Browse Subject Areas

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The Sex Determination Gene Shows No Founder Effect in the Giant Honey Bee, Apis dorsata

  • Zhi Yong Liu ,

    Contributed equally to this work with: Zhi Yong Liu, Zi Long Wang

    Affiliations Honeybee Research Institute, Jiangxi Agricultural University, Nanchang, China, Experimental Animal Center, Institute of Occupational Disease Prevention, Nanchang, China

  • Zi Long Wang ,

    Contributed equally to this work with: Zhi Yong Liu, Zi Long Wang

    Affiliation Honeybee Research Institute, Jiangxi Agricultural University, Nanchang, China

  • Wei Yu Yan,

    Affiliation Honeybee Research Institute, Jiangxi Agricultural University, Nanchang, China

  • Xiao Bo Wu,

    Affiliation Honeybee Research Institute, Jiangxi Agricultural University, Nanchang, China

  • Zhi Jiang Zeng ,; (ZYH)

    Affiliation Honeybee Research Institute, Jiangxi Agricultural University, Nanchang, China

  • Zachary Y. Huang; (ZYH)

    Affiliations Department of Entomology, Michigan State University, East Lansing, Michigan, United States of America, Ecology, Evolutionary Biology and Behavior Program, Michigan State University, East Lansing, Michigan, United States of America

The Sex Determination Gene Shows No Founder Effect in the Giant Honey Bee, Apis dorsata

  • Zhi Yong Liu, 
  • Zi Long Wang, 
  • Wei Yu Yan, 
  • Xiao Bo Wu, 
  • Zhi Jiang Zeng, 
  • Zachary Y. Huang



All honey bee species (Apis spp) share the same sex determination mechanism using the complementary sex determination (csd) gene. Only individuals heterogeneous at the csd allele develop into females, and the homozygous develop into diploid males, which do not survive. The honeybees are therefore under selection pressure to generate new csd alleles. Previous studies have shown that the csd gene is under balancing selection. We hypothesize that due to the long separation from the mainland of Hainan Island, China, that the giant honey bees (Apis dorsata) should show a founder effect for the csd gene, with many different alleles clustered together, and these would be absent on the mainland.

Methodology/Principal Findings

We sampled A. dorsata workers from both Hainan and Guangxi Provinces and then cloned and sequenced region 3 of the csd gene and constructed phylogenetic trees. We failed to find any clustering of the csd alleles according to their geographical origin, i.e. the Hainan and Guangxi samples did not form separate clades. Further analysis by including previously published csd sequences also failed to show any clade-forming in both the Philippines and Malaysia.


Results from this study and those from previous studies did not support the expectations of a founder effect. We conclude that because of the extremely high mating frequency of A. dorsata queens, a founder effect does not apply in this species.


In honey bees (genus Apis), as in other hymenopteran insects, sex is controlled by a mechanism named complementary sex determination (csd) [1], [2]. Diploid heterozygotes become females, while haploids develop into males. When the two copies of csd alleles are homozygous, the individual develops into a diploid male, which is eaten by workers [3]. Therefore, honey bees are under great selective pressure to become heterozygous. This complementary sex determination theory remained a hypothesis until recently. Beye et al. [4] cloned the csd gene by positional cloning and RNA interference. They found that this gene maintains many highly variable alleles in a group and no transcription difference exist between the sexes. Csd encodes an arginine serine-rich (SR) type protein, which contains an RS domain in the middle and a proline-rich region at its C terminus, between these two domains is a hypervariable region that differs highly among alleles and has variable numbers of asparagines/tyrosine repeats. The honey bee csd is homologous to Drosophila tra, which is involved in Drosophila sex determination.

Previous studies have shown that csd is evolving under balancing selection, and several parts of the coding region are possible targets of selection [5][9]. Moreover, the polymorphic level is approximately seven times higher in csd than in the neutral regions [8]. Although a previous study found no “bottleneck” effect in the csd gene of A. dorsata and A. mellifera, but suggestive of such an effect in A. cerana [9], the Hainan Island in China provides a more specific opportunity to test whether the csd gene has a founder effect. Hainan Island in China was thought to have been separated from the mainland about 20 million years ago [10]. The width of the Qiongzhou Strait separating Hainan Island from the mainland is about 18–33 km (Fig. 1). The maximum distance of Apis mellifera queen mating fight is about 15 km [11], but most of the queens mated at a distance of 7.5 km or less.

Figure 1. A map showing the strait between Hainan Island and Guangxi Province and the geographical distribution of the collected samples in this study.

It was suggested that Apis dorsata drones have “significantly shorter drone flight distance” compared to A. mellifera [12]. Regardless, the 18 km distance of the narrowest distance in the straight should be far enough to prevent any gene exchange between the A. dorsata populations in the island and the mainland. It is believed that the csd gene is under balancing selection, that is, it is under positive selection to create more alleles to avoid becoming homozygous, but at the same time alleles are lost due to sampling effect, creating a balancing force. If the A. dorsata population on Hainan Island has been separated from these on the mainland for more than 20 million years, we expect that due to the founder effect [13], the island should have many different alleles of csd compared to the mainland due to the initial sampling and then the expansion of the initial population. In addition, the island population should be under stronger selection force due to a smaller initial subset of the mainland csd alleles. This can be manifested by showing a higher nucleotide diversity value, due to either a higher level of polymorphism or a higher mutation rate. In this study we tested whether island A. dorsata populations experience the founder effect and stronger positive selection by comparing csd genes in workers sampled on the island and those on the mainland.


Samples collection

A. dorsata samples were collected from two provinces of China, Hainan Province, and Guangxi Province. The Hainan and Guangxi provinces are geographically separated by the Qiongzhou Strait. In each province, three A. dorsata colonies were collected, with 30 adult workers from each colony. In Hainan, two colonies were sampled from Qiongzhong County and one colony from Baoting County; and in Guangxi, two colonies were sampled from Chongzuo County and one from Wuming County. The A. dorsata in China are feral and usually nest on tall trees, adult workers were collected from colonies nested in trees using a net after climbing up the tree. The samples were first collected into 95% ethanol and then stored at −70°C until use.

DNA extraction

Total genomic DNA was extracted from the head and thorax of each sampled bee according to the protocol of the Animal Genomic DNA Extraction Kit (BEST ALL-HEAL LLC, NY, USA)

PCR and sequencing

The primers used for amplifying region 3 of A. dorsata csd gene in this study were designed by consulting those reported by [8] with some modifications. The primers are 5′ AATTGGATTTATTAATATAATTTATTATTCAGG 3′ (forward) and 5′ ATYTCATTATTCAATATGTTNGCATCA 3′ (reverse). High Fidelity LA Tag DNA polymerase (BEST ALL-HEAL LLC, NY, USA) was used for all PCR reactions. PCR conditions were denaturation at 94°C for 3 min, followed by 30 cycles of 94°C for 30 s, annealing at 54°C for 30 s and extension at 72°C for 2 min, with a final extension at 72°C for 7 min. PCR products were purified by using DNA GEL EXTRACTION kits (BEST ALL-HEAL LLC, NY, USA) and cloned into pEASY-T3 vectors (Transgene, Beijing, China). To obtain as many csd alleles as possible, the genomic region 3 of csd gene was cloned from each sample, and 1–3 clones of each cloned fragment were subjected to double-strand sequencing. Single-sequencing reads were assembled by using Seqman program in DNAstar software [14].

Definition of csd alleles

To avoid the effect of neutral mutation on our results, we adopted the method used by Hasselmann et al. [9], we classified those sequence variants that form a bush-like structure in the tree as neutral variants of a single allele. In each neutral cluster, only one sequence was chosen as an allele for further analysis, while the remaining sequences of the same cluster were excluded. We identified these clusters by π estimates and Z test on the whole genome sequences as well as the coding sequences of these alleles. Similar to Hasselmann and Beye [9], we found that using this method, sequences classified as neutral variants had the same repeat structure in the hyhpervariable region, while those identified as alleles were unique in that region.

Sequence analysis

Sequences of A. dorsata csd genomic region 3 (N = 42 sequences) published by other research groups were downloaded from Genbank under accession numbers DQ325038 - DQ325060 and EU100917- EU100935, repetitive sequences were removed and the remaining sequences (N = 31) were used for phylogenetic analysis together with our sequences. Exons, introns and coding regions of these sequences were determined by consulting those sequences of csd genomic region 3 reported by [8]. Nucleotide sequence alignments were performed with Clustal X version 1.8 [15], the alignment results were adjusted manually for obvious alignment errors.

DAMBE 4.1.19 [16] was used to identify haplotypes. Phylogenetic trees were constructed using MEGA version 4.0 program [17]. The minimal evolution (ME) method and Kimura's 2-parameter distances were adopted to obtain an unrooted tree with 2,000 bootstrap replications. Nucleotide diversity (π) and gene flow value (Nm) were calculated by using DNAsp5.0 program [18]. Two tailed Z test was used to detect significant differences between π values of Guangxi and Hainan populations. Pair-wise Fst distances were computed using ARLEQUIN 3.1 software [19]. Jost D test was performed at the website based program SMOGD with 200 bootstrap replicates [20]. Median joining (MJ) network was drawn using the program Network 4.5 [21].


csd variation in Guangxi and Hainan populations

For the csd gene region 3, we obtained a total of 63 and 55 different sequence variants from Guangxi and Hainan populations, respectively. These 63 and 55 sequence variants were respectively aligned and genealogy trees were constructed. After removing neutral variants, 17 different alleles from Guangxi and 18 different alleles from Hainan province were chosen for further analysis. Of them, 5 alleles were shared by both Guangxi and Hainan populations, resulting in a total of 30 haplotypes. To verify that our sequences were indeed csd gene, we compared our sequences with those Apis dorsata csd allele sequences reported by Hasselmann et al. [9] through amino acid sequence alignment (Figure S1). The alignment results showed that our sequences were highly similar to those csd alleles reported by Hasselmann et al. [9]. For example, each of our alleles contained a hypervariable region between the arginine/serine-rich (RS) domain and the proline rich domain, just as reported in [9]. The hypervariable region was rich in asparagine (N) and tyrosine (Y) that form (N)1–4Y repeats and (KHYN)1–4 repeats in each allele.

The nucleotide diversity values (π) of csd in Guangxi and Hainan populations were 0.06123±0.00576 and 0.05271±0.00631, respectively, without a significant difference between the two (two tailed Z test, Z = 0.997, P>0.05, Table 1). Moreover, the nucleotide diversity values of coding region, exon region and intron region of csd alleles also showed no significant differences between these two locations (Table 1).

Table 1. Nucleotide diversity (π) (mean ± SD) of csd alleles in Hainan and Guangxi populations.

Genetic differentiation between Guangxi and Hainan populations

The population pairwise Fst genetic distance between Guangxi and Hainan populations was 0.00236. The gene flow value (Nm) between these two populations was 10.71. The harmonic mean of Dest value between them was −0.03.

Phylogeny of Apis dorsata csd alleles

When all the alleles form Guangxi and Hainan populations were used to construct a phylogenic tree by using the ME method, csd alleles did not form two branches reflecting the Guangxi and Hainan samples. Rather, the two groups were well mixed among each other (Fig. 2). A median joining network was constructed based on the 30 haplotypes to investigate the possible relationships among these haplotypes (Fig. 3). The network suggests that the haplotypes from the same population varied greatly, and haplotypes from different geographical populations were intermixed. We then constructed another tree using ME method, using the coding region of all the available csd data for A. dorsata, including these obtained in our current study, and that from [8] and [9] (Fig. 4). Again, it showed very little or no clustering according to geographical origins of each csd allele.

Figure 2. The gene genealogy of csd alleles in region 3 from Guangxi and Hainan A. dorsata populations.

The minimum evolution method and Kimura's two parameter distances were used to construct the tree. Bootstrap percentages are shown on internal branches. The scale bar represents the number of nucleotide changes per site. Geographical origin is indicated by letters: HN, Hainan; GX, Guangxi.

Figure 3. The median joining network of 30 haplotypes in Guangxi and Hainan populations.

Circles denote haplotypes unique to Guangxi (yellow), or unique to Hainan (blue), or in both Guangxi and Hainan (half yellow and half blue). The sizes of circles are proportional to haplotype frequencies.

Figure 4. The gene genealogy of region 3 of the A. dorsata csd alleles from this study and those from Cho et al. 2006 [8] and Hasselmann et al. 2008 [9].

The coding sequences of all the alleles were used. The minimum evolution method and Kimura's two parameter distances were used to construct the tree. Bootstrap percentages are shown on internal branches. The scale bar represents the number of nucleotide changes per site. Amcsd-AW4B and Amcsd-AW5A, both from the Western honey bee Apis mellifera, were used as outgroup sequences.


Contrary to our original hypothesis, we did not find an expansion of csd alleles in Apis dorsata at the Hainan province, which would manifest as a different clade in a phylogenetic tree (Fig. 2). Furthermore, after we combined sequence data from our study and previous studies [8], [9], we failed to find any clustering of A. dorsata csd alleles from other islands such as the Philippines and Malaysia. The separation times of these two regions from the mainland were believed to be 23 million and 40 million years, respectively [22]. Our results are consistent with a previous study by Hasselmann et al. [9] showing that the csd genes of A. mellifera, and A. dorsata not showing a bottleneck effect. Further, their csd geneaology tree (Fig. 2) showed a similar intermix of csd alleles originating from Malaysia and Thailand.

The Fst distance between the Hainan and Guangxi A. dorsata populations was 0.236%, that is, 99.764% of genetic variation was within populations and 0.236% was among populations. In general, Fst<5% indicates a low level of genetic differentiation [23]. There was also a high gene flow value (Nm = 10.71) between these two populations, suggesting frequent exchange of genetic material between these two populations in history. All these results demonstrated that the genetic differentiation between these two populations was very low.

The lack of geographical clustering of A. dorsata alleles and the small genetic difference between the Hainan and Guangxi populations can be explained by two possible hypotheses. One is that our original assumption of the separation time between Hainan and the mainland was not accurate. Indeed, the separation time of Hainan from the mainland remains a mystery. While [10] cited a separation time of 20 million years, others claim the separation was not stable and the straight was dried and refilled many times since then [24]. The most recent separation was believed only to be 15,000 years ago. If the second estimate is correct, then we do not expect any csd changes in such a short time frame.

The alternative hypothesis is that even if the separation time is indeed 20 million years, one still would not expect a founder effect in the csd gene due to the particularity of honey bee biology. This is due to the highly polyandrous nature of honey bees, especially for A. dorsata. Previous reports for the queen mating frequency is 20–26 times for A. dorsata [25], [26], but a more recent study reported that the maximum number of subfamilies found per colony is 102 and the effective mating frequency is 88.5 [27]. The total number of csd alleles world wide is probably well under 100, and in a particular region is more likely to be about 20–30 ([5][7], this study). Therefore, even if only one colony of A. dorsata was “sampled” to be on the Hainan island during the separation (which is a highly unlikely low number), there would still be enough csd alleles preserved in the island to prevent the occurrence of any founder effect. This is confirmed by results of analysis after including the csd data from other island like countries, such as the Philippines and Malaysia (Fig. 4).

Our current study therefore suggests that due to the highly polyandrous nature of honey bees, the founder effect does not apply to the csd gene in Apis dorsata, perhaps also to any other gene, to most Apis species. Consistent with this idea, a previous study [28] on Africanized bees in Costa Rica also showed that “that Africanized honey bee populations are very representative of the genetic variation of African bees from the Transvaal region of South Africa.” In contrast, in social insects that have no multiple matings, such as the fire ant Solenopsis invicta, a founder effect was found in their sex determination system [29].

Supporting Information

Figure S1.

Amino acid sequence alignment of region 3 of the Apis dorsata csd alleles from this research (those started with Adcsd) and those reported by Hasselmann et al. 2008 [9] (those started with Dors). A total of 54 predicted amino acid sequences were used. Alignment was done by Clustal X version 1.8 software. The alignment suggests that our sequences from DNA are truly csd alleles because they are structurally highly similar to those of [9] which were from cDNA. Both our sequences and those from Hasselmann et al. [9] contain the arginine/serine-rich (RS) domain, the hypervariable region, and the proline rich domain. Furthermore, number 53 (this study) and number 54 [9] are identical in all amino acid sequences. Others, such as 29, 30, 31 only show small differences (2 in RS domain, 1 in proline rich domain), other than the differences in the hypervariable region.



We thank Junjun Hu from Guangxi and Tianbing Wang from Hainan for sampling honey bees; Soochin Cho, Melissa Huang, Katrina Klett and Matthew Lundquist for improving this manuscript.

Author Contributions

Conceived and designed the experiments: ZYH ZJZ. Performed the experiments: ZYL ZLW. Analyzed the data: ZLW. Contributed reagents/materials/analysis tools: WYY XBW. Wrote the paper: ZYH ZYL ZJZ.


  1. 1. Cook JM (1993) Sex determination in the hymenoptera: a review of models and evidence. Heredity 71: 421–435.
  2. 2. Heimpel GE, De Boer JD (2008) Sex determination in the hymenoptera. Annu Rev Entomol 53: 209–230.
  3. 3. Woyke J (1963) What happens to diploid drone larvae in a honeybee colony. J Apicult Res 2: 73–76.
  4. 4. Beye M, Hasselmann M, Fondrk MK, Page RE, Omholt SW (2003) The gene csd is the primary signal for sexual development in the honeybee and encodes an SR-type protein. Cell 114: 419–429.
  5. 5. Hasselmann M, Beye M (2004) Signatures of selection among sex-determining alleles of the honey bee. Proc Natl Acad Sci USA 101: 4888–4893.
  6. 6. Hasselmann M, Beye M (2006) Pronounced differences of recombination activity at the sex determination locus of the honeybee a locus under strong balancing selection. Genetics 174: 1469–1480.
  7. 7. Charlesworth D (2004) Sex determination: balancing selection in the honey bee. Curr Biol 14: 568–569.
  8. 8. Cho S, Huang ZY, Green DR, Smith DR, Zhang J (2006) Evolution of the complementary sex-determination gene of honey bees: Balancing selection and trans-species polymorphisms. Genome Res 16: 1366–1375.
  9. 9. Hasselmann M, Vekemans X, Pflugfelder J, Koeniger N, Koeniger G, et al. (2008) Evidence for convergent nucleotide evolution and high allelic turnover rates at the complementary sex determiner gene of Western and Asian honeybees. Mol Biol Evol 25: 696–708.
  10. 10. Huang FS (2002) Forest insects in Hainan. Beijing: Science Press. 1064 p.
  11. 11. Jensen AB, Palmer KA, Chaline N, Raine NE, Tofilski , et al. (2005) Quantifying honey bee mating range and isolation in semi-isolated valleys by DNA microsatellite paternity analysis. Conservation Genetics 6: 527–537.
  12. 12. Koeniger N, Koeniger G, Tingek S, Kalitu A, Mardan M (1994) Drones of Apis dorsata (Frabircius 1793) congregate under the canopy of tall emergent trees in Borneo. Apidologie 25: 249–264.
  13. 13. Provine WB (2004) Ernst Mayr: Genetics and speciation. Genetics 167(3): 1041–1046.
  14. 14. Burland TG (2000) DNASTAR's Lasergene sequence analysis software. Methods Mol Biol 132: 71–91.
  15. 15. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876–4882.
  16. 16. Xia X, Xie Z (2001) DAMBE: Software package for data analysis in molecular biology and evolution. J Hered 92: 371–373.
  17. 17. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol and Evol 24: 1596–1599.
  18. 18. Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451–1452.
  19. 19. Excoffier L, Laval G, Schneider S (2005) Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol Bioinform 1: 47–50.
  20. 20. Crawford NG (2010) Smogd: software for the measurement of genetic diversity. Mol Ecol Resour 10: 556–557.
  21. 21. Bandelt H, Forster P, Rohl A (1999) Median joining networks for inferring intraspecific phylogenies. Mol Biol Evol 16: 37–48.
  22. 22. Soulier-Perkins A (2000) A phylogenetic and geotectonic scenario to explain the biogeography of the Lophopidae (Hemiptera, Fulgoromorpha). Palaeogeogr Palaeocl 160(3–4): 239–254.
  23. 23. Hartl DL, Clark AG (1997) Principles of Population Genetics, 3 ed. Sunderland: Sinauer Associates Press. 542 p.
  24. 24. South China Sea Institute of Oceanology (1978) Quaternary Littoral Geology of South China. Beijing: Science Press. pp. 15–54.
  25. 25. Moritz RFA, Kryger P, Koeniger G, Estoup A, Tingek S, et al. (1995) High degree of polyandry in Apis dorsata queens detected by DNA microsatellite variability. Behav Ecol Sociobiol 37: 357–363.
  26. 26. Oldroyd BP, Smolenski AJ, Cornuet JM, Wongsiri S, Estoup A, et al. (1996) Levels of polyandry and intracolonial genetic relationships in Apis dorsata (Hymenoptera Apidae). Ann Entomol Soc Am 89: 276–283.
  27. 27. Wattanachaiyingcharoen W, Oldroyd BP, Wongsiri S, Palmer K, Paar J (2003) A scientific note on the mating frequency of Apis dorsata. Apidologie 34: 85–86.
  28. 28. Segura JAL (2000) Highly polymorphic DNA markers in an Africanized honey bee population in Costa Rica. Genetics and Molecular Biology 23: 317–322.
  29. 29. Ross KG, Vargo EL, Keller L, Tragers JC (1993) Effect of a founder event on variation in the genetic sex-determining system of the fire ant Solenopsis invicta. Genetics 135: 843–854.