Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Overexpression of DNA Polymerase Zeta Reduces the Mitochondrial Mutability Caused by Pathological Mutations in DNA Polymerase Gamma in Yeast

  • Enrico Baruffini ,

    enrico.baruffini@nemo.unipr.it

    Affiliation Department of Genetics, Biology of Microorganisms, Anthropology, Evolution, University of Parma, Parma, Italy

  • Fausta Serafini,

    Affiliation Department of Genetics, Biology of Microorganisms, Anthropology, Evolution, University of Parma, Parma, Italy

  • Iliana Ferrero,

    Affiliation Department of Genetics, Biology of Microorganisms, Anthropology, Evolution, University of Parma, Parma, Italy

  • Tiziana Lodi

    Affiliation Department of Genetics, Biology of Microorganisms, Anthropology, Evolution, University of Parma, Parma, Italy

Overexpression of DNA Polymerase Zeta Reduces the Mitochondrial Mutability Caused by Pathological Mutations in DNA Polymerase Gamma in Yeast

  • Enrico Baruffini, 
  • Fausta Serafini, 
  • Iliana Ferrero, 
  • Tiziana Lodi
PLOS
x

Abstract

In yeast, DNA polymerase zeta (Rev3 and Rev7) and Rev1, involved in the error-prone translesion synthesis during replication of nuclear DNA, localize also in mitochondria. We show that overexpression of Rev3 reduced the mtDNA extended mutability caused by a subclass of pathological mutations in Mip1, the yeast mitochondrial DNA polymerase orthologous to human Pol gamma. This beneficial effect was synergistic with the effect achieved by increasing the dNTPs pools. Since overexpression of Rev3 is detrimental for nuclear DNA mutability, we constructed a mutant Rev3 isoform unable to migrate into the nucleus: its overexpression reduced mtDNA mutability without increasing the nuclear one.

Introduction

In yeast, DNA polymerase zeta (Pol zeta) and Rev1 are involved in the error-prone translesion synthesis (TLS) during replication of nuclear DNA: mutations in any of these polymerases lead to a decrease of mutagenesis in nuclear genome either in normal conditions or in conditions known to increase DNA damage such as UV treatment [1]. The yeast Pol zeta is composed by a catalytic subunit encoded by REV3 and an accessory subunit encoded by REV7. Biochemically, Pol zeta is a poorly processive enzyme [2], lacks of a 3′-5′ exonucleolytic proofreading activity [3] and is able to extend terminally mismatched primers [4][6]. From these properties derives its propensity to generate mutations. On the contrary, Pol zeta is very inefficient in inserting nucleotides opposite lesions in vitro, suggesting that a distinct polymerase should act in this first step and that Pol zeta can efficiently extend from primer-terminal base pairs containing mismatches or lesions [6].

Rev1 encodes for a deoxycytidyl transferase that preferentially incorporates C opposite to an abasic site [7]. Also, Rev1 interacts in vitro with Pol zeta through a Rev3-Rev1 binding and this interaction strongly stimulates the activity of Pol zeta and, probably, contributes to its targeting to the replication fork [8].

Recently, it was found that Pol zeta and Rev1 localize in mitochondria and that they participate in the mitochondrial DNA mutagenesis, since disruption of REV3, REV7 or REV1 resulted in a strongly decreased frequency of −1 frameshift mutations in mtDNA [9]. On the contrary, it was shown that deletion of REV3, REV7 or REV1 resulted in increased frequencies of both spontaneous and UV-induced mitochondrial erythromycin resistance, due to base substitutions [10]. On the basis of their results, these authors speculated that, in absence of the TLS by Rev1 and/or Pol zeta, the mitochondrial DNA polymerase gamma (Pol gamma), the mitochondrial replicase, could create mutations in efforts to bypass lesions that block the replication fork [10]. As a consequence, Pol zeta and Rev1, which in the nucleus are responsible with other DNA polymerases for the error-prone bypass of DNA lesions, in the mitochondrial compartment function in a less mutagenic pathway [10].

Pol gamma is a protein conserved in fungi and animals. Structurally, human Pol gamma is a heterotrimer composed by one catalytic subunit, encoded by POLG, and two accessory subunits, encoded by POLG2 [11]. The catalytic subunit contains an N-terminal 3′-5′ exonuclease domain (residues 170–440), a C-terminal polymerase domain (residues 440–475 and 785–1239) and a spacer region encompassing residues 475–785 [12]. To date, more than 150 pathological mutations in POLG have been identified in severe mitochondrial disorders (http://tools.niehs.nih.gov/polg/) and, among them, a few mutations have been recently described in stavudine induced toxicity [13], [14], in valproate induced hepatotoxicity [15], [16] and in breast tumorigenesis [17]. This places POLG as a major locus for mitochondrial diseases and disorders.

In yeast the DNA polymerase gamma, encoded by MIP1 gene, is composed by a sole catalytic subunit [18]. Thanks to the similarity between human Pol gamma and Mip1 (approximately 43%), yeast has been used to validate the role of human putative pathological mutations, to understand the biochemical consequences associated to these mutations, to study the pharmacogenetics of drugs such as valproate and stavudine, and to find mechanisms able to rescue the detrimental effects of Mip1 mutations [16], [19][28]. Since a therapy has not been yet developed for mitochondrial diseases caused by POLG mutations, a major goal of the research involving yeast/animal models is to find new strategies to rescue the pathological phenotypes associated to these mutations.

Yeast is a suitable model organism to study the effects of nuclear mutations affecting mtDNA stability, thanks to its ability to survive in absence of a functional mitochondrial genome and to the possibility to easily analyze mtDNA mutability. Yeast cells containing deletions-carrying mtDNA, called rho-, or cells which have completely lost mtDNA, called rho0, are respiratory deficient and produce colony of small size, called petite. rho cells, which arise more frequently than rho0 cells, retain only small fragments of wt mtDNA, from 30% to less than 1% (reviewed in [29]). Although the mechanisms thanks to which rho mutations arise are not fully know, analysis of the regions flanking the deleted regions suggest that mtDNA of some of these rho cells derives from recombination between direct repeats flanking the deleted region with consequent excision [29]. In addition, deletions do not occur randomly at all. As a matter of fact, some fragments, encompassing COB, COX2 and COX3 genes, are most frequently retained [29]. These large deletions make mtDNA irreversibly unfunctional. In S. cerevisiae, petite mutants arise spontaneously with high frequency (approximately 10−2) [29]. The frequency of petite mutants is a measure of mtDNA extended mutability and is an index of mtDNA instability. Extended mutability is indeed a series of large deletions (generally >70%) that arise spontaneously, and partially randomly, in the mtDNA, without involvement of point mutations. Mutations in a large group of nuclear genes, encoding for proteins directly or indirectly involved in mtDNA replication, recombination, stability and maintenance (reviewed in [30]) produce increase of petite mutability. mtDNA point mutations can be also easily measured as frequency of spontaneous mutants resistant to erythromycin (EryR mutants), an antibiotic that inhibits mitochondrial but not cytoplasmic translation. In fact, resistance to erythromycin is acquired through specific transversions or transitions in the mitochondrial gene encoding the 21 S rRNA, in particular at 1950, 1951, 1952 and 3993 positions [31][34]. EryR mutants arise spontaneously approximately at a frequency of 10−7–10−8. EryR mutability is influenced by replication fidelity of DNA polymerase gamma as well as by the activity of some enzymes involved in mtDNA repair and/or recombination [34][37].

In an attempt to investigate about genetic conditions that might reduce the damages caused by mutations in POLG, we analyzed the effect of deletion or overexpression of TLS polymerases that, together with DNA polymerase gamma, are present in mitochondria, Pol zeta (Rev3–Rev7) and Rev1. Genetic tests based on gene overexpression are widely used in yeast to assess a role of a gene function in a biological process. Several researches are reported where one or more proteins were overexpressed with this aim, among which a study showing that overexpression of Rev3 led to increasing UV-induced mutagenesis [38]. In addition, gene overexpression is commonly used to rescue the phenotypic defects caused by mutations in another gene which is functionally associated. For example, in the case of MIP1, overexpression of RNR1, encoding the large subunit of the ribonucleotide reductase, lead to the discovery that increased levels of dNTP pools reduced the extended mutability caused by mutations in Mip1 [19], [26], [39]. This finding has had impacted also in studies on human DNA polymerase gamma pathological mutations [26], where, starting from analysis in yeast, it has been shown that human DNA polymerase gamma harboring the pathological mutation H932Y has a ∼200-fold reduced affinity to the incoming dNTPs.

Here we found that increased expression of Pol zeta resulted in a significant reduction of extended mutability caused by mutations mapping in different domains of MIP1 and that overexpression of both Pol zeta and Rev1 led to a reduction in mtDNA point mutability.

Materials and Methods

Yeast strains and media

The yeast strains used in this work are DWM-5A (Matα ade2-1 leu2-3,112 ura3-1 trp1-1 his3-11,15 can1-100 mip1::KanR), DYY-4C (Mata ade2-1 leu2-3,112 ura3-1 trp1-1 his3-11,15 can1-100 mip1::KanR sml1::HIS3) [19], W303-1A CANS (Matα ade2-1 leu2-3,112 ura3-1 trp1-1 his3-11,15) (a kind gift from Antoni Barrientos, University of Miami Miller School of Medicine, Miami, FL, USA), W303-1B (Mata ade2-1 leu2-3,112 ura3-1 trp1-1 his3-11,15 can1-100) [40], BY4742 rev1Δ (Matα, his3Δ1, leu2Δ0, lys2Δ0, ura3Δ0 rev1::KanR), BY4742 rev7Δ (Matα, his3Δ1, leu2Δ0, lys2Δ0, ura3Δ0 rev7::KanR) (Euroscarf collection), DWM-5Ar3 (Matα ade2-1 leu2-3,112 ura3-1 trp1-1 his3-11,15 can1-100 mip1::KanR rev3::HphR), DWM-9A (Matα ade2-1 leu2-3,112 ura3-1 trp1-1 his3-11,15 can1-100 mip1::HphR) [41], DWM-9Ar1 (Matα ade2-1 leu2-3,112 ura3-1 trp1-1 his3-11,15 can1-100 mip1::HphR rev1::KanR), DWM-9Ar7 (Matα ade2-1 leu2-3,112 ura3-1 trp1-1 his3-11,15 can1-100 mip1::HphR rev7::KanR).

Synthetic defined medium (SD) contained 6.9 g/l yeast nitrogen base without amino acids (Formedium), synthetic complete medium (SC) was SD supplemented with 1 g/l drop out mix [42]. YP medium contained 1% yeast extract (Formedium) and 2% peptone (Formedium), and YPA medium was YP supplemented with 40 mg/ml adenine base (Formedium). Carbon sources were added as indicated in the text. YPAEG-Ery contained 1% yeast extract (Difco), 2% Bacto-peptone (Difco), 40 mg/l adenine base, 25 mM potassium phosphate pH 6.5, 3% ethanol, 3% glycerol and 3 g/l erythromycin (Sigma). CAN plates was SD medium supplemented with 0.006% L-canavanine sulfate (Sigma), amino acids and bases necessary to complement the auxotrophy and 2% glucose.

Plasmids construction

The DNA constructions produced in this work were obtained using plasmids pFL38, which is centromeric and brings the URA3 marker, pFL39 (centromeric, TRP1 marker) [43], YEplac195 (multicopy, URA3 marker), YEplac181 (multicopy, LEU2 marker) [44], pUG35 (centromeric, URA3 marker, for EGFP fusion) (http://mips.helmholtz-muenchen.de/proj/yeast/info/tools/hegemann/gfp.html), pTL85 (multicopy, KanMX4 marker, for EGFP fusion) [41] and pAG32, an integrative plasmid used as template for gene disruption with the HphMX4 cassette [45].

Plasmids pFL38-MIP1 and pFL39 harboring wt or mutant mip1 alleles have been previously described [19]. YEplac195-REV3 was obtained by PCR-amplification of REV3, including the upstream and the downstream regions, from genomic DNA of strain DWM-5A with primers REV3-Fw (gcgcgggtaccggatccaagaatccctgtgg) and REV3-Rv (gcgccgaattccttagaggatacgaagattcc), digestion with KpnI and EcoRI of both the PCR fragment and YEplac195 and ligation. YEplac195-REV7 was obtained by PCR-amplification of REV7 from genomic DNA of strain DWM-5A with primers REV7-Fw (gcgccgtcgacgatgaatgggaaaagaagtgc) and REV7-Rv (gcgcgggtacccatggaaccagacagaagacc), digestion of both the PCR fragment and YEplac195 with SalI and KpnI and ligation. YEplac195-REV3/REV7 was obtained by subcloning REV7 from YEplac195-REV7 to YEplac195-REV3 digested with SalI and KpnI. YEplac181-REV1 was obtained by PCR amplification of REV1 from genomic DNA of strain BY4742 with primers REV1-Fw (cggcgggtcgacgtgaagtgatcatgcacatcg) and REV1-Rv (cggccggtacccttacgcatttctactgttgg), digestion of both the PCR fragment and YEplac181 with SalI and KpnI and ligation. pUG35-REV3 was obtained by PCR amplification of REV3 ORF from genomic DNA of strain DWM-5A with primers REV3GFPFw (ccgccgaattcatgtcgagggagtcgaacgacac) and REV3GFPRv (ccgccgtcgacccaatcatttagagatattaatgc), digestion of both the PCR fragment and pUG35 with EcoRI and SalI and ligation in order to clone REV3 in frame with the EGFP gene. pTL85-REV3 was obtained by subcloning REV3 from pUG35-REV3 to pTL85 digested with XbaI and SalI. The REV3 DNA region corresponding to the amino acid stretch 1 to 534 was cloned in frame with the EGFP gene of pUG35 by amplification of the fragment from genomic DNA of strain BY4742 with primers REV3GFPFw and R3GFPRvS (ggcccgtcgaccagaatatcttgataaccg) and cloning it between the EcoRI and SalI sites. All the cloned fragments were sequenced to check for the absence of mutations.

REV3 mutagenesis

505–508 RKRKK stretch of Rev3 was mutagenized to AAAAA through the overlap extension technique [46]. In the first set of PCR reactions, the REV3 fragment encoding for the 1–534 Rev3 stretch was amplified with i) the primer REV3GFPFw and the mutagenic primer REV3NONSRV (cgtaatcccgcagccataaccGCcGCtGCgGCcGCagacagcaacgatgttttattagc), and ii) the mutagenic primer REV3NONSFW, complementary to REV3NONSRV, and the R3GFPRVS primer. The final mutagenized product was obtained by using the overlapping PCR fragments as template and REV3NONSFW and R3GFPRVS as external primers. The product was then digested with EcoRI and SalI and cloned in EcoRI-SalI digested pUG35.

To mutagenize YEPlac195-REV3, a fragment of REV3 was amplified with the primer REV3MUTFW (cattgagacaccaaagatgtgc) and with the mutagenic primer REV3NONSRV, and with the mutagenic primer REV3NONSFW and the primer REV3MUTRV (cagaatggaaatctattcctatc). The final product was obtained as above and was cloned in NgoMIV-SacI digested YEplac195-REV3. The entire cloned fragment was sequenced to confirm the presence of the mutations.

Disruption of REV3, REV7 and REV1

REV3 was disrupted in strain DWM-5A by using the HphMX4 cassette amplified from plasmid pAG32 [34] by using primers DELREV3FW (gttcataaaacgctggaagtaaaaattagggcatcctttaaaaggCCTTGACAGTCTTGACGTGC) and DELREV3RV (aagtaatcgaatacatttttcaataatcttctgctgggctgggatCGCACTTAACTTCGCATCTG), each of which contains a 5′ stretch complementary to a sequence internal to REV3 ORF and a 3′ stretch, in uppercase, complementary to the extremities of the HphMX4 cassette. Disruptants were as resistant to 250 µg/ml hygromycin B. Correct disruption was confirmed by PCR.

REV7 and REV1 were disrupted in strain DWM-5A9 by using the KanMX4 cassette. The disrupted rev7::KanR and rev1::KanR loci were amplified from strain BY4742 rev7Δ and BY4742 rev1Δ, respectively, by using primers external to the loci: REV7-Fw and REV7-Rv, or REV1-Fw and REV1-Rv. Disruptants were selected on YP supplemented with 200 µg/ml geneticin and disruption was confirmed by PCR.

Transformation of yeast strains

Yeast strains were transformed by lithium acetate methods [47]. We used the “Quick and easy method” (http://home.cc.umanitoba.ca/~gietz/Quick.html) in case of transformation with centromeric or episomal (multicopy) plasmids, and the “Best Method” (http://home.cc.umanitoba.ca/~gietz/method.html) in case of disruption cassettes.

Determination of mitochondrial and nuclear mutability

Petite frequency was determined as previously reported [48]. To determine the effect of antioxidant agents on the extended mtDNA mutability, wild-type and mutant strains, were grown on liquid SCD medium supplemented with 40 µM dihydrolipoic acid (Sigma) or 10 µM MitoQ (a kind gift from Luigi Palmieri, University of Bari, Italy) for two 24-hour growth cycles. Dihydrolipoic acid was supplemented from a 40 mM stock solution in ethanol, while MitoQ was supplemented from a 5 mM stock solution in DMSO. Control experiment in which equal amounts of ethanol (0.1%) or DMSO (0.2%) were added to untreated cells was done in parallel. For each strain/condition at least three independent experiments were performed on three independent clones. Statistical analysis of petite frequency was performed by a two-tailed t-test.

EryR mutant frequency was determined as previously reported [48]. Briefly, 15 independent colonies, isolated on SC medium supplemented with 2% glucose, were inoculated into 2 ml of SC liquid medium supplemented with 2% ethanol and grown to saturation (approximately 48 h). Cultures were then plated on YPAEG-Ery medium and dilutions were plated nonselectively on YP medium supplemented with 3% glycerol (300–500 colonies) for a total cell count. After 7 days incubation, EryR mutant frequency was determined by the method of the median [49]. Each experiment was repeated at least three times on two independent clones for each strain. Statistical analysis of EryR mutant frequency was performed by a one-tailed t-test.

Nuclear point mutability was evaluated by measuring the mutation rate of CanR mutants in strain W303-1A CANS, bearing the wt copy of CAN1, as previously reported [50], except that colonies were grown on SC medium supplemented with 2% glucose. Mutation rates were calculated using median values according to Lea and Coulson [49] by using the program FALCOR [51]. Rates are given as mean of four independent experiments in each of which 10 independent colonies for each clone were tested. Unpaired two-tailed t-test was used to evaluate the statistical significance.

In every test, frequencies or rates were considered significantly different when p<0.05.

Northern blot and semiquantitative RT-PCR

Total RNA was extracted from 10 ml of culture at a concentration of 1 OD600/ml, according to [52]. For Northern blot analysis, 25 µg of RNA were blotted according to [53]. The probes for hybridization were obtained by purifying the 1 Kb EcoRV fragment of REV3 and by amplifying REV7 with primers REV7N-Fw (gggtagagaagtggctgagg) and REV7N-Rv (ctcgccctcttcatattgag). Probes were labeled using [α-32P]dCTP and the kit ‘Rediprime II DNA Labelling System’ (GE Healthcare). Signals were acquired after different time exposures with Kodak films or with PhosphorImager and quantified by ImageQuant software (Molecular Dynamics).

For RT-PCR, 1.5 µg of RNA were treated with DNase (Invitrogen), precipitated and converted to cDNA with ProtoScript® M-MuLV First Strand cDNA Synthesis Kit (NEB) by using oligod(T). Semiquantitative PCR was performed by amplifying a fragment of REV1 cDNA with primers REV1rtFW (gtatattccagccgatcaaattcc) and REV1rtRV (cgtttggaagcctgaatgatcc) and, as control, a fragment of TAF10 DNA with primers FWTAF10 (atattccaggatcaggtcttccgtagc) and RVTAF10 (gtagtcttctcattctgttgatgttgttgttg). PCR samples were taken after 20, 23, 26, 29, 32 and 35 cycles, and aliquots of equal volume was loaded on a 0.8% agarose gel. Images were acquired by Kodak Digital Science D120 zoom digital camera, converted to gray scale with Photoshop; signals were quantified through Multianalyst software (Molecular Dynamics). To avoid saturation, signals were considered only if the signal deriving from the PCR amplification with 3-cycle less was 6–8-fold lower. Both in the case of Northern analysis and in the case of RT-PCR, relative levels of mRNA were quantified by comparison with a house-keeping gene signal (ACT1 or TAF10). All experiments were performed three times.

Fluorescence microscopy

Cells were grown in solid SC medium without methionine and supplemented with 2% glucose. After 24 hours, cells were resuspended in Tris–HCl 50 mM pH 7.5, incubated with 1 µg/ml DAPI (4′,6-diamidino-2-phenylindole) for 15 min on ice and observed with a 100× magnification using DAPI or FITC filters. Pictures were taken with constant parameters (100 ms exposure for DAPI and 250–500 ms exposure for GFP with Nikon ACT-1 acquisition software) and processed to optimize contrast and brightness with Adobe Photoshop 7.0.

Results

Pol zeta overexpression rescues the mtDNA mutability induced by specific mip1 mutations

We have previously constructed a set of Saccharomyces cerevisiae mip1 mutant alleles, corresponding to POLG pathological mutations, and determined their effects on mtDNA extended and point mutability (Table 1) [19][21], [23]. These mutant alleles localized in different Mip1 domains, displayed different in vivo and in vitro defects and behaved either as dominant or recessive (Table 1 and Figure 1).We analyzed the effect of overexpression and deletion of Pol zeta and Rev1 on the mtDNA mutability induced by these mip1 mutations, based on the recent finding that these polymerases were found in mitochondria, where Pol zeta and Mip1 belong to the same epistatic pathway [9].

thumbnail
Figure 1. Linear representation of human Polg and yeast Mip1 with the mutations used in this study.

NTD-Exo = N-terminal domain- 3′-5′ exonuclease domain. Pol = polymerase domain.

https://doi.org/10.1371/journal.pone.0034322.g001

thumbnail
Table 1. POLG human pathological mutations, associated syndromes, mip1 equivalent mutations analyzed in this study and phenotypes of mip1 mutant strains.

https://doi.org/10.1371/journal.pone.0034322.t001

REV3 and REV7 were cloned in the multicopy plasmid YEplac195 and introduced i) in the strain DWM-5A (mip1Δ) transformed with a number of recessive mip1 mutant alleles (haploid condition) and ii) in the strain W303-1B (MIP1) transformed with dominant mip1 mutant alleles (heteroallelic condition). Extended mtDNA mutability was first determined in these transformants by analyzing the frequency of spontaneous petite mutants.

In presence of overexpressed REV3, the level of petite mutants decreased; the rescue was mutation specific, being null for some mutations and significant for other ones (Figure 2). The strongest effect was observed for haploid strains bearing mutations G807R (50% reduction) and A692T (25% reduction). The REV7 overexpression, on the contrary, had slighter effects, which however were significant for mutations A692T and G807R (Figure 2A). In heteroallelic strains harboring wt MIP1 and dominant mip1E698G, mip1K749R or mip1Y757C mutant alleles (Figure 2B) no rescue was observed in the presence of either REV3 or REV7.

thumbnail
Figure 2. Petite frequency of mip1 strains overexpressing REV3, REV7, or both.

Petite frequency was measured as reported in Materials and Methods on three independent clones for each strain. All values are means at least of three independent experiments. (A) Haploid mutant strains harboring mip1 recessive mutant alleles. (B) Heteroallelic strains harboring MIP1 wt allele and mip1 dominant mutant alleles. For each mip1 allele, * indicates that the petite frequency is significantly lower (p<0.05) than that of strain transformed with the empty plasmid (YEplac195).

https://doi.org/10.1371/journal.pone.0034322.g002

We also evaluated the combined effects of REV3 and REV7 overexpression by cloning the two genes together in the YEplac195 plasmid. Northern blot analysis indicated that REV3 and REV7 were expressed at high level (10–12 fold increase of mRNA levels) when cloned either alone or together, demonstrating that their concomitant presence in the plasmid did not affect the level of their expression (Figure 3A). Overexpression of whole Pol zeta had the same effect than overexpression of Rev3 (Figure 2), suggesting that Rev3 alone was responsible of the observed rescue or that the physiological levels of Rev7, which is more abundant than Rev3 [54], were sufficient to ensure the highest level of rescue. However the slight decrease in petite frequency obtained overexpressing Rev7 alone suggests, as demonstrated below, that also Rev7 participates to the rescue and that the petite mutants' reduction observed is most likely due to a slight increase of the whole Pol zeta.

thumbnail
Figure 3. mRNA levels in overexpressing strains.

A. Northern blot mRNA expression of REV3 and REV7 in strains transformed with YEplac195 empty plasmid (1st lane), YEplac195-REV3 (2nd lane), YEplac195-REV7 (3rd lane) and YEplac195-REV3/REV7 (4th lane). Numbers indicate the fold increase of REV3 and REV7 levels in overexpressing strains. mRNA of the ACT1 gene was used as a control. B. RT-PCR on REV1 in strains transformed with YEplac81-REV1 and YEplac181 empty plasmid. cDNA of the TAF10 gene was used as control. Numbers over the gel indicate the number of PCR cycles, number under the gel indicate the fold increase of REV1 levels in overexpressing strains.

https://doi.org/10.1371/journal.pone.0034322.g003

Effect of REV3 deletion on extended and point mtDNA mutability

We next investigated the effect of REV3 deletion on mtDNA stability. No difference was observed between REV3 and rev3Δ regarding the frequency of petite mutants in strains harboring either wt MIP1 allele or mutant mip1 alleles, indicating that the REV3 deletion produced no effect on extended mutability (data not shown).

However, deletion of REV3 resulted in alteration of mtDNA point mutation, with 2.5 fold increase of EryR mutant frequency in the MIP1 wt strain, in agreement with results reported by Kalifa and Sia [10] (Table 2). In addition, strains carrying mip1C261R, mip1A692T and mip1G807R mutant alleles showed a further increase of EryR mutation (an increase of 3.9-, 3.3- and 5.1-fold, respectively) (Table 2), indicating that mutations in MIP1 and deletion of REV3 have a synergistic effect in rising point mutability. Furthermore, the ratios of EryR mutant frequencies of rev3Δ strains to REV3 wt strains parallelized the mutator phenotype of the mip1 mutant allele, being the lowest in mip1A692T strain showing a moderate increase of EryR frequency compared to wt MIP1 strain (approximately 3.4-fold), and being the highest in the strain mip1G807R showing an increase of 8.8 times the EryR frequency of MIP1 strain (Table 2). Therefore, Pol zeta is not physiologically involved in the maintenance of full mtDNA but is required for the fidelity of the mtDNA replication.

thumbnail
Table 2. EryR mutant frequency in wt and rev3Δ strains transformed with wt or mutant mip1 alleles.

https://doi.org/10.1371/journal.pone.0034322.t002

Effects of REV1 overexpression

Rev3 subunit of Pol zeta binds to Rev1, and the complex Pol zeta-Rev1 increases the efficiency of translesion synthesis by Pol zeta [8]. We tested whether overexpression of REV1, together with overexpression of Pol zeta, could further reduce the petite frequency due to mip1C261R, mip1A692T and mip1G807R mutant alleles. REV1 was cloned in the multicopy plasmid YEplac181 and introduced in strains overexpressing both REV3 and REV7 and carrying wt MIP1, mip1C261R, mip1A692T and mip1G807R mutant alleles. RT-PCR analysis confirmed that REV1 was 9–13-fold overexpressed in transformant cells (Figure 3B) and that REV3 and REV7 were overexpressed at the same levels (10–12 fold overexpression) as in strain not harboring YEplac181-REV1 (data not shown). Together with REV1, we overexpressed both REV3 and REV7, and not REV3 alone, because it is known that Rev1 can recruit Rev7 through a Rev3 independent Rev1-Rev7 binding thus depleting the levels of Rev7 [54]. REV1 overexpression did not alter the frequency of petite, both in presence and absence of overexpressed Pol zeta (Figure 4). This result indicates that either the physiological levels of REV1 are sufficient for the rescue by Pol zeta overexpressed or that Rev1 is not involved. Moreover, we observed that overexpression of both Pol zeta and Rev1, but not of either Pol zeta or Rev1 individually, resulted in a significant reduction of the EryR mutant frequency, in particular for the strain carrying the mutation G807R (Table 3). The results described here are symmetrical to those obtained previously by Kalifa and Sia [10], who showed an increase in EryR mutant frequency when REV1, REV3 or REV7 were disrupted

thumbnail
Figure 4. Petite frequency of mip1 mutant strains overexpressing Pol zeta, Rev1, or both.

Petite frequency was measured as in Figure 2.

https://doi.org/10.1371/journal.pone.0034322.g004

thumbnail
Table 3. EryR mutant frequency in mip1 mutant strains overexpressing REV3, REV7 and/or REV1.

https://doi.org/10.1371/journal.pone.0034322.t003

Rescue of extended mutability by Rev3 overexpression is Rev7 dependent and Rev1 independent

We tested whether the rescue by Rev3 overexpression was dependent on the physiological levels of Rev7 and Rev1. The deletion of REV1 or REV7 had no effect on petite mutability (data not shown). However, the rescue of petite mutability in MIP1 mutants, exerted by overexpressed Rev3, occurred only when Rev7 was present (Table 4), indicating that the whole Pol zeta participated in the rescue. We furthermore observed that overexpression of REV7 in a rev3Δ strain did not reduce petite frequency both in wt MIP1 and in mip1 mutant strains (data not shown), corroborating this hypothesis. Unlike Rev7, Rev1 was dispensable (Table 4), thus supporting the hypothesis reported in the previous paragraph that Rev1 did not participate in the rescue of the extended mutability.

thumbnail
Table 4. Petite frequency in mip1 mutant strains deleted of REV1 or REV7 and overexpressing REV3 and REV7.

https://doi.org/10.1371/journal.pone.0034322.t004

Combined action of REV3 overexpression and other chemical and genetic rescues

We have shown previously that a decrease of reactive oxygen species and/or an increase of the mitochondrial dNTP pool reduced the mtDNA extended mutagenesis induced by pathological Pol gamma mutations in yeast [19]. Several mutations in MIP1, but not all, were rescued, albeit at different extent, by treatment with dihydrolipoic acid or with the mitochondrial specific ROS scavenger MitoQ [21]. To know whether this effect could be increased by REV3 overexpression the petite frequency was measured either in haploid (Figure 5A) or in heteroallelic strains (Figure 5B) treated with these molecules. We found that there was a negative correlation between the rescue exerted by ROS scavengers and the rescue caused by REV3 overexpression (Figure 2 and Figure 5).

thumbnail
Figure 5. Petite frequency of mip1 strains treated with dihydrolipoic acid 40 µM (DHL) or 10 µM MitoQ.

Petite frequency was measured as reported in Materials and Methods on three independent clones for each strain at least twice. (A) Haploid mutant strains harboring mip1 recessive mutant alleles. (B) Heteroallelic strains harboring MIP1 wt allele and mip1 dominant mutant alleles. For each mip1 strain, * indicates that the petite frequency is significantly lower (p<0.05) than that of non-treated (NT) strain.

https://doi.org/10.1371/journal.pone.0034322.g005

In fact, in haploid strains harboring A692T and G807R mutations, whose effect was reduced by overexpression of Rev3, no rescue was exerted by dihydrolipoic acid or MitoQ. In contrast, ROS scavengers strongly mitigated the effect of mip1 mutations E698G, K749R, Y757C, that are insensitive to Rev3 overexpression.

The only exception was mutation C261R, whose effect was slightly rescued both by treatment with ROS scavengers and by Rev3 overexpression (Fig. 2A and Fig. 5A). In this case, the additive effect of Pol zeta overexpression and ROS scavengers (data not shown) suggested that two different mechanisms were involved in the reduction of petite mutability observed.

The second mechanism able to rescue the mip1 induced mtDNA extended mutability is the increase of the dNTP pools. In S. cerevisiae an increase of the dNTP pool was obtained either by overexpressing RNR1 gene, which encodes the large subunit of the ribonucleotide reductase or by deleting SML1 gene, which encodes an inhibitor of the latter activity [55]. It has been shown that overexpression of RNR1 or deletion of SML1, reduced the petite frequency in strains harboring specific MIP1 mutations [20], [26], [39], [55].

To evaluate the relationship between the rescue exerted by REV3 overexpression and the rescue exerted by increasing the dNTP pools, we deleted SML1 in strains harboring mip1C261R, mip1A692T and mip1G807R mutant alleles, in presence of overexpressed REV3. We observed that, for every mutation studied, the two processes act synergistically (Figure 6). For example, in strain carrying mip1A692T mutant allele the overexpression of REV3 reduced the petite frequency of approximately 1.3-fold, while deletion of SML1 reduced the petite frequency of 4.4 fold: together, the reduction was 9.1-fold. The synergistic effects were even stronger in the case of strain harboring mip1G807R mutation (1.9-fold when REV3 was overexpressed, 4.1-fold when SML1 was deleted, 15.7-fold together). It is likely that the observed synergy is due to an increase of dNTP pools, which are the substrate for both Mip1 and Pol zeta.

thumbnail
Figure 6. Petite frequency of mip1C261R, mip1A692T and mip1G807R strains disrupted in SML1 and overexpressing REV3.

In each graph the following petite frequencies are reported: mip1 strains transformed with YEplac195 empty plasmid (wt) or with YEPlac195-REV3 (REV3); mip1 sml1Δ strains transformed with YEplac195 empty plasmid (sml1Δ) or with YEplac195-REV3 (sml1Δ/REV3 observed). In addition, the penultimate bar represents the petite frequency of sml1Δ strain transformed with YEplac195-REV3 that would be expected if the effects of the overexpression of REV3 and of the deletion of SML1 were additive (sml1Δ/REV3 expected). * indicates that the observed frequency is significant lower than the expected one. NS: not significant.

https://doi.org/10.1371/journal.pone.0034322.g006

Construction of a mutant Rev3 which rescues mtDNA mutability without affecting nuclear mutability

It was previously shown that in UV-treated cells, enhanced expression of REV3 led to increase of nuclear point mutability, measured as increase in the rate of arg4–17 reversion. Pol zeta mutagenic function is dependent on Rev1 protein [38]. We measured nuclear mutability in cells transformed with REV3 and/or REV1 overexpressing plasmids to determine whether increased levels of Pol zeta/Rev1 exerted mutagenic effect as a consequence of a general mechanism associated to the translesion bypass. The overexpression of Rev3 or Rev1 caused an approximately two-fold increase of nuclear point mutability, measured as rate of CanR mutants. When both Pol zeta and Rev1 were overexpressed, the rate of CanR mutations increased approximately 3-fold (Figure 7). Thus, overexpression of Pol zeta is useful to reduce the mtDNA instability caused by specific mutations in MIP1 but is detrimental to spontaneous nuclear mutability.

thumbnail
Figure 7. Rate of CanR mutants.

Rate of CanR mutants (A) in wt strains overexpressing REV3, REV7 and/or REV1 or (B) wt REV3 and mutant REV3, encoding for the Rev3 protein harboring the 504–508 AAAAA stretch. Rate of CanR mutants was measured as indicated in Materials and Methods on three independent clones. If no stated differently, * indicates that the rate is significantly different from that of strain transformed with the empty plasmid(s). NS: not significant.

https://doi.org/10.1371/journal.pone.0034322.g007

A Rev3 mutant which could enter into mitochondria, but not in the nucleus is expected to reduce the mitochondrial mutability without increasing nuclear mutability. To this end, we thought of designing a REV3 gene whose product could not enter the nucleus. We searched inside Rev3 for the potential nuclear localization signal, by using the PredictNLS server (http://cubic.bioc.columbia.edu/services/predictNLS/). Rev3 protein is predicted to possess a unique bipartite nuclear localization signal encompassing amino acids 487–508 (Figure 8). Both upstream and downstream basic amino acid stretches composing the bipartite signal are critical for nuclear import [56].

thumbnail
Figure 8. Position and sequence of the bipartite nuclear localization sequence.

The stretch RKRKK was mutagenized to AAAAA to obtain a mutant Rev3 fragment fused with EGFP for protein localization and a mutant Rev3 isoform for analysis of mtDNA mutability and nuclear point mutability.

https://doi.org/10.1371/journal.pone.0034322.g008

To evaluate the localization of Rev3, we first cloned the whole coding sequence either in a centromeric plasmid or in a multicopy plasmid in frame with the EGFP gene. In both cases no GFP signal was detected in transformant cells, as it was found previously in high throughput analysis [57]. To overcome this problem, a shorter Rev3 fragment encompassing residues 1–534, which include the bipartite signal, was cloned in frame with EGFP. In this case, in transformant cells we observed a fluorescent signal corresponding to Rev3, localized in the nucleus. This was confirmed by DAPI staining of mitochondrial and nuclear DNA (Figure 6). Both in rho+ strain, where DAPI stained both mtDNA and nuclear DNA, and in the rho0, where DAPI stained only nuclear DNA, the GFP signal co-localized with the nuclear DAPI signal.

To obtain a version of Rev3 unable to migrate in the nucleus, we changed the 504–508 RKRKK downstream stretch to AAAAA (Figure 8). When Rev3 fragment encompassing amino acid 1–534 and harboring the 504–508 AAAAA stretch was fused with EGFP, the fluorescent signal corresponding to the fusion protein localized in the cytoplasm only (Figure 9). The AAAAA mutation was then introduced in the full REV3 gene, cloned in the multicopy plasmid YEplac195 and its effect was evaluated in strains harboring mip1A692T or mip1G807R. In the presence of overexpressed mutant Rev3, the mtDNA extended mutability decreased at the same extent as achieved in the presence of overexpressed wild type Rev3, indicating that the alteration of the nuclear signal did not affect the ability of Rev3 of operating in mitochondria (Table 5). If the mutated version of the enzyme did not enter the nucleus, then it was expected that its overexpression did not cause an increase in nuclear mutability. Indeed, in the presence of overexpressed mutant Rev3 the nuclear point mutability, measured as rate of CanR mutants accumulation, did not increase (Figure 7).

thumbnail
Figure 9. Localization of Rev3.

Localization of Rev3 and mutagenized Rev3 fused with EGFP in (A) a rho+ strain and in (B) a rho0 strain. Images have been acquired and adjusted as reported in Materials and Methods. In rho+ strain DAPI stains both the nuclear DNA (bigger spot) and the mtDNA (small spots in the cell periphery). In rho0 strain, which is depleted of mtDNA, DAPI stains the nuclear DNA only.

https://doi.org/10.1371/journal.pone.0034322.g009

thumbnail
Table 5. Petite frequency in mip1 strains overexpressing REV3 or the mutagenized form of REV3.

https://doi.org/10.1371/journal.pone.0034322.t005

Discussion

In this study we showed that increased levels of Rev3, encoding the catalytic subunit of Pol zeta, reduces both the mtDNA extended mutability and the point mutability caused by specific mutations in Mip1, the S. cerevisiae mtDNA polymerase. The rescue of mtDNA extended mutability requires overexpression of the catalytic subunit Rev3, but not that of the accessory subunit encoded by REV7. However, a basal level of Rev7, which is known to be expressed more than Rev3 [54], is necessary, because in a rev7Δ strain the rescue does not occur.

Rev1, which interacts with Pol zeta for efficient bypass and extension past the DNA lesion, is not required to rescue mtDNA extended mutability, suggesting that Pol zeta can function independently of Rev1 in mitochondrion. In contrast, Rev1 overexpression is necessary for the rescue of point mutability mediated by Rev3. These observations suggest that the rescues mediated by Rev3 overexpression are driven by two different mechanisms: i. the rescue of mtDNA extended mutability involving only Pol zeta and ii. the rescue of mtDNA point mutability for which both Pol zeta and Rev1 are required. These results are consistent with previous findings which indicate that the instability of mitochondrial DNA in general is caused by mechanisms different from those producing single point mutations [19].

Deletion of REV3 did not influence the mtDNA extended mutability (petite frequency), both in the wt strain and in mip1 mutant strains. In contrast, REV3 deletion caused an increase of point mutability. Therefore Pol zeta, in mitochondria, functions in a pathway less mutagenic than Mip1, supporting the hypothesis of Kalifa and Sia [10]. Moreover, strains carrying mip1 mutant alleles were themselves mutators, i.e. showed an EryR mutant frequency higher than that of the wt strain. The observation that the higher the mtDNA point mutability of the mutant strain, the higher the effect of REV3 deletion, indicates that mutator Mip1 isoforms are more sensitive to the absence of Rev3 than the wild type one and is coherent with that hypothesis.

Until now, it has not been yet elucidated the physiological role of Pol zeta in mitochondria. Rev3, that is expressed at basal levels during the whole vegetative cell cycle and only moderately (∼2-fold) overexpressed when cells are treated with UV, is expressed at levels comparable or higher (∼18-fold) than those obtained in this study during the late phase of sporulation [58]. Interestingly, maintenance of a full non-mutated mtDNA genome is fundamental in meiosis, since respiratory-deficient diploid strains are unable to sporulate or show increased levels of dead spores [59], [60]. A possible interpretation is that increased levels of Pol zeta could have importance in the maintenance of wt mtDNA during sporulation.

Regarding extended mutability, some MIP1 mutations equivalent to human pathological mutations were rescued by overexpression of Rev3 while others were not. Y757C, E698G and K749R, dominant mutations located in the polymerase domain, together with the recessive mutation in the exonuclease domain G259R, belong to this second group. These mutations are rescued by treatment with antioxidant molecules such as dihydrolipoic acid and MitoQ. Biochemical properties are available only for human Y955C mutation, equivalent to yeast Y757C, that strongly reduces the polymerase activity (<0.03% compared to the wild type), the processivity and the nucleotide binding affinity, but does not affect the DNA binding affinity [61], [62]. It was previously reported also that human Pol gamma harboring the Y955C mutation increases the in vitro incorporation of 8-oxo-dGTP, the most abundant oxidized nucleotide in mitochondria, and the translesion synthesis opposite to an 8-oxo-dG residue [63]. The last observation suggests that, although most of the mtDNA extended mutability by Y757C mutation is caused by stalled replication due to strongly reduced polymerase activity [61], [62], [64], [65], the mtDNA damage can be partially induced also by the accumulation of oxidized bases. In addition, for heteroallelic strains containing dominant mutations, it is possible that replication stalling by mutant Mip1 itself causes oxidative damage on mtDNA, which can partially block replication by wt Mip1. Independently of the mechanisms, it is known that there is a correlation between mtDNA extended mutability and oxidative stress: petite frequency is higher in strains with a reduced antioxidant potential [66], in strains treated with hydrogen peroxide [67] and in strains deleted both in MSH1 and in OGG1, encoding the mitochondrial glycosylase/lyase that specifically excises 8-oxo-dG residues in mtDNA [68].

Differently from Y757C, E698G, K749R and G259R, mutations C261R, R467W, A692T and G807R are rescued by Rev3 overexpression. These mutations are known to reduce the polymerase activity and/or the processivity of Mip1 [20], [27]. Yeast C261, equivalent to human S305, is part of a loop-helix orienter module (amino acids 304–316) that creates steric constraints leading to a destabilization of the template strand and a modification in the arrangement of the primer strand [27]: this subdomain in the 3′–5′ exonuclease plays a crucial role in the DNA polymerase function with no major effect on the exonucleolytic activity. yG807, equivalent to hG1051, is part of a partitioning loop (amino acids 1050–1095) [12] that modulates the partitioning of the primer strand between the polymerase and the exonuclease active sites by forming stable contacts with correctly base-paired primer-template DNA and destabilizing primer-template DNA that contains mispairs [69] This subdomain is adjacent to the orienter module, whose role is to position correctly the partitioning loop. Mutations in the orienter loop and in the partitioning loop both result in reduced DNA-binding affinity, reduced polymerase activity, increased point mutability and increased extended mutability [20], [26], [27]. yA692T, equivalent to hA889, is part of a β-sheet which surrounds the catalytic residues in the palm [12]. Mutations in this β-sheet are predicted to reduce polymerase activity [69], and this effect was observed for A692T mutation in yeast [26]. yR467, equivalent to hR574, is part of a subdomain responsible for the intrinsic processivity of Pol gamma [12]. As a matter of fact, mutation yR467W results in a decreased processivity [27].

We showed that these recessive mutations with reduced polymerase activity or processivity are insensitive to antioxidants treatment. Thus, we speculate that different Pol gamma mutations exert their negative effect according to two distinct ways. The first one, rescued by the treatment with antioxidants, can be related to the increased incorporation of 8-oxo-dG: in presence of antioxidant molecules the concentration of oxidized nucleotides and, as a consequence, their incorporation in the mtDNA is reduced. The inability of Pol zeta to rescue these Mip1 mutations may depend partially on the low efficiency (approximately 12%) of Pol zeta to incorporate nucleosides opposite to 8-oxo-dG [70], [71]. The second way, rescued by Rev3 overexpression, could be related to reduced polymerase activity, processivity and/or TLS synthesis of mutated mtDNA polymerase as in the case of C261R, R467W, A692T and G807R mutations. Two modes of action may account for ability of Rev3 to rescue this kind of mip1 mutations. i) Pol zeta could participate directly to the replication of undamaged mtDNA at the replicative fork partially playing the role of Mip1, as it was recently demonstrated in the case of defective nuclear replisome due to mutations in the replicative polymerases [72]. Interestingly, the rescue is observed for mutations which cause reduced DNA binding affinity (C261R) or for which reduced DNA binding affinity is predicted (R467W and G807R) [27], [69]. ii) Alternately, Pol zeta could partially substitute mutant Mip1 defective of TLS, either during the incorporation opposite to a lesion or the extension from mismatched terminally nucleotides. Reports of translesion synthesis by Pol gamma are limited. In vitro studies showed that Pol gamma from higher eukaryotes is an enzyme with a low TLS activity: it can bypass 8-oxo-dG incorporating dCMP (∼73%) or dAMP (∼27%), but stalls the majority of the time opposite abasic sites and opposite adducts containing benzo[a]pyrene and benzo[c]phenantrene [73], [74]. Moreover, it has been recently reported that human Pol gamma barely bypasses cyclobutane T-T dimers incorporating dAMP (∼80%) or dCTP (∼20%), whereas it extends very inefficiently past the dimer [75]. These observations suggest that DNA polymerase gamma can promote mutagenesis during TLS.

It is worthwhile mentioning that the Rev3 rescue was observed only in the absence of wt Mip1. It could be possible that in heteroallelic strains wt Mip1 out-competes even a 10-fold overexpression of Pol zeta for the stalled replication that is caused by mutant Mip1. As a consequence, putative beneficial effects of overexpression of Pol zeta in heteroallelic strain could be hidden by the presence of wt Mip1.

It has been demonstrated previously that mtDNA instability caused by specific mutations in MIP1 is reduced by increasing the dNTPs in the cell, either by overexpressing the RNR1 gene, which encodes the large subunit of the ribonucleotide reductase, or by deleting the SML1 gene, which encodes an inhibitor of the latter activity [55]. Increased concentration of dNTPs is beneficial since the basal levels of mitochondrial dNTP pools are a limiting factor to maintain mtDNA copy number in yeast [76], [77].

Here we describe that overexpression of Rev3 and increased activity of ribonucleotide reductase have a synergistic effect on reducing the frequency of petites. The synergistic effect is probably due to the fact that the activity of Pol zeta but also of Mip1 have improved with the increase of the dNTP pools, which are the substrate of both DNA polymerases. In addition, the REV3 overexpressing sml1Δ strains harboring mip1 mutations A692T and G807R reached petite frequency values which are slightly higher or similar, respectively, to those of wt strain, thus indicating that through genetic modifications it is possible to erase completely the detrimental effects of such mip1 mutations on extended mutability.

It is worth mentioning that the human Pol zeta protein does not localize to the mitochondria [9]. From the data here described, we suggest that in mammalian cells carrying mutant Pol gamma a beneficial effect could be obtained by overexpressing the yeast Rev3 mutant isoform unable to enter the nucleus but capable of rescuing mtDNA mutability, or as an alternative a mitochondrial localizing version of human Rev3. It has been reported that expression of a yeast mitochondrial repair/recombination enzyme, Cce1, the cruciform-cutting endonuclease, in human cells harboring partially duplicated mtDNA induced the appearance of wt mtDNA, thus demonstrating that expression of a yeast protein could be beneficial for mtDNA stability in mammalian cells [78]. Such a genetic rescue could be associated to a treatment with dNTPs, which seems to be beneficial for the detrimental effects caused by specific mutations in human POLG: the processivity defect of human DNA polymerase gamma harboring Y955C mutation was overcome by increasing the dATP or dTTP concentration during in vitro synthesis of mtDNA fragments [65] and the treatment with dAMP and dGMP leads to a slight increase in the levels of mtDNA in myoblasts deriving from an Alpers' patient harboring mutations A467T and K1191N in POLG [79].

Acknowledgments

We are deeply grateful to Antonietta Cirasolo and Roberto Silva for their skilful technical assistance, and to Antoni Barrientos for the gift of strain W303-1A CANS.

Author Contributions

Conceived and designed the experiments: EB IF TL. Performed the experiments: EB FS. Analyzed the data: EB TL. Contributed reagents/materials/analysis tools: IF TL. Wrote the paper: EB IF TL.

References

  1. 1. Lawrence CW (2004) Cellular functions of DNA polymerase zeta and Rev1 protein. Adv Protein Chem 69: 167–203.CW Lawrence2004Cellular functions of DNA polymerase zeta and Rev1 protein.Adv Protein Chem69167203
  2. 2. Nelson JR, Lawrence CW, Hinkle DC (1996) Thymine-thymine dimer bypass by yeast DNA polymerase zeta. Science 272: 1646–1649.JR NelsonCW LawrenceDC Hinkle1996Thymine-thymine dimer bypass by yeast DNA polymerase zeta.Science27216461649
  3. 3. Morrison A, Christensen RB, Alley J, Beck AK, Bernstine EG, et al. (1989) REV3, a Saccharomyces cerevisiae gene whose function is required for induced mutagenesis, is predicted to encode a non-essential DNA polymerase. J Bacteriol 171: 5659–5667.A. MorrisonRB ChristensenJ. AlleyAK BeckEG Bernstine1989REV3, a Saccharomyces cerevisiae gene whose function is required for induced mutagenesis, is predicted to encode a non-essential DNA polymerase.J Bacteriol17156595667
  4. 4. Lawrence CW, Hinkle DC (1996) DNA polymerase zeta and the control of DNA damage induced mutagenesis in eukaryotes,. In: Lindahl T, editor. Cancer Surveys: Genetic Stability in Cancer, vol. 28. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. pp. 21–31.CW LawrenceDC Hinkle1996DNA polymerase zeta and the control of DNA damage induced mutagenesis in eukaryotes,T. LindahlCancer Surveys: Genetic Stability in Cancer, vol. 28Cold Spring Harbor, NYCold Spring Harbor Laboratory Press2131
  5. 5. Lawrence CW, Gibbs PEM, Murante RS, Wang X-D, Li Z, et al. (2000) Roles of DNA polymerase zeta and Rev1 protein in eukaryotic mutagenesis and translesion replication,. Proceedings of the Cold Spring Harbor Symposia on Quantitative Biology, vol. 65. Cold Spring Habor, NY: Cold Spring Harbor Laboratory Press. pp. 61–69.CW LawrencePEM GibbsRS MuranteX-D WangZ. Li2000Roles of DNA polymerase zeta and Rev1 protein in eukaryotic mutagenesis and translesion replication,Proceedings of the Cold Spring Harbor Symposia on Quantitative Biology, vol. 65Cold Spring Habor, NYCold Spring Harbor Laboratory Press6169
  6. 6. Johnson RE, Washington MT, Haracska L, Prakash S, Prakash L (2000) Eukaryotic polymerases iota and zeta act sequentially to bypass DNA lesions. Nature 406: 1015–1019.RE JohnsonMT WashingtonL. HaracskaS. PrakashL. Prakash2000Eukaryotic polymerases iota and zeta act sequentially to bypass DNA lesions.Nature40610151019
  7. 7. Nelson JR, Lawrence CW, Hinkle DC (1996) Deoxycytidyl transferase activity of yeast REV1 protein. Nature 382: 729–731.JR NelsonCW LawrenceDC Hinkle1996Deoxycytidyl transferase activity of yeast REV1 protein.Nature382729731
  8. 8. Acharya N, Johnson RE, Prakash S, Prakash L (2006) Complex formation with Rev1 enhances the proficiency of Saccharomyces cerevisiae DNA polymerase zeta for mismatch extension and for extension opposite from DNA lesions. Mol Cell Biol 26: 9555–9563.N. AcharyaRE JohnsonS. PrakashL. Prakash2006Complex formation with Rev1 enhances the proficiency of Saccharomyces cerevisiae DNA polymerase zeta for mismatch extension and for extension opposite from DNA lesions.Mol Cell Biol2695559563
  9. 9. Zhang H, Chatterjee A, Singh KK (2006) Saccharomyces cerevisiae polymerase zeta functions in mitochondria. Genetics 172: 2683–2688.H. ZhangA. ChatterjeeKK Singh2006Saccharomyces cerevisiae polymerase zeta functions in mitochondria.Genetics17226832688
  10. 10. Kalifa L, Sia EA (2007) Analysis of Rev1p and Pol zeta in mitochondrial mutagenesis suggests an alternative pathway of damage tolerance. DNA Repair 6: 1732–1739.L. KalifaEA Sia2007Analysis of Rev1p and Pol zeta in mitochondrial mutagenesis suggests an alternative pathway of damage tolerance.DNA Repair617321739
  11. 11. Yakubovskaya E, Chen Z, Carrodeguas JA, Kisker C, Bogenhagen DF (2006) Functional human mitochondrial DNA polymerase gamma forms a heterotrimer. J Biol Chem 281: 374–382.E. YakubovskayaZ. ChenJA CarrodeguasC. KiskerDF Bogenhagen2006Functional human mitochondrial DNA polymerase gamma forms a heterotrimer.J Biol Chem281374382
  12. 12. Lee YS, Kennedy WD, Yin YW (2009) Structural insight into processive human mitochondrial DNA synthesis and disease-related polymerase mutations. Cell 139: 312–324.YS LeeWD KennedyYW Yin2009Structural insight into processive human mitochondrial DNA synthesis and disease-related polymerase mutations.Cell139312324
  13. 13. Yamanaka H, Gatanaga H, Kosalaraksa P, Matsuoka-Aizawa S, Takahashi T, et al. (2007) Novel mutation of human DNA polymerase gamma associated with mitochondrial toxicity induced by anti-HIV treatment. J Infect Dis 195: 1419–1425.H. YamanakaH. GatanagaP. KosalaraksaS. Matsuoka-AizawaT. Takahashi2007Novel mutation of human DNA polymerase gamma associated with mitochondrial toxicity induced by anti-HIV treatment.J Infect Dis19514191425
  14. 14. Chiappini F, Teicher E, Saffroy R, Debuire B, Vittecoq D, et al. (2009) Relationship between polymerase gamma (POLG) polymorphisms and antiretroviral therapy induced lipodystrophy in HIV-1 infected patients: a case-control study. Curr HIV Res 7: 244–253.F. ChiappiniE. TeicherR. SaffroyB. DebuireD. Vittecoq2009Relationship between polymerase gamma (POLG) polymorphisms and antiretroviral therapy induced lipodystrophy in HIV-1 infected patients: a case-control study.Curr HIV Res7244253
  15. 15. Saneto RP, Lee IC, Koenig MK, Bao X, Wenig SW, et al. (2010) POLG DNA testing as an emerging standard of care before instituting valproic acid therapy for pediatric seizure disorders. Seizure 19: 140–146.RP SanetoIC LeeMK KoenigX. BaoSW Wenig2010POLG DNA testing as an emerging standard of care before instituting valproic acid therapy for pediatric seizure disorders.Seizure19140146
  16. 16. Stewart JD, Horvath R, Baruffini E, Ferrero I, Bulst S, et al. (2010) Polymerase γ gene POLG determines the risk of sodium valproate-induced liver toxicity. Hepatology 52: 1791–1796.JD StewartR. HorvathE. BaruffiniI. FerreroS. Bulst2010Polymerase γ gene POLG determines the risk of sodium valproate-induced liver toxicity.Hepatology5217911796
  17. 17. Singh KK, Ayyasamy V, Owens KM, Koul MS, Vujcic M (2009) Mutations in mitochondrial DNA polymerase-gamma promote breast tumorigenesis. J Hum Genet 54: 516–524.KK SinghV. AyyasamyKM OwensMS KoulM. Vujcic2009Mutations in mitochondrial DNA polymerase-gamma promote breast tumorigenesis.J Hum Genet54516524
  18. 18. Lucas P, Lasserre JP, Plissonneau J, Castroviejo M (2004) Absence of accessory subunit in the DNA polymerase gamma purified from yeast mitochondria. Mitochondrion 4: 13–20.P. LucasJP LasserreJ. PlissonneauM. Castroviejo2004Absence of accessory subunit in the DNA polymerase gamma purified from yeast mitochondria.Mitochondrion41320
  19. 19. Baruffini E, Lodi T, Dallabona C, Puglisi A, Zeviani M, et al. (2006) Genetic and chemical rescue of the Saccharomyces cerevisiae phenotype induced by mitochondrial DNA polymerase mutations associated with progressive external ophthalmoplegia in humans. Hum Mol Genet 15: 2846–2855.E. BaruffiniT. LodiC. DallabonaA. PuglisiM. Zeviani2006Genetic and chemical rescue of the Saccharomyces cerevisiae phenotype induced by mitochondrial DNA polymerase mutations associated with progressive external ophthalmoplegia in humans.Hum Mol Genet1528462855
  20. 20. Baruffini E, Ferrero I, Foury F (2007) Mitochondrial DNA defects in Saccharomyces cerevisiae caused by functional interactions between DNA polymerase gamma mutations associated with disease in human. Biochim Biophys Acta 1772: 225–235.E. BaruffiniI. FerreroF. Foury2007Mitochondrial DNA defects in Saccharomyces cerevisiae caused by functional interactions between DNA polymerase gamma mutations associated with disease in human.Biochim Biophys Acta1772225235
  21. 21. Baruffini E, Horvath R, Dallabona C, Czermin B, Lamantea E, et al. (2011) Predicting the contribution of novel POLG mutations to human disease through analysis in yeast model. Mitochondrion 11: 182–190.E. BaruffiniR. HorvathC. DallabonaB. CzerminE. Lamantea2011Predicting the contribution of novel POLG mutations to human disease through analysis in yeast model.Mitochondrion11182190
  22. 22. Stuart GR, Santos JH, Strand MK, Van Houten B, Copeland WC (2006) Mitochondrial and nuclear DNA defects in Saccharomyces cerevisiae with mutations in DNA polymerase gamma associated with progressive external ophthalmoplegia. Hum Mol Genet 15: 363–374.GR StuartJH SantosMK StrandB. Van HoutenWC Copeland2006Mitochondrial and nuclear DNA defects in Saccharomyces cerevisiae with mutations in DNA polymerase gamma associated with progressive external ophthalmoplegia.Hum Mol Genet15363374
  23. 23. Spinazzola A, Invernizzi F, Carrara F, Lamantea E, Donati A, et al. (2009) Clinical and molecular features of mitochondrial DNA depletion syndromes. J Inherit Metab Dis 32: 143–158.A. SpinazzolaF. InvernizziF. CarraraE. LamanteaA. Donati2009Clinical and molecular features of mitochondrial DNA depletion syndromes.J Inherit Metab Dis32143158
  24. 24. Stricker S, Prüss H, Horvath R, Baruffini E, Lodi T, et al. (2009) A variable neurodegenerative phenotype with Polymerase γ mutation. J Neurol Neurosurg Psychiatry 80: 1181–1182.S. StrickerH. PrüssR. HorvathE. BaruffiniT. Lodi2009A variable neurodegenerative phenotype with Polymerase γ mutation.J Neurol Neurosurg Psychiatry8011811182
  25. 25. Baruffini E, Lodi T (2010) Construction and validation of a yeast model system for studying in vivo the susceptibility to nucleoside analogues of DNA polymerase gamma allelic variants. Mitochondrion 10: 183–187.E. BaruffiniT. Lodi2010Construction and validation of a yeast model system for studying in vivo the susceptibility to nucleoside analogues of DNA polymerase gamma allelic variants.Mitochondrion10183187
  26. 26. Stumpf JD, Bailey CM, Spell D, Stillwagon M, Anderson KS, et al. (2010) mip1 containing mutations associated with mitochondrial disease causes mutagenesis and depletion of mtDNA in Saccharomyces cerevisiae. Hum Mol Genet 19: 2123–2133.JD StumpfCM BaileyD. SpellM. StillwagonKS Anderson2010mip1 containing mutations associated with mitochondrial disease causes mutagenesis and depletion of mtDNA in Saccharomyces cerevisiae.Hum Mol Genet1921232133
  27. 27. Szczepanowska K, Foury F (2010) A cluster of pathogenic mutations in the 3′–5′ exonuclease domain of DNA polymerase gamma defines a novel module coupling DNA synthesis and degradation. Hum Mol Genet 19: 3516–3529.K. SzczepanowskaF. Foury2010A cluster of pathogenic mutations in the 3′–5′ exonuclease domain of DNA polymerase gamma defines a novel module coupling DNA synthesis and degradation.Hum Mol Genet1935163529
  28. 28. Stumpf JD, Copeland WC (2011) Mitochondrial DNA replication and disease: insights from DNA polymerase γ mutations. Cell Mol Life Sci 68: 219–233.JD StumpfWC Copeland2011Mitochondrial DNA replication and disease: insights from DNA polymerase γ mutations.Cell Mol Life Sci68219233
  29. 29. Dujon B (1981) Mitochondrial genetics and functions. The Molecular Biology of the Yeast Saccharomyces, Life Cycle and Inheritance. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. pp. 505–635.B. Dujon1981Mitochondrial genetics and functions.The Molecular Biology of the Yeast Saccharomyces, Life Cycle and InheritanceCold Spring Harbor, NYCold Spring Harbor Laboratory Press505635
  30. 30. Contamine V, Picard M (2000) Maintenance and integrity of the mitochondrial genome: a plethora of nuclear genes in the budding yeast. Microbiol Mol Biol Rev 64: 281–315.V. ContamineM. Picard2000Maintenance and integrity of the mitochondrial genome: a plethora of nuclear genes in the budding yeast.Microbiol Mol Biol Rev64281315
  31. 31. Sor F, Fukuhara H (1982) Identification of two erythromycin resistance mutations in the mitochondrial gene coding for the large ribosomal RNA in yeast. Nucleic Acids Res 10: 6571–6577.F. SorH. Fukuhara1982Identification of two erythromycin resistance mutations in the mitochondrial gene coding for the large ribosomal RNA in yeast.Nucleic Acids Res1065716577
  32. 32. Sor F, Fukuhara H (1984) Erythromycin and spiramycin resistance mutations of yeast mitochondria: nature of the rib2 locus in the large ribosomal RNA gene. Nucleic Acids Res 12: 8313–8318.F. SorH. Fukuhara1984Erythromycin and spiramycin resistance mutations of yeast mitochondria: nature of the rib2 locus in the large ribosomal RNA gene.Nucleic Acids Res1283138318
  33. 33. Cui Z, Mason TL (1989) A single nucleotide substitution at the rib2 locus of the yeast mitochondrial gene for 21 S rRNA confers resistance to erythromycin and cold-sensitive ribosome assembly. Curr Genet 16: 273–279.Z. CuiTL Mason1989A single nucleotide substitution at the rib2 locus of the yeast mitochondrial gene for 21 S rRNA confers resistance to erythromycin and cold-sensitive ribosome assembly.Curr Genet16273279
  34. 34. Vanderstraeten S, Van den Brûle S, Hu J, Foury F (1998) The role of 3′-5′ exonucleolytic proofreading and mismatch repair in yeast mitochondrial DNA error avoidance. J Biol Chem 273: 23690–23697.S. VanderstraetenS. Van den BrûleJ. HuF. Foury1998The role of 3′-5′ exonucleolytic proofreading and mismatch repair in yeast mitochondrial DNA error avoidance.J Biol Chem2732369023697
  35. 35. Chi NW, Kolodner RD (1994) The effect of DNA mismatches on the ATPase activity of MSH1, a protein in yeast mitochondria that recognizes DNA mismatches. J Biol Chem 269: 29993–29997.NW ChiRD Kolodner1994The effect of DNA mismatches on the ATPase activity of MSH1, a protein in yeast mitochondria that recognizes DNA mismatches.J Biol Chem2692999329997
  36. 36. Mieczkowski PA, Fikus MU, Ciesla Z (1997) Characterization of a novel DNA damage-inducible gene of Saccharomyces cerevisiae, DIN7, which is a structural homolog of the RAD2 and RAD27 DNA repair genes. Mol Gen Genet 253: 655–665.PA MieczkowskiMU FikusZ. Ciesla1997Characterization of a novel DNA damage-inducible gene of Saccharomyces cerevisiae, DIN7, which is a structural homolog of the RAD2 and RAD27 DNA repair genes.Mol Gen Genet253655665
  37. 37. Mookerjee SA, Sia EA (2006) Overlapping contributions of Msh1p and putative recombination proteins Cce1p, Din7p, and Mhr1p in large-scale recombination and genome sorting events in the mitochondrial genome of Saccharomyces cerevisiae. Mutat Res 595: 91–106.SA MookerjeeEA Sia2006Overlapping contributions of Msh1p and putative recombination proteins Cce1p, Din7p, and Mhr1p in large-scale recombination and genome sorting events in the mitochondrial genome of Saccharomyces cerevisiae.Mutat Res59591106
  38. 38. Rajpal DK, Wu X, Wang Z (2000) Alteration of ultraviolet-induced mutagenesis in yeast through molecular modulation of the REV3 and REV7 gene expression. Mutat Res 461: 133–143.DK RajpalX. WuZ. Wang2000Alteration of ultraviolet-induced mutagenesis in yeast through molecular modulation of the REV3 and REV7 gene expression.Mutat Res461133143
  39. 39. Lecrenier N, Foury F (1995) Overexpression of the RNR1 gene rescues Saccharomyces cerevisiae mutants in the mitochondrial DNA polymerase-encoding MIP1 gene. Mol Gen Genet 249: 1–7.N. LecrenierF. Foury1995Overexpression of the RNR1 gene rescues Saccharomyces cerevisiae mutants in the mitochondrial DNA polymerase-encoding MIP1 gene.Mol Gen Genet24917
  40. 40. Thomas BJ, Rothstein R (1989) Elevated recombination rates in transcriptionally active DNA. Cell 56: 619–630.BJ ThomasR. Rothstein1989Elevated recombination rates in transcriptionally active DNA.Cell56619630
  41. 41. Baruffini E, Serafini F, Lodi T (2009) Construction and characterization of centromeric, episomal and GFP-containing vectors for Saccharomyces cerevisiae prototrophic strains. J Biotechnol 143: 247–254.E. BaruffiniF. SerafiniT. Lodi2009Construction and characterization of centromeric, episomal and GFP-containing vectors for Saccharomyces cerevisiae prototrophic strains.J Biotechnol143247254
  42. 42. Kaiser C, Michaelis S, Mitchell A (1994) Methods in Yeast Genetics: a Laboratory Course Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. C. KaiserS. MichaelisA. Mitchell1994Methods in Yeast Genetics: a Laboratory Course ManualCold Spring Harbor, NYCold Spring Harbor Laboratory Press
  43. 43. Bonneaud N, Ozier-Kalogeropoulos O, Li GY, Labouesse M, Minvielle-Sebastia L, et al. (1991) A family of low and high copy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors. Yeast 7: 609–615.N. BonneaudO. Ozier-KalogeropoulosGY LiM. LabouesseL. Minvielle-Sebastia1991A family of low and high copy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors.Yeast7609615
  44. 44. Gietz RD, Sugino A (1988) New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74: 527–534.RD GietzA. Sugino1988New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.Gene74527534
  45. 45. Goldstein AL, McCusker JH (1999) Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15: 1541–1553.AL GoldsteinJH McCusker1999Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae.Yeast1515411553
  46. 46. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77: 51–59.SN HoHD HuntRM HortonJK PullenLR Pease1989Site-directed mutagenesis by overlap extension using the polymerase chain reaction.Gene775159
  47. 47. Gietz RD, Woods RA (2006) Yeast transformation by the LiAc/SS Carrier DNA/PEG method. Methods Mol Biol 313: 107–120.RD GietzRA Woods2006Yeast transformation by the LiAc/SS Carrier DNA/PEG method.Methods Mol Biol313107120
  48. 48. Baruffini E, Ferrero I, Foury F (2010) In vivo analysis of mtDNA replication defects in yeast. Methods 51: 426–436.E. BaruffiniI. FerreroF. Foury2010In vivo analysis of mtDNA replication defects in yeast.Methods51426436
  49. 49. Lea DE, Coulson CA (1949) The distribution of the numbers of mutants in bacterial populations. J Genet 49: 264–285.DE LeaCA Coulson1949The distribution of the numbers of mutants in bacterial populations.J Genet49264285
  50. 50. Huang ME, Rio AG, Galibert MD, Galibert F (2002) Pol32, a subunit of Saccharomyces cerevisiae DNA polymerase delta, suppresses genomic deletions and is involved in the mutagenic bypass pathway. Genetics 160: 1409–1422.ME HuangAG RioMD GalibertF. Galibert2002Pol32, a subunit of Saccharomyces cerevisiae DNA polymerase delta, suppresses genomic deletions and is involved in the mutagenic bypass pathway.Genetics16014091422
  51. 51. Hall BM, Ma C, Liang P, Singh KK (2009) Fluctuation AnaLysis CalculatOR (FALCOR): a web tool for the determination of mutation rate using Luria-Delbruck fluctuation analysis. Bioinformatics 25: 1564–1565.BM HallC. MaP. LiangKK Singh2009Fluctuation AnaLysis CalculatOR (FALCOR): a web tool for the determination of mutation rate using Luria-Delbruck fluctuation analysis.Bioinformatics2515641565
  52. 52. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, et al. (1994) Current Protocols in Molecular Biology. New York: Wiley. FM AusubelR. BrentRE KingstonDD MooreJG Seidman1994Current Protocols in Molecular BiologyNew YorkWiley
  53. 53. Sherman F, Fink GR, Hicks JB (1986) Laboratory Course Manual for Methods in Yeast Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. F. ShermanGR FinkJB Hicks1986Laboratory Course Manual for Methods in Yeast GeneticsCold Spring Harbor, NYCold Spring Harbor Laboratory Press
  54. 54. Acharya N, Haracska L, Johnson RE, Unk I, Prakash S, et al. (2005) Complex formation of yeast Rev1 and Rev7 proteins: a novel role for the polymerase-associated domain. Mol Cell Biol 25: 9734–9740.N. AcharyaL. HaracskaRE JohnsonI. UnkS. Prakash2005Complex formation of yeast Rev1 and Rev7 proteins: a novel role for the polymerase-associated domain.Mol Cell Biol2597349740
  55. 55. Zhao X, Muller EG, Rothstein R (1998) A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools. Mol Cell 2: 329–340.X. ZhaoEG MullerR. Rothstein1998A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools.Mol Cell2329340
  56. 56. Dingwall C, Robbins J, Dilworth SM, Roberts B, Richardson WD (1988) The nucleoplasmin nuclear location sequence is larger and more complex than that of SV-40 large T antigen. J Cell Biol 107: 841–849.C. DingwallJ. RobbinsSM DilworthB. RobertsWD Richardson1988The nucleoplasmin nuclear location sequence is larger and more complex than that of SV-40 large T antigen.J Cell Biol107841849
  57. 57. Huh WK, Falvo JV, Gerke LC, Carroll AS, Howson RW, et al. (2003) Global analysis of protein localization in budding yeast. Nature 425: 686–691.WK HuhJV FalvoLC GerkeAS CarrollRW Howson2003Global analysis of protein localization in budding yeast.Nature425686691
  58. 58. Singhal RK, Hinkle DC, Lawrence CW (1992) The REV3 gene of Saccharomyces cerevisiae is transcriptionally regulated more like a repair gene than one encoding a DNA polymerase. Mol Gen Genet 236: 17–24.RK SinghalDC HinkleCW Lawrence1992The REV3 gene of Saccharomyces cerevisiae is transcriptionally regulated more like a repair gene than one encoding a DNA polymerase.Mol Gen Genet2361724
  59. 59. Küenzi MT, Tingle MA, Halvorson HO (1974) Sporulation of Saccharomyces cerevisiae in the absence of a functional mitochondrial genome. J Bacteriol 117: 80–88.MT KüenziMA TingleHO Halvorson1974Sporulation of Saccharomyces cerevisiae in the absence of a functional mitochondrial genome.J Bacteriol1178088
  60. 60. Codón AC, Gasent-Ramírez JM, Benítez T (1995) Factors which affect the frequency of sporulation and tetrad formation in Saccharomyces cerevisiae baker's yeasts. Appl Environ Microbiol 61: 630–638.AC CodónJM Gasent-RamírezT. Benítez1995Factors which affect the frequency of sporulation and tetrad formation in Saccharomyces cerevisiae baker's yeasts.Appl Environ Microbiol61630638
  61. 61. Ponamarev MV, Longley MJ, Nguyen D, Kunkel TA, Copeland WC (2002) Active site mutation in DNA polymerase gamma associated with progressive external ophthalmoplegia causes error-prone DNA synthesis. J Biol Chem 77: 15225–15228.MV PonamarevMJ LongleyD. NguyenTA KunkelWC Copeland2002Active site mutation in DNA polymerase gamma associated with progressive external ophthalmoplegia causes error-prone DNA synthesis.J Biol Chem771522515228
  62. 62. Graziewicz MA, Longley MJ, Bienstock RJ, Zeviani M, Copeland WC (2004) Structure-function defects of human mitochondrial DNA polymerase in autosomal dominant progressive external ophthalmoplegia. Nat Struct Mol Biol 11: 770–776.MA GraziewiczMJ LongleyRJ BienstockM. ZevianiWC Copeland2004Structure-function defects of human mitochondrial DNA polymerase in autosomal dominant progressive external ophthalmoplegia.Nat Struct Mol Biol11770776
  63. 63. Graziewicz MA, Bienstock RJ, Copeland WC (2007) The DNA polymerase gamma Y955C disease variant associated with PEO and parkinsonism mediates the incorporation and translesion synthesis opposite 7,8-dihydro-8-oxo-2′-deoxyguanosine. Hum Mol Genet 16: 2729–2739.MA GraziewiczRJ BienstockWC Copeland2007The DNA polymerase gamma Y955C disease variant associated with PEO and parkinsonism mediates the incorporation and translesion synthesis opposite 7,8-dihydro-8-oxo-2′-deoxyguanosine.Hum Mol Genet1627292739
  64. 64. Wanrooij S, Goffart S, Pohjoismäki JL, Yasukawa T, Spelbrink JN (2007) Expression of catalytic mutants of the mtDNA helicase Twinkle and polymerase POLG causes distinct replication stalling phenotypes. Nucleic Acids Res 35: 3238–3251.S. WanrooijS. GoffartJL PohjoismäkiT. YasukawaJN Spelbrink2007Expression of catalytic mutants of the mtDNA helicase Twinkle and polymerase POLG causes distinct replication stalling phenotypes.Nucleic Acids Res3532383251
  65. 65. Atanassova N, Fusté JM, Wanrooij S, Macao B, Goffart S, et al. (2011) Sequence-specific stalling of DNA polymerase γ and the effects of mutations causing progressive ophthalmoplegia. Hum Mol Genet 20: 1212–1223.N. AtanassovaJM FustéS. WanrooijB. MacaoS. Goffart2011Sequence-specific stalling of DNA polymerase γ and the effects of mutations causing progressive ophthalmoplegia.Hum Mol Genet2012121223
  66. 66. Lee JC, Straffon MJ, Jang TY, Higgins VJ, Grant CM, et al. (2001) The essential and ancillary role of glutathione in Saccharomyces cerevisiae analysed using a grande gsh1 disruptant strain. FEMS Yeast Res 1: 57–65.JC LeeMJ StraffonTY JangVJ HigginsCM Grant2001The essential and ancillary role of glutathione in Saccharomyces cerevisiae analysed using a grande gsh1 disruptant strain.FEMS Yeast Res15765
  67. 67. Gibson BR, Prescott KA, Smart KA (2008) Petite mutation in aged and oxidatively stressed ale and lager brewing yeast. Lett Appl Microbiol 46: 636–642.BR GibsonKA PrescottKA Smart2008Petite mutation in aged and oxidatively stressed ale and lager brewing yeast.Lett Appl Microbiol46636642
  68. 68. Kaniak A, Dzierzbicki P, Rogowska AT, Malc E, Fikus M, et al. (2009) Msh1p counteracts oxidative lesion-induced instability of mtDNA and stimulates mitochondrial recombination in Saccharomyces cerevisiae. DNA Repair (Amst) 8: 318–329.A. KaniakP. DzierzbickiAT RogowskaE. MalcM. Fikus2009Msh1p counteracts oxidative lesion-induced instability of mtDNA and stimulates mitochondrial recombination in Saccharomyces cerevisiae.DNA Repair (Amst)8318329
  69. 69. Euro L, Farnum GA, Palin E, Suomalainen A, Kaguni LS (2011) Clustering of Alpers disease mutations and catalytic defects in biochemical variants reveal new features of molecular mechanism of the human mitochondrial replicase, Pol γ. Nucleic Acids Res 39: 9072–9084.L. EuroGA FarnumE. PalinA. SuomalainenLS Kaguni2011Clustering of Alpers disease mutations and catalytic defects in biochemical variants reveal new features of molecular mechanism of the human mitochondrial replicase, Pol γ.Nucleic Acids Res3990729084
  70. 70. de Padula M, Slezak G, Auffret van Der Kemp P, Boiteux S (2004) The post-replication repair RAD18 and RAD6 genes are involved in the prevention of spontaneous mutations caused by 7,8-dihydro-8-oxoguanine in Saccharomyces cerevisiae. Nucleic Acids Res 32: 5003–5010.M. de PadulaG. SlezakP. Auffret van Der KempS. Boiteux2004The post-replication repair RAD18 and RAD6 genes are involved in the prevention of spontaneous mutations caused by 7,8-dihydro-8-oxoguanine in Saccharomyces cerevisiae.Nucleic Acids Res3250035010
  71. 71. Haracska L, Prakash S, Prakash L (2003) Yeast DNA polymerase zeta is an efficient extender of primer ends opposite from 7,8-dihydro-8-Oxoguanine and O6-methylguanine. Mol Cell Biol 23: 1453–1459.L. HaracskaS. PrakashL. Prakash2003Yeast DNA polymerase zeta is an efficient extender of primer ends opposite from 7,8-dihydro-8-Oxoguanine and O6-methylguanine.Mol Cell Biol2314531459
  72. 72. Northam MR, Robinson HA, Kochenova OV, Shcherbakova PV (2010) Participation of DNA polymerase zeta in replication of undamaged DNA in Saccharomyces cerevisiae. Genetics 184: 27–42.MR NorthamHA RobinsonOV KochenovaPV Shcherbakova2010Participation of DNA polymerase zeta in replication of undamaged DNA in Saccharomyces cerevisiae.Genetics1842742
  73. 73. Pinz KG, Shibutani S, Bogenhagen DF (1995) Action of mitochondrial DNA polymerase gamma at sites of base loss or oxidative damage. J Biol Chem 270: 9202–9206.KG PinzS. ShibutaniDF Bogenhagen1995Action of mitochondrial DNA polymerase gamma at sites of base loss or oxidative damage.J Biol Chem27092029206
  74. 74. Graziewicz MA, Sayer JM, Jerina DM, Copeland WC (2004) Nucleotide incorporation by human DNA polymerase gamma opposite benzo[a]pyrene and benzo[c]phenanthrene diol epoxide adducts of deoxyguanosine and deoxyadenosine. Nucleic Acids Res 32: 397–405.MA GraziewiczJM SayerDM JerinaWC Copeland2004Nucleotide incorporation by human DNA polymerase gamma opposite benzo[a]pyrene and benzo[c]phenanthrene diol epoxide adducts of deoxyguanosine and deoxyadenosine.Nucleic Acids Res32397405
  75. 75. Kasiviswanathan R, Gustafson MA, Copeland WC, Meyer JN (2011) Human mitochondrial DNA polymerase γ exhibits potential for bypass and mutagenesis at UV-induced cyclobutane thymine dimers. J Biol Chem. R. KasiviswanathanMA GustafsonWC CopelandJN Meyer2011Human mitochondrial DNA polymerase γ exhibits potential for bypass and mutagenesis at UV-induced cyclobutane thymine dimers.J Biol Chem
  76. 76. Taylor SD, Zhang H, Eaton JS, Rodeheffer MS, Lebedeva MA, et al. (2005) The conserved Mec1/Rad53 nuclear checkpoint pathway regulates mitochondrial DNA copy number in Saccharomyces cerevisiae. Mol Biol Cell 16: 3010–3018.SD TaylorH. ZhangJS EatonMS RodehefferMA Lebedeva2005The conserved Mec1/Rad53 nuclear checkpoint pathway regulates mitochondrial DNA copy number in Saccharomyces cerevisiae.Mol Biol Cell1630103018
  77. 77. Lebedeva MA, Shadel GS (2007) Cell cycle- and ribonucleotide reductase-driven changes in mtDNA copy number influence mtDNA Inheritance without compromising mitochondrial gene expression. Cell Cycle 6: 2048–2057.MA LebedevaGS Shadel2007Cell cycle- and ribonucleotide reductase-driven changes in mtDNA copy number influence mtDNA Inheritance without compromising mitochondrial gene expression.Cell Cycle620482057
  78. 78. Sembongi H, Di Re M, Bokori-Brown M, Holt IJ (2007) The yeast Holliday junction resolvase, CCE1, can restore wild-type mitochondrial DNA to human cells carrying rearranged mitochondrial DNA. Hum Mol Genet 16: 2306–2314.H. SembongiM. Di ReM. Bokori-BrownIJ Holt2007The yeast Holliday junction resolvase, CCE1, can restore wild-type mitochondrial DNA to human cells carrying rearranged mitochondrial DNA.Hum Mol Genet1623062314
  79. 79. Bulst S, Abicht A, Holinski-Feder E, Müller-Ziermann S, Koehler U, et al. (2009) In vitro supplementation with dAMP/dGMP leads to partial restoration of mtDNA levels in mitochondrial depletion syndromes. Hum Mol Genet 18: 1590–1599.S. BulstA. AbichtE. Holinski-FederS. Müller-ZiermannU. Koehler2009In vitro supplementation with dAMP/dGMP leads to partial restoration of mtDNA levels in mitochondrial depletion syndromes.Hum Mol Genet1815901599
  80. 80. Filosto M, Mancuso M, Nishigaki Y, Pancrudo J, Harati Y, et al. (2003) Clinical and genetic heterogeneity in progressive external ophthalmoplegia due to mutations in polymerase gamma. Arch Neurol 60: 1279–1284.M. FilostoM. MancusoY. NishigakiJ. PancrudoY. Harati2003Clinical and genetic heterogeneity in progressive external ophthalmoplegia due to mutations in polymerase gamma.Arch Neurol6012791284
  81. 81. Hisama FM, Mancuso M, Filosto M, DiMauro S (2005) Progressive external ophthalmoplegia: a new family with tremor and peripheral neuropathy. Am J Med Genet A 135: 217–219.FM HisamaM. MancusoM. FilostoS. DiMauro2005Progressive external ophthalmoplegia: a new family with tremor and peripheral neuropathy.Am J Med Genet A135217219