Browse Subject Areas

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Low-Replicating Viruses and Strong Anti-Viral Immune Response Associated with Prolonged Disease Control in a Superinfected HIV-1 LTNP Elite Controller

  • María Pernas,

    Affiliation Servicio de Virología Molecular, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Madrid, Spain

  • Concepción Casado,

    Affiliation Servicio de Virología Molecular, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Madrid, Spain

  • Carolina Arcones,

    Affiliation Servicio de Virología Molecular, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Madrid, Spain

  • Anuska Llano,

    Affiliation Fundació irsiCaixa-HIVACAT, Institut de Recerca de la Sida, Hospital Universitari Germans Trias i Pujol, Badalona, Spain

  • Víctor Sánchez-Merino,

    Affiliation Laboratorio de Retrovirología e Inmunología IDIBAPS-Facultad de Medicina, Barcelona, Spain

  • Beatriz Mothe,

    Affiliation Fundació irsiCaixa-HIVACAT, Institut de Recerca de la Sida, Hospital Universitari Germans Trias i Pujol, Badalona, Spain

  • José L. Vicario,

    Affiliation Centro de Transfusiones de la Comunidad de Madrid, Comunidad Autónoma de Madrid, Spain

  • Eulalia Grau,

    Affiliation Fundació irsiCaixa-HIVACAT, Institut de Recerca de la Sida, Hospital Universitari Germans Trias i Pujol, Badalona, Spain

  • Lidia Ruiz,

    Affiliation Fundació irsiCaixa-HIVACAT, Institut de Recerca de la Sida, Hospital Universitari Germans Trias i Pujol, Badalona, Spain

  • Jorge Sánchez,

    Affiliation Asociación Civil IMPACTA Salud y Educación, Lima, Perú

  • Amalio Telenti,

    Affiliation Institute of Microbiology, University Hospital Center, University of Lausanne, Lausanne, Switzerland

  • Eloísa Yuste,

    Affiliation Laboratorio de Retrovirología e Inmunología IDIBAPS-Facultad de Medicina, Barcelona, Spain

  • Christian Brander,

    Affiliations Fundació irsiCaixa-HIVACAT, Institut de Recerca de la Sida, Hospital Universitari Germans Trias i Pujol, Badalona, Spain, Institucio Catalana de Recerca i Estudis Avancats (ICREA), Barcelona, Spain

  • Cecilio López- Galíndez

    Affiliation Servicio de Virología Molecular, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Madrid, Spain

Low-Replicating Viruses and Strong Anti-Viral Immune Response Associated with Prolonged Disease Control in a Superinfected HIV-1 LTNP Elite Controller

  • María Pernas, 
  • Concepción Casado, 
  • Carolina Arcones, 
  • Anuska Llano, 
  • Víctor Sánchez-Merino, 
  • Beatriz Mothe, 
  • José L. Vicario, 
  • Eulalia Grau, 
  • Lidia Ruiz, 
  • Jorge Sánchez



To study the causes for the lack of clinical progression in a superinfected HIV-1 LTNP elite controller patient.

Methodology and Principal Findings

We studied host genetic, virological and immunological factors associated with viral control in a SI long term non progressor elite controller (LTNP-EC). The individual contained both viruses and maintained undetectable viral loads for >20 years and he did not express any of the described host genetic polymorphisms associated with viral control. None of four full-length gp160 recombinants derived from the LTNP-EC replicated in heterologous peripheral blood mononuclear cells. CTL responses after SI were maintained in two samples separated by 9 years and they were higher in breadth and magnitude than responses seen in most of 250 treatment naïve patients and also 25 controller subjects. The LTNP-EC showed a neutralization response, against 4 of the 6 viruses analyzed, superior to other ECs.


The study demonstrated that a strong and sustained cellular and humoral immune response and low replicating viruses are associated with viral control in the superinfected LTNP-EC.


Long term non progressor elite controllers (LTNP-EC) constitute a subset of Human Immunodeficiency Virus (HIV-1) infected naïve individuals whose viral load is below 50 copies/ml for more than 10 years of infection [1]. This group constitutes around 1% of the HIV-1 infected individuals and has attracted a lot of interest for the identification of mechanisms contributing to the natural control of viral replication.

Viral factors, host genetics and immune responses have been associated with the control of HIV-1 replication and lack or slow disease progression. In some studies, mutations or deletions in HIV-1 proteins, like Nef [2] or Env [3] and in accessory genes lead to viral control [2], [4]. An important role of gag and pol viral proteins from LTNPs were responsible for the impaired viral replicative capacity [5]. Other works described the presence of viruses with reduced replicative capacity in the initial stages of the infection [6]. In contrast, other studies did not find relevant deletions or defects after analyzing viral sequences from a large cohort of the EC [7]. Recently, a detailed study of viruses from HIV-1 EC showed a lower replicative and reduced entry capacity, suggesting that viral factor may contribute to the low viral burden in EC [8].

Host genetic factors have also been associated with viral control in LTNPs. Genetic polymorphisms in the coding and the promoter regions of the CCR5 co-receptor have been associated with protection against HIV-1 acquisition [9]. The most relevant host factors associated with relative viral control map to the major histocompatibility complex class (MHC), specially the HLA class I B alleles [10]. Particularly, HLA B* 27, B* 57 and B* 58 alleles are consistently overrepresented in individuals who, in the absence of anti-viral treatment, show viral control [11]. More recently, certain alleles of the MHC class II, including HLA-DRB1*13 and/or HLA-DQB1*06 have been related to controller status and associated with the presence of mucosal CD4+ T cell response against HIV [12]. The maintenance of a robust HIV-specific CD4+ T cell response, providing help to CD8+ T cells, may also facilitate to the long term control of HIV replication [13]. The robust associations between viral control and specific HLA class I and II alleles strongly suggests that virus-specific CD8+ T cell responses represent one of the most effective mechanisms to control HIV-1 infection [14].

Several studies have addressed whether ECs have broadly neutralizing antibody (Nab) responses that could account for their ability to control their virus [15], [16], [17], [18], [19]. This response is not present, however, in most ECs and it does not have a major protective role in the early or chronic phase of the viral replication [19].

In previous analysis of HIV-1 superinfection (SI), infection with a second virus during the course of an established infection was generally associated with loss of viral control and abrupt decline in CD4+ T cells counts [20]. In two EC patients, an accelerated rate of disease progression was observed after a documented SI [21]. Disease control after infection by a nef-defective strain in a B*57 HIV-1 LTNP was lost after SI with a fully competent virus [22]. In a LTNP-EC, recovery of viremic control after SI was described although viral load was higher than before SI, and the patient did no longer fulfill the EC definition [23].

We identified a case of HIV-1 SI in a LTNP-EC that was able to control both viruses and maintain undetectable viral loads for >20 years [24]. This study analyses the mechanisms leading to this exceptional clinical presentation.

Materials and Methods

Ethic statement

The Ethical Committee of the Hospital German Trias i Pujol approved the current investigation and the patient gave its informed consent for the study.

Study participant

Samples from a homosexual man, who maintained undetectable viral loads below 50 copies/ml, occasional blips, and high levels of CD4+ T cells for more than 20 years were analyzed (Figure 1). The study subject, fulfilled the LTNP-EC criteria [1] even after SI by a second strain around nine years after primo-infection [24].

Figure 1. Clinical characteristics of the patient.

CD4+ T cell counts and viral load are represented in the Y axis against time in the X axis. The first sample was taken 78 months after the first documented HIV-1 positive test diagnosis. Blue arrow shows the first sample available, close to the estimated moment of SI (1995). In yellow are represented samples taken to perform quasispecies analysis and gp160 amplification. Serum samples used for neutralization analysis () and PBMC samples used for CTL response () are indicated.

Host genetics, HLA typing and determination of chemokine genotype

Genetic polymorphisms were chosen based on genome-wide association studies, or selected from the literature according to the quality of their supporting evidence. These included the HCP5 rs2395029 allele in linkage disequilibrium with HLA-B*5701, the HLA-C-35 (rs9264942) variant, CCR5 Δ32 (rs333), CCR2 V64I (rs1799864). CCR5 haplotypes (HHA to HHF) were constructed according to the published nomenclature [9] considering 8 polymorphisms in the CCR5/CCR2 promoter and coding region (rs2856758, rs2734648, rs1799987, rs1799988, rs1800023, rs1800024, rs333, rs1799864). HLA-classI (A, B, C) and HLA-class II alleles were also analyzed. HLA typing were determined by sequencing, and SNP analysis was done by TaqMan as described [25].

Gp160 amplification

Peripheral blood mononuclear cells (PBMC) were separated by phycoll-hypaque centrifugation. Proviral DNA was obtained from 1×107 cells by a standard phenol-extraction method. Proviral HIV DNA was amplified in the gp160 region in env gene by limiting dilution nested PCR [26]. Outer primers 5′ ATGGCTTAGGGCAACATATCTATG 3′ (5677–5700 HXB2 position) 5′CTCTGGTAACTAGAGATC 3′, (position 9664–9681) were used for the first PCR and 5′ GCGGAGACAGCGACGAAGAGCTCCTCAAG 3′ (5983–6011) 5′CTGCTGGCTCAGCTCTTCTCATTCTTTCCC3′ (8845–8878) for the nested, containing the SapI sites for cloning. All PCRs were done using the Expand High Fidelity (Roche) to increase fidelity. Nucleotide sequences were determined with the Big Dye™ Terminator Cycle Sequencing kit (Applied Biosystems) in an ABI 3730 sequencer (Applied Biosystems).

Generation of chimeric viruses

For the virus selection, the C2-V5 region of gp160 env amplicons from different samples of the patient, were included in a Maximun Likelihood phylogenetic tree. One clone of each of the three sub-clusters of “a” viruses and of the superinfecting “b” virus in the phylogenetic tree was selected for the study and are marked with arrows in the tree of Figure 2.

Figure 2. Maximum likelihood tree derived from the C2-V5 env sequences obtained during the patient follow-up.

Maximum Likelihood tree was performed with the help of the MEGA program. Symbols represent sequences taken in different year: 1995 □, 1996 ▾, 1998 ◊, 2001♦, 2005, •2006 and 2007▿. Virus “a” corresponds to the primoinfecting virus and the encircled groups identify the different a1, a2, and a3 variants. Virus “b” corresponds to the superinfecting virus. Samples chosen for molecular cloning are marked with arrows a1, a2 and a3 from virus “a” and b1 from virus “b”. Nucleotide sequences from control Spanish isolates are denoted by standard typeface and sequences from subtype B reference viruses from the Los Alamos HIV Data Base are shown in italic. The scale bar on the bottom of the figure represents 5% of genetic distance.

Four complete gp160 amplicons from the patient, one from LTNP 64 and three amplicons obtained for a patient with rapid progression were used for the generation of chimeric viruses and gp160 from NL4.3 reference virus was also included. The full-length infectious molecular clones were constructed by replacing the gp160 env sequence of molecular clone 89ES061 [27] with the different gp160 amplicons. The molecular clone 89ES061 was SapI digested; gel extracted using PureLink Quick Gel Extraction Kit following the manufactures instructions (Invitrogen) and ligated with the gp160 amplicons using T4 DNA ligase (New England Biolabs). Recombinants plasmids were transformed in DH5α competent cells and clones sequenced to check the correct insert orientation.

In order to generate the chimeric viruses, 10 µg of the recombinant plasmids were transfected into 3×106 293 T cells using calcium chloride protocol [28]. 293 T cells were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin and 100 µg de streptomycin/ml (DMEMc). 72 h post-transfection, supernatants were harvested, filtered through 0.45 µm to remove cellular debris. Virus production was quantified measuring HIV-1 p24 antigen by enzyme-linked immunosorbent assay (Roche Diagnostic).

Viral sequence analysis

The gp160 amino acid sequence of viruses a1, a2 a3 and b were aligned using the Bioedit Program. The subject' sequences were automatically compared to all available sequences of subtype B (702 sequences) from the Los Alamos HIV Sequence Data base using the Quickalign tool ( The presence of unusual residues in conserved positions (more than 85%) of the sequences from the Database was analyzed in the LTNP-EC's viruses.

Co receptor usage was determined with the PSSM prediction tool (, based on the V3 amino acid sequences and confirmed by growing the viruses in the U87.CD4.CCR5 or CXCR 4 cells.

Viral titer determination

Virus titration was performed in duplicate in TZM-bl cells. Five serial ten-fold dilutions of viral stocks were assayed. After 48 h, cells were stained for β-galactosidase activity as described [29]. Titers were expressed as tissue culture infective dose (TCID), calculated by the Spearman–Karber formula [30].

Replicative capacity assay of the chimeric viruses in U87.CD4.CCR5 and PBMCs cells

U87.CD4.CCR5 and U87.CD4.CXCR4 cells were cultured in DMEM supplemented media with 15% fetal bovine serum plus 300 µg/ml G418 (Sigma-Aldrich) and 1 µg/ml puromycin (Sigma-Aldrich). 50×103 U87.CD4.CCR5 or CXCR4 cells per well were seeded in a 24 well plate and infected with 1 ng of p24 of the different viruses. Replicative capacity was evaluated quantifying the p24 production in the culture supernatant after 3, 7, 10 and 14 days post infection.

PBMC obtained from two different uninfected donors, were grown in RPMI 1640 (Bio-Whittaker) supplemented with 10% fetal bovine serum (Gibco) plus 1% antibiotics (Bio-Whittaker), and were activated with phytohaemagglutinin 2 µg/ml (Sigma-Aldrich) for three days before infection. In order to compare the replicative capacity of the variants present before and after SI, 1×107 PBMC cultured in RPMI supplemented with 2.5 ng/ml of recombinant human interleukin-2 rhIL-2 (Bender Medsystems), were infected in two independent experiments, by spin inoculation with equivalent amounts of viruses (1 ng) [31]. HIV-1 production was quantified measuring p24 protein in the supernatant after 3, 7, 10, 14 and 17 days post infection. In the experiments, replicative capacity of LTNP-EC's virus was compared to the capacity of reference strains HIV1-SF162 and NL 4.3. Chimeric virus containing gp160 env from NL4.3 in the 89ES061 background, LTNP patient 64, three clones obtained from a rapid progressor (Ris 6 C2-2, Ris 3 C6-1 and Ris 3 C9-2) and the full length 89ES061 viruses were included as controls.

ELISPOT analysis of HIV-1 specific CD8+ T cell response

ELISPOT assay was performed as previously described [32]. A screening for cytotoxic T lymphocyte (CTL) responses was performed using a matrix of overlapping peptides (OLP) pool that spanned the entire genome of HIV from p17 in gag gene to nef in the 3′end of the genome; this scan included the env gene. The matrix consists of a set of 410 OLP based on the consensus B sequences of 2001 (HIV immunology database, ( Peptides were generally 18 mers varying from 15–20 amino acids in length and overlapping by 10 amino acids as described [32].

Cryopreserved PBMCs (105 cells) from 1995 and 2004 samples of LTNP-EC were incubated with the matrix peptides, at a 14 µg/µl concentration, in a 96-well plate (Millipore, Barcelona, Spain) pre-coated with anti-human interferon–gamma monoclonal antibody (Mabtech, Sweden). Cells with medium only were used as negative controls and cells with phytohaemagglutinin were used as positive controls. PBMCs were cultured overnight at 37°C, 5% CO2 atmosphere and then washed six times with PBS. Plates were then incubated for 1 hour at room temperature with the biotinylated anti-INF monoclonal antibody (Mabtech, Sweden) followed by 6 washes and 1 hour incubation with the streptavidin-coupled alkaline phosphatase (Mabtech, Sweden). After washing the plate, nitroblue tetrazolium and 5-bromo-4-chloro-3indolul phosphate (Bio-Rad, Barcelona, Spain) was added for color development. After a short incubation, the reaction was stopped by washing the plate with water. The INF production was detected as blue spots, counted using an ELISPOT reader (CTL, Germany). Results are expressed as spot-forming cells (SFC) per million inputs PBMC. Responses were considered positive if they exceeded i) 50 SFC/106 PBMC per well, ii) the mean of negative wells plus 3 standard deviations and iii) three times the mean of the negative well [32]. Positive pools were deconvoluted and individual peptides were retested individually in a confirmatory ELISPOT assay. The breadth of the responses was determined by the sum of all the recognized peptides and the magnitude of the responses was determined as the total sum (SFC/106 PBMC) of the responses to all the peptides eliciting a positive response.

Neutralization test

Sera samples taken at different times (1995, 1996/01, 1996/07 and 1998) were tested with a panel of six recombinant viruses (VI191 subtype A, 92BR025 subtype C, 92UG024 subtype D, CM244 subtype E, AC10 and NL4.3 subtype B) obtained as previously described [33]. To perform neutralization assays, 96-well plates were set up as follows: to the first three columns, 25 µl of medium (DMEM, 10% FBS) was added; to each of the other columns (n° 4 through 12), 25-µl aliquots of the corresponding sera dilution at 1/100 and 1/1000 in DMEM-10% FBS were added. All sera were heat inactivated at 56°C for 30 min before use in neutralization assays. Each virus in a total volume of 75 µl was then added to each well in columns 3 through 12. Virus-free medium was added to columns 1 and 2 (mock). The amount of each virus chosen was the lowest level of viral input sufficient to give a clear luciferase signal within the linear range for each viral strain. The plate was incubated for 1 h at 37°C. After incubation, 104 target cells (TZM-bl) in a volume of 100 µl were added to each well. The plate was then placed into a humidified chamber within a CO2 incubator at 37°C. After 72 h of incubation at 37°C, supernatants were removed and the cell-associated luciferase activity for each well was determined on a micro plate luminometer (Turner biosystems, Sunnyvale, CA) by using a luciferase assay kit (Biotherma, Sweden). Neutralization activity for all samples was measured in triplicate and reported as the percentage of luciferase activity ± standard deviation, corresponding to the viral infectivity after neutralization.


HLA typing and determination of CCR5 haplotypes

To study the LTNP-EC host genetic markers potentially associated with control of disease progression, we assessed the most validated genetic markers [34]. The patient genotype, A*0201/A*0301, B*4402/B*3501, HHC/HHF2, V64V/I, did not include any of the known protective alleles (Table 1) while HLA class II alleles, DRB1*13 and DQB1*16, recently associated with HIV non-progression, were both present in the LTNP-EC.

Replicative capacity of LTNP-EC's chimeric virus

In order to study the virological factors potentially associated with viral control, we cloned the gp160 sequence of env gene from four different variants, three (a1, a2 and a3) corresponding to the different subgroups within the initial “a” virus, and strain b1 corresponding to the superinfecting virus (Figure 2). As shown by the very low quasispecies heterogeneity of 0.93±0.22 for group “a” viruses (after more than 20 years of infection) and 1.15±0.34 for group “b” (after more than 13 years), viral evolution was very limited in the patient. The mean genetic distance from the selected a1 strain to its subgroup was 0.18%±0.1, 0.2±0.1 for a2 virus and 0.6±0.2 for a3 and 1.7%±0.4 for b1 strain. Thus, the four gp160 clones selected were representative of the different variants present in the patient (Figure 2).

The chimeric viruses derived from the patient were functional but gave low titers in TZM-bl cells ranging from 1.1±0.2×102 to 2.2±1.2×103 TCID/ml (Table 2). Replicative capacity of the four selected variants was also tested in U87.CD4.CCR5 cells because they showed a CCR5 genotype in PSSM tool. To discard that the cloning methodology could affect the results, different control viruses were cloned in the same background. Fourteen days after infection, the SF162 reference virus replicated at high p24 levels (around 103 ng/ml of p24) as well as the three variants (Ris 6 C2-2, Ris 3 C6-1 and Ris 3 C9-2) from the rapid progressor patient (RIS) and virus from the patient 64 (Figure 3A). The LTNP-EC variants a2 and b1 produced positive but low levels of p24 (below 1 ng/ml) whereas viruses a1 and a3 did not show any evidence of replicative capacity in this cell line (Figure 3A). As expected the NL4.3 virus, the chimeric virus containing the NL4.3 gp160 region as well as the full length 89ES061 virus, with CXCR4 tropism, did not replicate in this cell line. These viruses were tested in the U87.CD4.CXCR4 cell line and replicated to high p24 levels (>103 ng/ml, data not shown). To reject that the lack of replication of a1 and a3 viruses in U87.CD4.CCR5 cells was due to a CXCR4 tropism, both viruses were assayed in the CXCR4 expressing cell line with negative results (<0.1 ng/ml of p24, data not shown).

Figure 3. Replicative capacity of the recombinant viruses.

Viral replication was measured by the p24 production, showed in logarithmic scale in the Y axis, in U87.CD4.CCR5 in panel A) and PBMC cells in panel B). In X axis are represented days of culture.

Table 2. Viruses titter in TZM-bl and replicative capacity in U87.CD4. CCR5 or CXCR4 cells and PBMCs.

The replicative capacity of the recombinant variants from the LTNP-EC was studied in heterologous PBMC that represent more physiologic conditions (Figure 3B). All control viruses, SF162 and NL4.3 viruses, a gp160 NL4.3 recombinant cloned in the same genetic background or the complete virus from the molecular clone 89ES061 replicated to high levels measured by p24 production. Viruses obtained for patient LTNP 64 or rapid progressor RIS also replicated in PBMCs. In contrast, none of the LTNP-EC viruses showed any replication after 17 days in culture in these cells (Figure 3B). All these data showed that the chimeric viruses with the envelopes from the LTNP-EC viruses were functional but replicated poorly in U87.CD4.CCR5 cells or did not replicate at all in PBMCs.

Gp160 mutations analysis

In order to investigate the mutations or defects that could explain the lack of replication of a1, a2, a3 and b1 viruses, the complete amino-acid sequence of the gp160 region was determined (Figure 4). No relevant deletions or stop codons were observed in the sequence of both viruses. In addition, cysteines and functional sites including the gp120/41 cleavage site, residues related with the receptor and co-receptor binding sites or functional domains in the gp120 and gp41 regions were all conserved. The sequences of the infecting and superinfecting viruses diverged by more than 9.4% [24]. Analysis of unusual residues in conserved positions (more than 85% conservation) in the Los Alamos HIV Sequence Data Base identified 5, 7 and 11 unusual residues in the primo-infecting a1, a2 and a3 variants, while more than 24 unusual aminoacids were identified in the super-infecting b1 virus (Table 3). In “a” viruses three residues G237E, N611D and G825R were represented below 1% in the data base (Table 3). Two changes in relation to the B consensus, N616D in a2 virus and N611S in a2 and a3 viruses produced loss of N–glycosylation sites (Table 3). There are many differences between the two viruses with replicative capacity (a2 and b1), although they showed only two amino acids in common which are different in the viruses a1 and a3; L34 located close to the signal peptide which changed to the unusual residue S in a1 virus and W in a3 virus; and G355, located in the C3 region, that changed to G355E in a1 virus, and G355K in a3 virus. These mutations need to be further analyzed to investigate the potential role in the replication capacity. Overall, we did not found in any of the variants studied defects in the env gene that could be clearly associated with the poor replication capacity.

Figure 4. Gp160 amino-acid sequences of LTNP-EC viruses.

Amino acid sequences of viruses a1, a2, a3 and b1 are shown. Underlined residues marked the N-glycosylation sites. Empty vertical arrows signal CD4+ binding residues. Cysteines in the variable loops in gp120 are marked with asterisks. Shaded areas correspond to the signal peptide, variable regions in gp120, fusion peptide, homology regions and lentivirus lytic peptide (LLP1-2) region in gp41. In green are shown the two positions in common for a2 and b1 viruses and that are different from the non-replicating viruses.

Table 3. Unusual mutations in the gp160 patient viruses compared to the consensus subtype B sequence.

Magnitude and breadth of HIV-specific CTL response in LTNP-EC

To estimate the role of the cellular immune response in the control of viral replication, we evaluated CTL responses of the LTNP-EC in the first sample available after SI (1995 sample). The LTNP-EC responded to a total of 27 peptides (OLP). Of the 27 responses, 6 (22.2%) targeted Gag protein, 3 (11.1%) targeted Nef, 2 (7.04%) Protease, 11 (40%) Reverse Transcriptase, 3 (11.1%) Integrase and 2 (7.04%) Gp120 (Figure 5). The total magnitude of these responses was 35.727 SFC/million PBMC; with the strongest responses targeting p24 and Nef. The response in gag (OLP p2-p7-p1-p6) contains a HLA-DR1*13 restricted T helper epitope (Figure 5). Among the 27 OLP responses, 6 OLP contained optimal CTL epitopes for which the LTNP-EC expressed the known restricting HLA class I alleles (Table 4). For 4 of these 6 optimal epitopes, the autologous viral sequence showed the presence of classical HLA footprint mutations in different genes associated with the LTNP-EC's HLA, indicating that the virus had likely adapted to and escaped from this host immune response (Table 4).

Figure 5. IFN-γ ELISPOT analysis of the HIV-1 specific CD8+ T cell response in the LTNP-EC.

The analysis was performed in the first sample available after SI (▪) and on a second one taken 8.8 years later (▪). The results are expressed as spot-forming cells (SFC) per million inputs PBMC in Y axis. The X axis shows the overlapping peptides in viral proteins along the genome eliciting a positive response.

Table 4. Mutations found in optimal epitopes along the LTNP-EC viral genome.

We also compared the CTL responses of the first sample available after SI (1995) with a second one taken 8.8 years later (sample 2004). In this second sample the study subject had a total breadth of 23 responses, of which 13 (56.5%) were already detected at the first time point. In this case, the total magnitude was 26.080 SFC/million PBMC (Table 5). A relative shift from Gag p24-specific responses towards targets in Integrase and Nef-specific responses was noted (Figure 5). Of note, is that 26 of these T cell targets are located in relatively conserved regions.

Table 5. Patient CTL response in comparison with Peruvian Cohort of treatment naïve chronically HIV-1 infected individuals and Barcelona Controllers.

In order to compare these cellular immune responses to reactivities in HIV controllers and non-controllers, we compared the data from the SI LTNP-EC with data from a cohort of 250 treatment naïve Peruvian patients (Table 5) with heterogeneous immunological and virological markers (median of 385 CD4+ T cells/µl and a median viral load of 35.732 copies of RNA/ml (range <40 to >750.000). The median breadth of OLP responses in this cohort was 15, placing the response breadth in the study subject in the 85 percentile with the first sample and the 80 percentile with the second sample. When comparing the median magnitude of the CTL responses in the Peruvian cohort (median 5.202 SFC/million PBMC), the study subject response fell into the 99.5 and 98 percentile in the two samples analyzed, respectively (i.e. only one patient out of the 250 subjects studied in Lima had a greater magnitude than the study subject). In addition, the response in the SI individual was also compared to responses in a group of 25 HIV controllers (EC, viremic controllers and LTNPs individuals) from a cohort in Barcelona not expressing HLA-B*57, HLA-B*58 or HLA-B*27 (Table 5). This cohort showed a median viral load of 2.072 (range <40 to <10.000) of RNA/ml and a median of 696 CD4+ T cells/µl and had a median breath of 23 OLP with a total magnitude of 19.345 SFC/million PBMC. The response seen in the LTNP-EC still scored high, exceeding the median breadth and magnitude of the responses in this controller cohort at both time points (67% and 69% percentile in 1995 and 2004, respectively for breadth, and 71% and 88% percentile, respectively for magnitude). Thus, the LTNP-EC mounted HIV specific T cell responses that were in the highest percentiles in a large cross-sectional, unrestricted HIV infected cohort and still in the top third when compared to a more limited, specific controller cohort. These data suggest that the study subject had broad, strong and sustained CTL response to HIV, including responses to high conserved regions of the HIV genome, which could contribute to viral control “in vivo”.

Neutralization assay

The neutralization capacity of the LTNP-EC plasma samples was assayed against a mini-panel of six recombinant viruses with envelopes from different subtypes and tropisms (see Materials and Methods). Previous work determined that the recombinant viruses in the panel adequately represented the global HIV-1 diversity [33]. Table 6 summarizes the neutralization activity of the study subject serum at four different time points. No differences in the neutralization activity were observed between the sample close to SI (around 1995–1996) and the sample analyzed three years latter (Table 6). The LTNP-EC achieved 50% neutralization against 4 (V1 191, NL4.3, 92BR025 and 92UG024) out the 6 recombinant viruses assayed at 1/100 dilution and against one (NL4.3) at 1/1000 dilution. This result was compared with the neutralization results obtained in a previous work from 248 samples for 191 untreated patients (Table 7) [33]. Only 18.5% of samples showed 50% neutralization at 1/200 dilution against 4 of the panel viruses as LTNP-EC patient did. These results indicate that the patient has a neutralization response above the average response in HIV-1 infected patients.


In this work we described a very uncommon case of SI in an HIV-1 LTNP-EC. This study subject, who maintained the EC status for 20 years even after SI, showed natural control of the two viruses in the absence of protective HLA class I alleles. The investigation of the viral and immune factors associated with viral control identified a strong and sustained broad CTL and high neutralization response, beneficial HLA class II alleles as well as the presence of deleterious viruses as potential factors contributing for the observed clinical outcome.

Host genetic factors, like co-receptors polymorphisms and HLA I alleles, have been strongly associated with long term virological control [11]. However, these markers account only for 20% of the “controllers” phenotype [34] and more than 25% of the elite and viremic controllers patients lack HLA class I protective alleles [35]. The LTNP-EC studied did not carry any protective HLA class I haplotypes but showed HLA-DRB1*13 and DQB1*06 MHC class II haplotypes that have been associated to slow disease progression [12]. How these alleles or the CD4+ T cell responses restricted by these alleles mediate their beneficial effect remains unclear, but may include the induction of potent CD4+ T cell responses that could maintain effective CTL activities [36], [37]. In fact a strong response in Gag which contains a HLA-DR1*13 restricted T helper epitope has been observed. Alternatively, these HLA-class II restricted CD4+ T cell responses may also exert direct cytolytic effects on infected cells; a possibility that could not be tested due to sample limitations [38].

Due to the extremely low viral load and to the selection of the fittest variant when the co-culture method is applied [39], [40], [41], [42], we were unable to obtain the initial and the SI viruses from the LTNP-EC's patient by this method. Although it is established that defective variants could be found in the proviral population [43], the only possibility for the analysis of the viruses from the LTNP-EC was the amplification of proviral sequences from PBMCs DNA in longitudinal samples. To analyze the replicative capacity of the viruses present in the LTNP-EC, four variants, representative of the different sub-group of sequences from the two viruses, were selected for the generation of chimeric viruses. It is worth to highlight that the LTNP-EC's viruses displayed a very limited genetic variability within each virus, as can be deduced from the short length of the branches in the phylogenetic tree indicating a strong control of viral replication after many years of infection (Figure 2).

It is well known that provirus from patients may include many defective viruses, i.e. viruses that are not able to replicate [43]. In contrast, the study patient presented deleterious virus, i.e. viruses that are functional but poorly replicating. This is supported in the fact that the four chimeric viruses with HIV-1 envelopes derived from the different viruses of the primo and SI showed functional envelopes as shown by the replication in TZM-bl cells (Table 2). However, only two of these viruses were able to replicate although at low levels in U87.CD4.CCR5 cells (Figure 3). We did not found in any of the variants studied defects in the env gene that could be clearly associated with the poor replication capacity. However a high number of unusual mutations were observed. This result is in agreement with the results obtained by Alexander et al that suggested that unusual, difficult-to- revert polymorphisms in HIV-1 can be associated with slow progression or non-progression in a majority of cases [4].

The presence of viruses with limited replicative capacity before and after SI could be explained by two hypotheses: i) the study subject was infected twice by viruses with a very low replicative capacity. Although this option could not be rejected, it seems unlikely because it is known that there is wide spectrum of phenotypic characteristics among primary isolates [44]. Consequently the probability to be infected two times with deleterious viruses that are possibly more difficult to be transmitted, should be very low. ii) The LTNP-EC was infected by phenotypically diverse viruses, but during the infection, the remarkable immune cell response of the LTNP-EC was able to eliminate the cells infected with highly replicating viruses. This mechanism would lead to the accumulation of reservoir cells with low replicating or defective variants and could explain the low in vitro replicative potential observed.

Accumulation in the proviral quasispecies of impaired viruses with truncated env in absence of nef function has been previously observed [3]. Plasma viruses from ES did not replicate in sufficient amount to be archived as suggested by the discordance observed between gag sequences from plasma virus and virus archived in T cells [45]. Other authors reported that cells expressing intact antigens were eradicated, leaving only the cells containing the HIV defective genomes [46].

In the reported SI cases in HIV-1 infections, viral control is generally lost after SI even in EC patients [23]. HIV-1 SI despite broad CD8+ T cell responses containing replication of the primary virus was observed [47] and the responses generated after SI were not sufficiently effective to contain the second virus [48]. Our results suggest that the LTNP-EC immune response was able to control two very divergent viruses (9,4% of genetic distance between “a” and “b” viruses [24]. Although we analyzed one sample close to SI and the second sample eight years later, the CTL response was maintained and it was considerably broader and stronger than in typical or non progressor patients (Figure 5 and Table 5).

Previous work shows that the impact of T cell responses on control of viral replication cannot be explained by quantification of the magnitude and breadth of this response [49]. Multiple studies have shown that is the poly-functionality of the CTL response in EC patients the responsible of the immune control [50]. Poly-functional analyses in this study could have provided additional information on the potential quality of these responses but the lack of samples did not permit the analysis. However, it has recently shown that frequent and strong responses to conserved regions are associated with relatively controlled HIV infection [51]. In our study, 26 of the CTL response are located in relatively conserved regions suggesting that the cellular immune response could indeed have contributed to the control shown by the patient.

The neutralizing antibody response of this LTNP-EC was analyzed measuring heterologous neutralization against a panel of reference strains. The observation that neutralizing antibodies are capable of preventing infection in animal models [52] initially suggested that this kind of response might be able to prevent SI in humans. In support of this hypothesis is a study in which the lack of neutralizing antibody response had been associated with a predisposition to SI [53]. However, a more extensive study showed that SI can occur even in the presence of a good neutralizing response [54]. LTNP-EC sera were capable of neutralizing 4 out of the 6 strains analyzed from 5 different subtypes. The good neutralizing response observed in this individual contrasts with the poor heterologous response previously reported for LTNPs [15], [16], [18], [55], [56]. This unexpected good response observed in this patient, is also high when compared to the neutralizing response from samples taken from patients with typical progression. These results are in agreement with a previous work in which dual HIV-1 infection by genetically distant strains, as in the SI LTNP-EC patient, correlated with significantly increased potency and breadth in anti-HIV-1 neutralizing antibody response [57].

In summary, this study associates the ability to contain two divergent HIV infections with the maintenance of a strong HIV-1-specific CD8+ T cell response, beneficial HLA class II alleles as well as a good humoral neutralization response in a SI HIV-1 LTNP-EC. In addition, representative variants from the primo and SI viruses showed impaired replicative capacity in U87-CCR5 and PBMCs cells.

Whether the strong cellular and humoral immune responses were indeed mediating viral control and how other SI LTNP-EC contain their secondary viruses will require the identification of larger numbers of dually or super-infected LTNP-EC and close monitoring of these subjects from early infections time points. Although the latter may be complicated as secondary infections may go clinically unnoticed, such studies may warrant the effort as they could be highly informative for HIV vaccine immunogen development.

Author Contributions

Conceived and designed the experiments: MP CB CLG. Performed the experiments: MP CC CA AL VSM BM JLV EG. Analyzed the data: MP CC AT EY CB CLG. Contributed reagents/materials/analysis tools: BM LR JLV JS. Wrote the paper: MP EY AT CB CLG.


  1. 1. Casado C, Colombo S, Rauch A, Martinez R, Gunthard HF, et al. (2010) Host and viral genetic correlates of clinical definitions of HIV-1 disease progression. PLoS One 5: e11079.C. CasadoS. ColomboA. RauchR. MartinezHF Gunthard2010Host and viral genetic correlates of clinical definitions of HIV-1 disease progression.PLoS One5e11079
  2. 2. Deacon NJ, Tsykin A, Solomon A, Smith K, Ludford-Menting M, et al. (1995) Genomic Structure of an Attenuated Quasi Species of HIV-1 from a Blood Transfusion Donor and Recipients. Science 270: 988–991.NJ DeaconA. TsykinA. SolomonK. SmithM. Ludford-Menting1995Genomic Structure of an Attenuated Quasi Species of HIV-1 from a Blood Transfusion Donor and Recipients.Science270988991
  3. 3. Calugi G, Montella F, Favalli C, Benedetto A (2006) Entire genome of a strain of human immunodeficiency virus type 1 with a deletion of nef that was recovered 20 years after primary infection: large pool of proviruses with deletions of env. J Virol 80: 11892–11896.G. CalugiF. MontellaC. FavalliA. Benedetto2006Entire genome of a strain of human immunodeficiency virus type 1 with a deletion of nef that was recovered 20 years after primary infection: large pool of proviruses with deletions of env.J Virol801189211896
  4. 4. Alexander L, Weiskopf E, Greenough TC, Gaddis NC, Auerbach MR, et al. (2000) Unusual polymorphisms in human immunodeficiency virus type 1 associated with nonprogressive infection. J Virol 74: 4361–4376.L. AlexanderE. WeiskopfTC GreenoughNC GaddisMR Auerbach2000Unusual polymorphisms in human immunodeficiency virus type 1 associated with nonprogressive infection.J Virol7443614376
  5. 5. Miura T, Brumme ZL, Brockman MA, Rosato P, Sela J, et al. (2010) Impaired replication capacity of acute/early viruses in persons who become HIV controllers. J Virol 84: 7581–7591.T. MiuraZL BrummeMA BrockmanP. RosatoJ. Sela2010Impaired replication capacity of acute/early viruses in persons who become HIV controllers.J Virol8475817591
  6. 6. Brumme ZL, Li C, Miura T, Sela J, Rosato PC, et al. (2011) Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers. J Acquir Immune Defic Syndr 56: 100–108.ZL BrummeC. LiT. MiuraJ. SelaPC Rosato2011Reduced replication capacity of NL4-3 recombinant viruses encoding reverse transcriptase-integrase sequences from HIV-1 elite controllers.J Acquir Immune Defic Syndr56100108
  7. 7. Miura T, Brockman M, Pereyra F, Li B, Sheneidewind A, et al. (2007) Gross viral genetic defects unlikely explain many of spontaneous HIV-1 viremia controllers. T. MiuraM. BrockmanF. PereyraB. LiA. Sheneidewind2007Gross viral genetic defects unlikely explain many of spontaneous HIV-1 viremia controllers.Abstract 14Th Conference on Retrovirus and Opportunistic Infections Los Angeles. Abstract 14Th Conference on Retrovirus and Opportunistic Infections Los Angeles.
  8. 8. Lassen KG, Lobritz MA, Bailey JR, Johnston S, Nguyen S, et al. (2009) Elite suppressor-derived HIV-1 envelope glycoproteins exhibit reduced entry efficiency and kinetics. PLoS Pathog 5: e1000377.KG LassenMA LobritzJR BaileyS. JohnstonS. Nguyen2009Elite suppressor-derived HIV-1 envelope glycoproteins exhibit reduced entry efficiency and kinetics.PLoS Pathog5e1000377
  9. 9. Gonzalez E, Bamshad M, Sato N, Mummidi S, Dhanda R, et al. (1999) Race-specific HIV-1 disease-modifying effects associated with CCR5 haplotypes. Proc Natl Acad Sci USA 96: 12004–12009.E. GonzalezM. BamshadN. SatoS. MummidiR. Dhanda1999Race-specific HIV-1 disease-modifying effects associated with CCR5 haplotypes.Proc Natl Acad Sci USA961200412009
  10. 10. Deeks SG, Walker BD (2007) Human Immunodeficiency Virus Controllers: Mechanisms of Durable Virus Control in the Absence of Antiretroviral Therapy. Immunity 27: 406–416.SG DeeksBD Walker2007Human Immunodeficiency Virus Controllers: Mechanisms of Durable Virus Control in the Absence of Antiretroviral Therapy.Immunity27406416
  11. 11. Migueles SA, Sabbaghian MS, Shupert WL, Bettinotti MP, Marincola FM, et al. (2000) HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors. Proc Natl Acad Sci U S A 97: 2709–2714.SA MiguelesMS SabbaghianWL ShupertMP BettinottiFM Marincola2000HLA B*5701 is highly associated with restriction of virus replication in a subgroup of HIV-infected long term nonprogressors.Proc Natl Acad Sci U S A9727092714
  12. 12. Ferre AL, Hunt PW, McConnell DH, Morris MM, Garcia JC, et al. (2010) HIV controllers with HLA-DRB1*13 and HLA-DQB1*06 alleles have strong, polyfunctional mucosal CD4+ T-cell responses. J Virol 84: 11020–11029.AL FerrePW HuntDH McConnellMM MorrisJC Garcia2010HIV controllers with HLA-DRB1*13 and HLA-DQB1*06 alleles have strong, polyfunctional mucosal CD4+ T-cell responses.J Virol841102011029
  13. 13. Altfeld M, Rosenberg ES (2000) The role of CD4 (+) T helper cells in the cytotoxic T lymphocyte response to HIV-1. Curr Opin Immunol 12: 375–380.M. AltfeldES Rosenberg2000The role of CD4 (+) T helper cells in the cytotoxic T lymphocyte response to HIV-1.Curr Opin Immunol12375380
  14. 14. Koup RA, Safrit JT, Cao Y, Andrews CA, McLeod G, et al. (1994) Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J Virol 68: 4650–4655.RA KoupJT SafritY. CaoCA AndrewsG. McLeod1994Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome.J Virol6846504655
  15. 15. Bailey JR, Lassen KG, Yang HC, Quinn TC, Ray SC, et al. (2006) Neutralizing antibodies do not mediate suppression of human immunodeficiency virus type 1 in elite suppressors or selection of plasma virus variants in patients on highly active antiretroviral therapy. J Virol 80: 4758–4770.JR BaileyKG LassenHC YangTC QuinnSC Ray2006Neutralizing antibodies do not mediate suppression of human immunodeficiency virus type 1 in elite suppressors or selection of plasma virus variants in patients on highly active antiretroviral therapy.J Virol8047584770
  16. 16. Lambotte O, Ferrari G, Moog C, Yates NL, Liao HX, et al. (2009) Heterogeneous neutralizing antibody and antibody-dependent cell cytotoxicity responses in HIV-1 elite controllers. AIDS 23: 897–906.O. LambotteG. FerrariC. MoogNL YatesHX Liao2009Heterogeneous neutralizing antibody and antibody-dependent cell cytotoxicity responses in HIV-1 elite controllers.AIDS23897906
  17. 17. Mahalanabis M, Jayaraman P, Miura T, Pereyra F, Chester EM, et al. (2009) Continuous Viral Escape and Selection by Autologous Neutralizing Antibodies in Drug-Naive Human Immunodeficiency Virus Controllers. J Virol 83: 662–672.M. MahalanabisP. JayaramanT. MiuraF. PereyraEM Chester2009Continuous Viral Escape and Selection by Autologous Neutralizing Antibodies in Drug-Naive Human Immunodeficiency Virus Controllers.J Virol83662672
  18. 18. Pereyra F, Addo MM, Kaufmann DE, Liu Y, Miura T, et al. (2008) Genetic and Immunologic Heterogeneity among Persons Who Control HIV Infection in the Absence of Therapy. J Infect Dis 197(4): 563–571.F. PereyraMM AddoDE KaufmannY. LiuT. Miura2008Genetic and Immunologic Heterogeneity among Persons Who Control HIV Infection in the Absence of Therapy.J Infect Dis1974563571
  19. 19. Doria-Rose NA, Klein RM, Daniels MG, O'Dell S, Nason M, et al. (2010) Breadth of human immunodeficiency virus-specific neutralizing activity in sera: clustering analysis and association with clinical variables. J Virol 84: 1631–1636.NA Doria-RoseRM KleinMG DanielsS. O'DellM. Nason2010Breadth of human immunodeficiency virus-specific neutralizing activity in sera: clustering analysis and association with clinical variables.J Virol8416311636
  20. 20. Fang G, Weiser B, Kuiken C, Philpott SM, Rowland-Jones S, et al. (2004) Recombination following superinfection by HIV-1. AIDS 18: 153–159.G. FangB. WeiserC. KuikenSM PhilpottS. Rowland-Jones2004Recombination following superinfection by HIV-1.AIDS18153159
  21. 21. Clerc O, Colombo S, Yerly S, Telenti A, Cavassini M (2010) HIV-1 elite controllers: Beware of super-infections. J Clin Virol 47(4): 376–378.O. ClercS. ColomboS. YerlyA. TelentiM. Cavassini2010HIV-1 elite controllers: Beware of super-infections.J Clin Virol474376378
  22. 22. Braibant M, Xie J, Samri A, Agut H, Autran B, et al. (2010) Disease progression due to dual infection in an HLA-B57-positive asymptomatic long-term nonprogressor infected with a nef-defective HIV-1 strain. Virology 405: 81–92.M. BraibantJ. XieA. SamriH. AgutB. Autran2010Disease progression due to dual infection in an HLA-B57-positive asymptomatic long-term nonprogressor infected with a nef-defective HIV-1 strain.Virology4058192
  23. 23. Rachinger A, Navis M, van Assen S, Groeneveld PH, Schuitemaker H (2008) Recovery of viremic control after superinfection with pathogenic HIV type 1 in a long-term elite controller of HIV type 1 infection. Clin Infect Dis 47: 86–89.A. RachingerM. NavisS. van AssenPH GroeneveldH. Schuitemaker2008Recovery of viremic control after superinfection with pathogenic HIV type 1 in a long-term elite controller of HIV type 1 infection.Clin Infect Dis478689
  24. 24. Casado C, Pernas M, Alvaro T, Sandonis V, Garcia S, et al. (2007) Coinfection and superinfection in patients with long-term, nonprogressive HIV-1 disease. J Infect Dis 196: 895–899.C. CasadoM. PernasT. AlvaroV. SandonisS. Garcia2007Coinfection and superinfection in patients with long-term, nonprogressive HIV-1 disease.J Infect Dis196895899
  25. 25. Fellay J, Shianna KV, Ge D, Colombo S, Ledergerber B, et al. (2007) A Whole-Genome Association Study of Major Determinants for Host Control of HIV-1. Science 317: 944–947.J. FellayKV ShiannaD. GeS. ColomboB. Ledergerber2007A Whole-Genome Association Study of Major Determinants for Host Control of HIV-1.Science317944947
  26. 26. Sandonis V, Casado C, Alvaro T, Pernas M, Olivares I, et al. (2009) A combination of defective DNA and protective host factors are found in a set of HIV-1 ancestral LTNPs. Virology 391: 73–82.V. SandonisC. CasadoT. AlvaroM. PernasI. Olivares2009A combination of defective DNA and protective host factors are found in a set of HIV-1 ancestral LTNPs.Virology3917382
  27. 27. Olivares I, Shaw G, López-Galíndez C (1997) Phenotypic switch in a Spanish HIV Type 1 isolate on serial passage on MT-4 cells. AIDS Res Hum Retroviruses 13(11): 979–984.I. OlivaresG. ShawC. López-Galíndez1997Phenotypic switch in a Spanish HIV Type 1 isolate on serial passage on MT-4 cells.AIDS Res Hum Retroviruses1311979984
  28. 28. Perucho M, Hanahan D, Wigler M (1980) Genetic and physical linkage of exogenous sequences in transformed cells. Cell 22: 309–317.M. PeruchoD. HanahanM. Wigler1980Genetic and physical linkage of exogenous sequences in transformed cells.Cell22309317
  29. 29. Derdeyn CA, Decker JM, Sfakianos JN, Wu X, O'Brien WA, et al. (2000) Sensitivity of human immunodeficiency virus type 1 to the fusion inhibitor T-20 is modulated by coreceptor specificity defined by the V3 loop of gp120. J Virol 74: 8358–8367.CA DerdeynJM DeckerJN SfakianosX. WuWA O'Brien2000Sensitivity of human immunodeficiency virus type 1 to the fusion inhibitor T-20 is modulated by coreceptor specificity defined by the V3 loop of gp120.J Virol7483588367
  30. 30. Mascola JR (1999) Neutralization of HIV-1 Infection of Human Peripheral Blood Mononuclear Cells (PBMC): Infectivity Reduction Method. Methods Mol Med 17: 317–322.JR Mascola1999Neutralization of HIV-1 Infection of Human Peripheral Blood Mononuclear Cells (PBMC): Infectivity Reduction Method.Methods Mol Med17317322
  31. 31. Meng Z, He X, Xing H, Xin R, Sun J, et al. (2008) Construction and characterization of an infectious molecular clone of HIV type 1 CRF07_BC. AIDS Res Hum Retroviruses 24: 259–264.Z. MengX. HeH. XingR. XinJ. Sun2008Construction and characterization of an infectious molecular clone of HIV type 1 CRF07_BC.AIDS Res Hum Retroviruses24259264
  32. 32. Frahm N, Korber BT, Adams CM, Szinger JJ, Draenert R, et al. (2004) Consistent cytotoxic-T-lymphocyte targeting of immunodominant regions in human immunodeficiency virus across multiple ethnicities. J Virol 78: 2187–2200.N. FrahmBT KorberCM AdamsJJ SzingerR. Draenert2004Consistent cytotoxic-T-lymphocyte targeting of immunodominant regions in human immunodeficiency virus across multiple ethnicities.J Virol7821872200
  33. 33. Medina-Ramírez M, Sanchez-Merino V, Sanchez-Palomino S, Merino-Mansilla A, Ferreira CB, et al. (2011) Broadly Cross-Neutralizing Antibodies in HIV-1 Patients with Undetectable Viremia. J Virol 85(12): 5804–5813.M. Medina-RamírezV. Sanchez-MerinoS. Sanchez-PalominoA. Merino-MansillaCB Ferreira2011Broadly Cross-Neutralizing Antibodies in HIV-1 Patients with Undetectable Viremia.J Virol851258045813
  34. 34. Fellay J, Ge D, Shianna KV, Colombo S, Ledergerber B, et al. (2009) Common genetic variation and the control of HIV-1 in humans. PLoS Genet 5: e1000791.J. FellayD. GeKV ShiannaS. ColomboB. Ledergerber2009Common genetic variation and the control of HIV-1 in humans.PLoS Genet5e1000791
  35. 35. Pereyra F, Palmer S, Miura T, Block Brian L, Wiegand A, et al. (2009) Persistent Low Level Viremia in HIV-1 Elite Controllers and Relationship to Immunologic Parameters. J Infec Dis 200(6): 984–990.F. PereyraS. PalmerT. MiuraL. Block BrianA. Wiegand2009Persistent Low Level Viremia in HIV-1 Elite Controllers and Relationship to Immunologic Parameters.J Infec Dis2006984990
  36. 36. Gasser O, Bihl FK, Wolbers M, Loggi E, Steffen I, et al. (2007) HIV patients developing primary CNS lymphoma lack EBV-specific CD4+ T cell function irrespective of absolute CD4+ T cell counts. PLoS Med 4: e96.O. GasserFK BihlM. WolbersE. LoggiI. Steffen2007HIV patients developing primary CNS lymphoma lack EBV-specific CD4+ T cell function irrespective of absolute CD4+ T cell counts.PLoS Med4e96
  37. 37. Lichterfeld M, Kaufmann DE, Yu XG, Mui SK, Addo MM, et al. (2004) Loss of HIV-1 specific CD8+ T cell Proliferation after Acute HIV-1 Infection and Restoration by Vaccine-induced HIV-1 specific CD4+ T Cells. J Exp Med 200(6): 701–712.M. LichterfeldDE KaufmannXG YuSK MuiMM Addo2004Loss of HIV-1 specific CD8+ T cell Proliferation after Acute HIV-1 Infection and Restoration by Vaccine-induced HIV-1 specific CD4+ T Cells.J Exp Med2006701712
  38. 38. Lotti B, Wendland T, Furrer H, Yawalkar N, von Greyerz S, et al. (2002) Cytotoxic HIV-1 p55gag-specific CD4+ T cells produce HIV-inhibitory cytokines and chemokines. J Clin Immunol 22: 253–262.B. LottiT. WendlandH. FurrerN. YawalkarS. von Greyerz2002Cytotoxic HIV-1 p55gag-specific CD4+ T cells produce HIV-inhibitory cytokines and chemokines.J Clin Immunol22253262
  39. 39. Kusumi K, Conway B, Cunningham S, Berson A, Evans C, et al. (1992) Human Immunodeficiency Virus Type 1 Envelope Gene Structure and Diversity and after Cocultivation In Vitro. J Virol 66: 875–885.K. KusumiB. ConwayS. CunninghamA. BersonC. Evans1992Human Immunodeficiency Virus Type 1 Envelope Gene Structure and Diversity and after Cocultivation In Vitro.J Virol66875885
  40. 40. Meyerhans A, Cheynier R, Albert J, Seth M, Kwok S, et al. (1989) Temporal fluctuations in HIV quasispecies in vivo are not reflected by sequential HIV isolations. Cell 58: 901–910.A. MeyerhansR. CheynierJ. AlbertM. SethS. Kwok1989Temporal fluctuations in HIV quasispecies in vivo are not reflected by sequential HIV isolations.Cell58901910
  41. 41. Spira AI, Ho DD (1995) Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J Virol 69: 422–429.AI SpiraDD Ho1995Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro.J Virol69422429
  42. 42. Voronin Y, Chohan B, Emerman M, Overbaugh J (2007) Primary Isolates of Human Immunodeficiency Virus Type 1 Are Usually Dominated by the Major Variants Found in Blood. J Virol 81: 10232–10241.Y. VoroninB. ChohanM. EmermanJ. Overbaugh2007Primary Isolates of Human Immunodeficiency Virus Type 1 Are Usually Dominated by the Major Variants Found in Blood.J Virol811023210241
  43. 43. Li Y, Kappes JC, Conway JA, Price RW, Shaw GM, et al. (1991) Molecular characterization of human immunodeficiency virus type 1 cloned directly from uncultered human brain tissue: identification of replication-competent and -defective viral genomes. J Virol 65: 3973–3985.Y. LiJC KappesJA ConwayRW PriceGM Shaw1991Molecular characterization of human immunodeficiency virus type 1 cloned directly from uncultered human brain tissue: identification of replication-competent and -defective viral genomes.J Virol6539733985
  44. 44. Arien KK, Abraha A, Quinones-Mateu ME, Kestens L, Vanham G, et al. (2005) The Replicative Fitness of Primary Human Immunodeficiency Virus Type 1 (HIV-1) Group M, HIV-1 Group O, and HIV-2 Isolates. J Virol 79: 8979–8990.KK ArienA. AbrahaME Quinones-MateuL. KestensG. Vanham2005The Replicative Fitness of Primary Human Immunodeficiency Virus Type 1 (HIV-1) Group M, HIV-1 Group O, and HIV-2 Isolates.J Virol7989798990
  45. 45. O'Connell KA, Brennan TP, Bailey JR, Ray SC, Siliciano RF, et al. (2010) Control of HIV-1 in elite suppressors despite ongoing replication and evolution in plasma virus. J Virol 84: 7018–7028.KA O'ConnellTP BrennanJR BaileySC RayRF Siliciano2010Control of HIV-1 in elite suppressors despite ongoing replication and evolution in plasma virus.J Virol8470187028
  46. 46. Wang B, Dyer WB, Zaunders JJ, Mikhail M, Sullivan JS, et al. (2002) Comprehensive analyses of a unique HIV-1-infected nonprogressor reveal a complex association of immunobiological mechanisms in the context of replication-incompetent infection. Virology 304: 246–264.B. WangWB DyerJJ ZaundersM. MikhailJS Sullivan2002Comprehensive analyses of a unique HIV-1-infected nonprogressor reveal a complex association of immunobiological mechanisms in the context of replication-incompetent infection.Virology304246264
  47. 47. Altfeld M, Allen TM, Yu XG, Johnston MN, Agrawal D, et al. (2002) HIV-1 superinfection despite broad CD8+ T-cell responses containing replication of the primary virus. Nature 420: 434–439.M. AltfeldTM AllenXG YuMN JohnstonD. Agrawal2002HIV-1 superinfection despite broad CD8+ T-cell responses containing replication of the primary virus.Nature420434439
  48. 48. Yang OO, Daar ES, Jamieson BD, Balamurugan A, Smith DM, et al. (2005) Human Immunodeficiency Virus Type 1 Clade B Superinfection: Evidence for Differential Immune Containment of Distinct Clade B Strains. J Virol 79: 860–868.OO YangES DaarBD JamiesonA. BalamuruganDM Smith2005Human Immunodeficiency Virus Type 1 Clade B Superinfection: Evidence for Differential Immune Containment of Distinct Clade B Strains.J Virol79860868
  49. 49. Addo MM, Yu XG, Rathod A, Cohen D, Eldridge RL, et al. (2003) Comprehensive epitope analysis of human immunodeficiency virus type 1 (HIV-1)-specific T-cell responses directed against the entire expressed HIV-1 genome demonstrate broadly directed responses, but no correlation to viral load. J Virol 77: 2081–2092.MM AddoXG YuA. RathodD. CohenRL Eldridge2003Comprehensive epitope analysis of human immunodeficiency virus type 1 (HIV-1)-specific T-cell responses directed against the entire expressed HIV-1 genome demonstrate broadly directed responses, but no correlation to viral load.J Virol7720812092
  50. 50. Blankson JN (2010) Control of HIV-1 replication in elite suppressors. Discov Med 9: 261–266.JN Blankson2010Control of HIV-1 replication in elite suppressors.Discov Med9261266
  51. 51. Mothe B, Llano A, Ibarrondo J, Daniels M, Miranda C, et al. (2011) Definition of the viral targets of protective HIV-1-specific T cell responses. J Transl Med 9: 208.B. MotheA. LlanoJ. IbarrondoM. DanielsC. Miranda2011Definition of the viral targets of protective HIV-1-specific T cell responses.J Transl Med9208
  52. 52. Sealy R, Zhan X, Lockey TD, Martin L, Blanchard J, et al. (2009) SHIV infection protects against heterologous pathogenic SHIV challenge in macaques: a gold-standard for HIV-1 vaccine development? Curr HIV Res 7: 497–503.R. SealyX. ZhanTD LockeyL. MartinJ. Blanchard2009SHIV infection protects against heterologous pathogenic SHIV challenge in macaques: a gold-standard for HIV-1 vaccine development?Curr HIV Res7497503
  53. 53. Smith DM, Strain MC, Frost SD, Pillai SK, Wong JK, et al. (2006) Lack of neutralizing antibody response to HIV-1 predisposes to superinfection. Virology 355: 1–5.DM SmithMC StrainSD FrostSK PillaiJK Wong2006Lack of neutralizing antibody response to HIV-1 predisposes to superinfection.Virology35515
  54. 54. Blish CA, Dogan OC, Derby NR, Nguyen M-A, Chohan B, et al. (2008) Human Immunodeficiency Virus Type 1 Superinfection Occurs despite Relatively Robust Neutralizing Antibody Responses. J Virol 82(24): 12094–12103.CA BlishOC DoganNR DerbyM-A NguyenB. Chohan2008Human Immunodeficiency Virus Type 1 Superinfection Occurs despite Relatively Robust Neutralizing Antibody Responses.J Virol82241209412103
  55. 55. Doria-Rose NA, Klein RM, Manion MM, O'Dell S, Phogat A, et al. (2009) Frequency and phenotype of human immunodeficiency virus envelope-specific B cells from patients with broadly cross-neutralizing antibodies. J Virol 83: 188–199.NA Doria-RoseRM KleinMM ManionS. O'DellA. Phogat2009Frequency and phenotype of human immunodeficiency virus envelope-specific B cells from patients with broadly cross-neutralizing antibodies.J Virol83188199
  56. 56. Mahalanabis M, Jayaraman P, Miura T, Pereyra F, Chester EM, et al. (2009) Continuous Viral Escape and Selection by Autologous Neutralizing Antibodies in Drug-Naive Human Immunodeficiency Virus Controllers. J Virol 83(2): 662–672.M. MahalanabisP. JayaramanT. MiuraF. PereyraEM Chester2009Continuous Viral Escape and Selection by Autologous Neutralizing Antibodies in Drug-Naive Human Immunodeficiency Virus Controllers.J Virol832662672
  57. 57. Powell RL, Kinge T, Nyambi PN (2010) Infection by discordant strains of HIV-1 markedly enhances the neutralizing antibody response against heterologous virus. J Virol 84: 9415–9426.RL PowellT. KingePN Nyambi2010Infection by discordant strains of HIV-1 markedly enhances the neutralizing antibody response against heterologous virus.J Virol8494159426