Browse Subject Areas

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Anaesthetic Impairment of Immune Function Is Mediated via GABAA Receptors

  • Daniel W. Wheeler,

    Affiliation Division of Anaesthesia, University of Cambridge, Addenbrooke's Hospital, Cambridge, United Kingdom

  • Andrew J. Thompson,

    Affiliation Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom

  • Federico Corletto,

    Affiliation Division of Anaesthesia, University of Cambridge, Addenbrooke's Hospital, Cambridge, United Kingdom

  • Jill Reckless,

    Affiliation Department of Medicine, University of Cambridge, Addenbrooke's Hospital, Cambridge, United Kingdom

  • Justin C. T. Loke,

    Affiliation Division of Anaesthesia, University of Cambridge, Addenbrooke's Hospital, Cambridge, United Kingdom

  • Nicolas Lapaque,

    Affiliation Department of Pathology, University of Cambridge, Cambridge, United Kingdom

  • Andrew J. Grant,

    Affiliation Department of Veterinary Medicine, University of Cambridge, Cambridge, United Kingdom

  • Pietro Mastroeni,

    Affiliation Department of Veterinary Medicine, University of Cambridge, Cambridge, United Kingdom

  • David J. Grainger,

    Affiliation Department of Medicine, University of Cambridge, Addenbrooke's Hospital, Cambridge, United Kingdom

  • Claire L. Padgett,

    Affiliation Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom

  • John A. O'Brien,

    Affiliation Neurobiology Division, MRC Laboratory of Molecular Biology, Cambridge, United Kingdom

  • Nigel G. A. Miller,

    Affiliation Department of Pathology, University of Cambridge, Cambridge, United Kingdom

  • John Trowsdale,

    Affiliation Department of Pathology, University of Cambridge, Cambridge, United Kingdom

  • Sarah C. R. Lummis ,

    Contributed equally to this work with: Sarah C. R. Lummis, David K. Menon, John S. Beech

    Affiliations Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom, Neurobiology Division, MRC Laboratory of Molecular Biology, Cambridge, United Kingdom

  • David K. Menon ,

    Contributed equally to this work with: Sarah C. R. Lummis, David K. Menon, John S. Beech

    Affiliation Division of Anaesthesia, University of Cambridge, Addenbrooke's Hospital, Cambridge, United Kingdom

  •  [ ... ],
  • John S. Beech

    Contributed equally to this work with: Sarah C. R. Lummis, David K. Menon, John S. Beech

    Affiliation Division of Anaesthesia, University of Cambridge, Addenbrooke's Hospital, Cambridge, United Kingdom

  • [ view all ]
  • [ view less ]

Anaesthetic Impairment of Immune Function Is Mediated via GABAA Receptors

  • Daniel W. Wheeler, 
  • Andrew J. Thompson, 
  • Federico Corletto, 
  • Jill Reckless, 
  • Justin C. T. Loke, 
  • Nicolas Lapaque, 
  • Andrew J. Grant, 
  • Pietro Mastroeni, 
  • David J. Grainger, 
  • Claire L. Padgett



GABAA receptors are members of the Cys-loop family of neurotransmitter receptors, proteins which are responsible for fast synaptic transmission, and are the site of action of wide range of drugs [1]. Recent work has shown that Cys-loop receptors are present on immune cells, but their physiological roles and the effects of drugs that modify their function in the innate immune system are currently unclear [2]. We are interested in how and why anaesthetics increase infections in intensive care patients; a serious problem as more than 50% of patients with severe sepsis will die [3][6]. As many anaesthetics act via GABAA receptors [7], the aim of this study was to determine if these receptors are present on immune cells, and could play a role in immunocompromising patients.

Principal Findings

We demonstrate, using RT-PCR, that monocytes express GABAA receptors constructed of α1, α4, β2, γ1 and/or δ subunits. Whole cell patch clamp electrophysiological studies show that GABA can activate these receptors, resulting in the opening of a chloride-selective channel; activation is inhibited by the GABAA receptor antagonists bicuculline and picrotoxin, but not enhanced by the positive modulator diazepam. The anaesthetic drugs propofol and thiopental, which can act via GABAA receptors, impaired monocyte function in classic immunological chemotaxis and phagocytosis assays, an effect reversed by bicuculline and picrotoxin.


Our results show that functional GABAA receptors are present on monocytes with properties similar to CNS GABAA receptors. The functional data provide a possible explanation as to why chronic propofol and thiopental administration can increase the risk of infection in critically ill patients: their action on GABAA receptors inhibits normal monocyte behaviour. The data also suggest a potential solution: monocyte GABAA receptors are insensitive to diazepam, thus the use of benzodiazepines as an alternative anesthetising agent may be advantageous where infection is a life threatening problem.


The anaesthetic drug, propofol, is a first line agent for sedation of critically ill patients on intensive care, facilitating potentially life-saving invasive treatments such as mechanical ventilation [1]. Its use, however, can have serious side effects, such as an increase in the incidence of secondary pneumonia from 35% to 53% [2]. Thiopental is another intravenous anaesthetic used in intensive care patients, usually for the management of patients with refractory status epilepticus or intracranial hypertension [1], but again can impair immune function, for example by suppressing bone marrow haematopoiesis [3]. The extent to which these drugs immunocompromise patients, and the contribution of this immunological impairment to the development of septicaemia on the intensive care unit has not been studied. However, a large proportion of critically ill patients have a primary diagnosis of septicaemia or severe sepsis as a result of respiratory or abdominal infections [8], and are prone to secondary infections; risk factors for these include blood transfusion [9], positive pressure respiratory support [10] and intravenous nutrition [11]. The seriousness of such infection in critically ill patients is not in doubt: more than 50% of patients with severe sepsis will die, usually from multiple organ failure [4]. It is known that a wide variety of anaesthetic and analgesic drugs negatively modulate the migration and actions of various cells in the innate immune system [5][7], but as these drugs act at a broad range of receptors, their cytotoxic excipients have generally been considered to be responsible [12][14]. Recent work has shown that Cys-loop receptors are present on immune cells, and are a potential site of drug action [15][17]. Here we consider whether propofol and thiopental act via GABAA receptors on monocytes. These receptors are the target of a range of anaesthetics [18] and are known to modulate T-lymphocytes in mouse models of autoimmune diseases such as type 1 diabetes mellitus and experimental autoimmune encephalomyelitis [19][21]. Monocytes and macrophages produce and secrete GABA [21], [22], so the tonic paracrine inhibition of function seen in embryonic neurons and cerebellar granule cells may play a role in the regulation of innate immune function and inflammation. In this report we show that GABAA receptors are expressed by monocytes, and that action at these proteins can explain the effects of both propofol and thiopental. The studies were performed using freshly-prepared human monocytes whenever possible, but where they were unsuitable we used the human myleomonocytic cell line (THP-1), which are routinely used as a model of human monocyte function e.g.[23].


RT-PCR of RNA extracted from a human myleomonocytic cell line (THP-1 cells) and freshly prepared human monocytes showed that GABAA receptor subunits are expressed in these cells. In THP-1 cells, amplimers of the correct sizes and sequences were obtained for α4, β2, γ1 and δ GABAA receptor subunits (figure 1a). In fresh monocytes, only β2 subunits could be isolated (table 1). Expression of the β2 subunit protein was confirmed by immunoblotting and immunohistochemistry (figure 1b). These receptors are functional: whole cell patch clamp of THP-1 cells showed that both GABA and the GABAA-specific agonist muscimol elicited currents that were blocked by the GABAA antagonists picrotoxin and bicuculline at 1 mM and 100 µM respectively (figure 2a). The channels predominantly conducted chloride: in whole cell patch clamp experiments the reversal potential of the GABA-induced responses was 15.1±0.7 mV (all data  =  mean ± SEM, n≥5), close to the theoretical value of 16.1 mV for a chloride channel, and under bi-ionic conditions was predominantly chloride permeable (figures 2b and 2c). Due to the small amplitudes of the whole-cell responses and the fragility of the cells, it was not possible to obtain reliable concentration-response curves. However, the use of a membrane potential-sensitive dye revealed concentration-dependent decreases in fluorescence to the GABA-selective agonist muscimol (EC50  = 2.5 µM, pEC50  = 5.61±0.22, figures 2d and e), which were inhibited by the GABAA receptor antagonists bicuculline and picrotoxin with IC50s of 135 µM (pIC50  = 3.87±0.29) and 29.6 µM (pIC50  = 4.53±0.29) respectively. We also observed no potentiation of these effects in the presence of the benzodiazepine diazepam, and no responses to bicuculline and picrotoxin up to concentrations of 1 mM (data not shown). No specific radioligand binding could be observed with [3H]-GABA, [3H]-muscimol or [3H]-flunitrazepam (data not shown), which was consistent with the low levels of protein expression and small currents recorded in THP-1 cells.

Figure 1. mRNA and protein expression of GABAA receptor subunits in monocytic cells.

a) Typical RT-PCR of total RNA isolated from monocyte (M) and THP-1 cell (T) lysates detecting GABAA receptor subunits. Amplimers corresponding to the expected sizes were detected for α4, γ1 and δ subunits of the GABAA receptor in THP-1 cells, and β2 subunits in monocytes. RNA isolated from whole human brain (B) was used as a positive control. b) GABAA receptor β2 subunit expression in non–permeabilised human monocytes. Image of a human monocyte stained with Hoescht 33342 (left hand panel) to show the nucleus, and with a GABAA receptor β2-specific polyclonal antiserum (centre) revealing cell surface β2 subunits. The right panel shows the merged image. Positive controls were human cerebral cortex and negative controls were neutrophils (data not shown). Scale bar  = 5 µm. Data are typical of at least 6 independent experiments. Inset  =  typical immunoblot of a monocyte sample (left hand side) and control (neutrophil, right hand side) probed with the β2-specific antiserum and showing expected MWt for a β2 subunit.

Figure 2. Functional responses of GABAA receptors in THP-1 cells.

a) Typical whole-cell patch-clamp traces of THP-1 cells clamped at +60 mV in the presence of GABA and muscimol; currents were blocked by the GABAA receptor antagonists bicuculline and picrotoxin. b) Application of muscimol (300 µM) to THP-1 cells revealed a reversal potential (Erev) of 15.1 mV, and c) chloride-selectivity (PNa/PCl) of 0.23 (n = 5). d) Typical Flexstation responses of THP-1 cells to different concentrations of muscimol. Buffer (continuous line) or muscimol (3, 10 and 100 µM, dashed lines) were added at 20 s. e) Dose curve response of THP-1 cells; EC50  = 2.5 µM, n = 6.

Table 1. GABAA receptor subunits detected using RT-PCR in human monocytes, THP-1 cells and human cerebral cortex (positive control); n = 4–12.

To examine monocyte migration we used a transwell in vitro migration assay (figure 3). Both THP-1 cells and fresh human monocytes migrated towards monocyte chemoattractant protein-1 (MCP-1) [24]. Propofol or thiopental inhibited this chemotaxis in a concentration-dependent fashion; maximum inhibition was 97.3±0.3% for propofol and 79.0±3.8% for thiopental, with IC50s of 119 µM (pIC50  = 3.93±0.08) and 274 µM (pIC50  = 3.56±0.09) respectively. To determine if this process was modulated via GABAA receptors, we performed the same experiment in the presence of picrotoxin and bicuculline. Both these compounds significantly restored migration (figure 3); thiopental (400 µM) reduced migration to 26.9±2.5%, while in the presence of bicuculline (100 µM) migration was restored to 87.0±6.3%. Similarly 1 mM picrotoxin increased chemotaxis from 6.8±2.1% to 44.4±6.2% in the presence of 150 µM propofol.

Figure 3. Inhibition of monocyte migration by anaesthetics is reversed by GABAA antagonists.

a) Schematic representation of the in vitro transwell chemotaxis apparatus used to assay human primary monocyte migration; b and c) Concentration-dependent inhibition of chemotaxis was observed in the presence of propofol (PPF) and sodium thiopental (STP) (IC50s  = 119 µM and 274 µM, respectively, n = 6); d and e) In the presence of either propofol (PPF) or sodium thiopental (STP), chemotaxis was significantly restored by the addition of the GABAA antagonists picrotoxin (PTX) and bicuculline (BIC); (** sig diff. Mann-Whitney U test: p<0.01). Experiments were also performed with THP-1 cells and no significant differences between the behaviour of freshly-prepared human monocytes and THP-1 cells were seen (data not shown).

The ability of thiopental to inhibit monocyte phagocytosis of fluorescently labelled beads was also explored to further examine monocyte function. These data (figure 4a) demonstrated that thiopental inhibits phagocytosis with an IC50 of 229 µM (pIC50  = 2.64±0.52). This inhibition was partially prevented by application of picrotoxin and bicuculline (figures 4b and 4c).

Figure 4. Inhibition of monocyte phagocytosis by anaesthetics is reversed by GABAA antagonists.

a) Concentration dependent inhibition of phagocytosis by thiopental in primary human monocytes; b) In the presence of either propofol (PPF) or sodium thiopental (STP), phagocytosis was significantly restored by the addition of the GABAA receptor antagonists picrotoxin (PTX) and bicuculline (BIC) (* sig diff. Mann-Whitney U test: p<0.05).


The data we present here show that functional GABAA receptors, constructed of a combination of α1, α4, β2, γ1 and/or δ subunits, are present on monocytes. Whole cell patch clamp studies show that these receptors have properties broadly similar to CNS GABAA receptors, and the anaesthetic drugs propofol and thiopental, which can also activate GABAA receptors, impaired monocyte function in classic immunological chemotaxis and phagocytosis assays. The data therefore could provide an explanation as to why chronic propofol and thiopental administration can increase the risk of infection in critically ill patients.

The benzodiazepine diazepam did not affect function or modulate the effects of propofol or thiopental. Benzodiazepines have long been known to modulate GABAA receptor responses [25], although more recently it was shown that this capacity critically depends on the subunit composition of the GABAA receptors [26]. GABAA receptors are heteromeric pentamers that most commonly contain 2α, 2β and a γ subunit, although as there are 19 GABAA receptor subunits, a large number of receptor stoichiometries are possible. We detected α4, β2, γ1 and δ subunits in THP-1 cells and β2 subunits in fresh monocytes. Detecting RNA in the latter is problematic, due to high levels of RNAases and difficulties in obtaining large numbers of pure monocytes, and other subunits, such as α1, may be present. RNA for this subunit has been previously reported in monocytes which, despite lack of evidence of any other subunits, also responded to GABAA receptor agonists [27]. This suggests that a likely constitution of the GABAA receptors in monocytes is α4α1β2β2γ1 and/or α4α1β2β2δ, combinations typical of tonic GABAA receptors responsible for slower signalling in the central nervous system [28]. GABAA receptors containing α4 or δ subunits, and those lacking a γ2 subunit, would be expected to be insensitive to diazepam [29]. The detection of β2 subunits is significant, as this subunit contains a propofol-sensitive binding site, and - intriguingly - these subunits can assemble into functional receptors that respond to thiopental in vitro [30], [31]. Thus our RNA data are consistent with the presence of GABAA receptors in monocytes that are not modulated by benzodiazepines.

This first demonstration that propofol and thiopental modulate monocyte function through actions at diazepam-insensitive GABAA receptors has important clinical implications. If a patient's primary pathology is inflammatory, the immunomodulatory effects of propofol or thiopental could be therapeutic, but if it is infective they may increase the risk of sepsis. Recently the use of benzodiazepines as sedatives has been largely supplanted by propofol, but our data suggest that propofol might compromise immune cell function, while benzodiazepines would not. This raises the possibility that sedation strategies in critically ill patients could be tailored to their diagnosis, with a more traditional benzodiazepine-based approach for patients with, or at risk of, severe sepsis.

An essential question is whether our findings are relevant in terms of the concentrations of thiopental and propofol used in clinical practice. Here the concentrations at which thiopental and propofol cause a 50% reduction in monocyte chemotaxis in vitro are 270 µM and 120 µM respectively. High dose thiopental infusions result in a serum concentration of ∼73 mg.l−1, which is ∼300 µM [32], and the concentration of propofol required to prevent 50% of patients responding to a surgical stimulus equates to 38 µM [33]. There is a potential problem in that these compounds can bind to serum proteins, but this may not have large effects at low concentrations [34] and we included serum (bovine serum albumin) in our chemotaxis experiments to mimic this effect. It should also be considered that whilst half maximal effective and inhibitory (EC50 and IC50) concentrations are the conventional means of reporting experimental data, far more subtle reductions in function could have clinically relevant consequences. Thus we propose that thiopental and propofol are used in clinical practice at concentrations that have the potential to significantly diminish monocyte function in vivo.

An immunocompromising effect of two such widely used anaesthetics has significant consequences. Not least our data make a strong case for investigating alternative sedation strategies for patients depending on their primary pathology, and also add weight to the case for developing more precise methods for quantifying the adequacy of sedation. Clinicians titrate the doses of sedative drugs against rather blunt endpoints, tending to err on the side of caution (i.e. higher concentrations) to ensure that patients are comfortable and not distressed. Recent papers have focused on the need to minimise sedation levels in anaesthesia and critical care to reduce complications and time spent in an intensive care unit [35], [36]. While most attention has focused on the sedative effects of drugs in this situation, our data suggest that the increased potential to compromise immune function may play a part. Lower plasma concentrations or novel combinations of sedatives could significantly improve prognoses. The same applies during surgery: administering a larger anaesthetic dose than is necessary could have implications for wound healing and acquisition of postoperative infections.

Our findings also raise the intriguing possibility of administering GABAA antagonists to influence immune function. Picrotoxin and securinine have been shown to positively modulate macrophage activity and enhance the clearance of bacteria [37], [38]. A highly charged non-toxic GABAA antagonist that does not cross the blood brain barrier could be a means of diminishing the unwanted peripheral effects of the agonist drugs, or might even act as a novel non-sedating anti-inflammatory drug.

In conclusion we have demonstrated the clinical importance of GABAA receptors on monocytes, and suggest that using anaesthetic or sedative drugs that act via different receptors could avoid immune impairment. At this stage it is not possible to quantify the extent to which GABAA agonists contribute to the acquisition of infection on the intensive care unit considering the complex interplay of many pathophysiological processes in critical illness and multi-organ dysfunction. Our data suggest that the drugs used to sedate patients might be part of the problem, but also indicate possible solutions. The hypothesis that improved or different sedation strategies could reduce fatalities from septicaemia in the critically ill requires further testing, but the outcome potentially has very great clinical implications.

Materials and Methods


All reagents were source from Sigma Aldrich (Poole, UK) unless otherwise stated.

Cell preparation

Peripheral blood mononuclear cells were used as the source of primary human monocytes. These had been isolated by centrifugation of Buffy coat (Blood Transfusion Service, Cambridge, UK) in Percoll gradients [39]. Monocytes were negatively isolated using immunomagnetic beads coated with monoclonal antibodies against human CD2, CD7, CD16, CD19, CD56 and CD3 as previously described (Monocyte negative isolation kit; Invitrogen, Paisley, UK) [40]. THP-1 cells (European Collection of Cell Cultures, Salisbury, Wiltshire, UK) were maintained at a density of between 4×105 and 1×106 cells/ml in RPMI 1640 supplemented with penicillin, streptomycin, 10% fetal calf serum and 20 µM 2-mercaptoethanol.


Total RNA was extracted using an RNAqueous-4PCR kit (Ambion, Huntingdon, UK). RT-PCR reactions were prepared using 0.2 µg of total RNA and 20 pmol oligonucleotide primers using a SuperScript One-Step RT-PCR with Platinum Taq kit (Invitrogen). Total RNA extracted from human brain was used for positive controls; reactions lacking RT were also included. The expression of the ‘housekeeping gene’ glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was also examined. The primer sequences used to identify GABAA subunit mRNA have been published previously [41], those for GAPDH were: ACCACAGTCCATGCCATCAC (sense) and TCCACCACCCTGTTGCTGTA (antisense). PCR conditions were: 2 min at 94°C x1; 94°C for 15 s, 55°C for 30 s and 68°C for 1 min×40; 5 min at 68°C x1. Amplimers were resolved on a 1% agarose gel, extracted and sequenced (Applied Biosystems 3130×l, Applied Biosystems, Warrington, UK). Results were compared with known mRNA sequences on the Entrez PubMed nucleotides database ( using ClustalW (

Immunohistochemistry and immunoblotting

Cells were fixed with 4% paraformaldehyde in phosphate buffered saline (PBS), washed in Tris buffered saline (TBS), blocked with 3% BSA in TBS containing 0.2% Tween 20 (TTBS) and incubated overnight in a humidified chamber at 4°C with 1∶1000 β2 subunit antisera (Abcam, Cambridge, UK). After 2 washes in TTBS, the samples were incubated with FITC-conjugated secondary antibody at room temperature for 3 h. Following washing, the samples were dried and mounted in Vectashield containing 4′,6-diamidino-2-phenylindole (Vector, London, UK), and examined using confocal microscopy. Immunoblotting was performed using standard techniques with an overnight incubation using a 1∶1000 dilution of the β2 subunit antisera, followed by a 1 h incubation with an HRP-conjugated secondary antibody. Bands were detected using enhanced luminol chemiluminescent reagent (Perkin Elmer, Beaconsfield, UK).

Whole cell patch clamp

THP-1 cells were grown on fibronectin-coated sterile cover slips. Cells were clamped at +60 mV in whole-cell configuration. Extracellular saline consisted of (mM) 140 NaCl, 5.4 KCl, 1 MgCl2, 1.0 CaCl2, 10.0 HEPES (pH 7.2). Pipettes were filled with (mM) 140 CsCl, 1.0 MgCl2, 1.0 CaCl2, 10.0 EGTA, 10.0 HEPES (pH 7.2). Currents were filtered at a frequency of 1 kHz (−3 dB) with a 4-pole low-pass Bessel filter and acquired at a sampling frequency of 110 Hz. Current-voltage relationships were studied using a voltage-ramp protocol from −80 mV to +40 mV over 1 s. Series resistance was usually less than 5.0 MΩ and voltage errors never exceeded 5 mV.

FlexStation analysis of potentiometric dyes

THP-1 cells were washed in flex buffer (in mM 115.0 NaCl, 1.0 KCl, 1.0 CaCl2, 1.0 MgCl2, 1.0 glucose, 10.0 HEPES pH 7.4) and 1×105 cells added to each well of a 96 well plate. This was centrifuged at 1000 rpm for 2 min to embed an even layer of cells, and then incubated at room temperature for 45 min in 100 µl buffer containing membrane potential dye (Blue Kit, Molecular Devices, Wokingham, UK) before being assayed in the FlexStation (Molecular Devices). Fluorescence was measured every 2 s for 300 s. At 20 s, 50 µl of muscimol was added to each well. Data was analysed using Prism (GraphPad, San Diego, USA).

Transwell filter migration assay

MCP-1 (Peprotech, London, UK) was diluted in Gey's Balanced Salt Solution (GBSS) with 1% BSA to a final concentration of 12.5−1; 29.2 µl was added to each well of 96 well disposable chemotaxis chamber (Neuroprobe, Gaithersburg, USA) and an 8 µm polycarbonate filter membrane fitted. 1×105 monocytes in 25 µl GBSS/BSA were then placed on the top of each well. The assembled chamber was incubated at 37°C in a humidified atmosphere of air and 5% CO2 for 90 min. Compounds under investigation were added in equal concentrations to both the top and bottom compartments of the migration chamber. After incubation, the cells were gently removed from the top of the filter with a pipette, 20 µl of ice-cold 20 mM EDTA in PBS was added to the top of each well and incubated at 4°C for 15 min. Cells that had migrated into the lower compartment of the chamber were incubated at 37°C for 60 min with 3 ml of the vital dye 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT; 5 mg/ml in RPMI-1640). The liquid was then carefully aspirated from the wells leaving the stained cells, and the converted formazan blue dye was solubilised using 20 µl DMSO per well. Absorbance of the converted dye was measured at a wavelength of 595 nm using an ELISA plate reader (Molecular Devices). The number of cells migrated in each well was determined by interpolation of an 8-point standard curve using Softmax Pro (Molecular Devices).

Monocyte Phagocytosis Assay

THP-1 cells were differentiated in 200 nM phorbol 12-myristate 13-acetate (PMA) for 24 h. Fluorescent (FITC) labelled microspheres (Molecular Probes) were coated with 1% BSA (2.25×109−1) and added to the cells in 500 µl HEPES-buffered saline (mM: 140.0 NaCl, 5.0 KCl, 2.0 CaCl2, 1.0 MgCl2, 10.0 HEPES, pH 7.4) with the compounds under investigation and incubated for 1 h. The positive control conditions were PMA alone; the negative control was unstimulated THP-1 cells. The cells were then washed with ice-cold PBS solution, fixed with 0.5% glutaraldehyde and analysed by flow cytometry using FlowJo software (version 7.5.5, Tree Star Inc., OR, USA). A phagocytosis index was calculated from the average number of beads taken up per cell.

Author Contributions

Conceived and designed the experiments: DW JT SL DM JB. Performed the experiments: DW AT FC JR JL NL AG PM DG CP JOB NM JT SL. Analyzed the data: DW AT FC JR JL NL AG PM DG CP NM JT SL. Wrote the paper: DW SL.


  1. 1. Fraser GL, Riker RR (2007) Sedation and analgesia in the critically ill adult. Curr Opin Anaesthesiol 20: 119–123.
  2. 2. Nadal P, Nicolas JM, Font C, Vilella A, Nogue S (1995) Pneumonia in ventilated head trauma patients: the role of thiopental therapy. Eur J Emerg Med 2: 14–16.
  3. 3. Stover JF, Stocker R (1998) Barbiturate coma may promote reversible bone marrow suppression in patients with severe isolated traumatic brain injury. Eur J Clin Pharmacol 54: 529–534.
  4. 4. Brun-Buisson C, Doyon F, Carlet J, Dellamonica P, Gouin F, et al. (1995) Incidence, risk factors, and outcome of severe sepsis and septic shock in adults. A multicenter prospective study in intensive care units. French ICU Group for Severe Sepsis. JAMA 274: 968–974.
  5. 5. Hofbauer R, Frass M, Salfinger H, Moser D, Hornykewycz S, et al. (1999) Propofol reduces the migration of human leukocytes through endothelial cell monolayers. Crit Care Med 27: 1843–1847.
  6. 6. Krumholz W, Endrass J, Hempelmann G (1995) Inhibition of phagocytosis and killing of bacteria by anaesthetic agents in vitro. Br J Anaesth 75: 66–70.
  7. 7. Krumholz W, Reussner D, Hempelmann G (1999) The influence of several intravenous anaesthetics on the chemotaxis of human monocytes in vitro. Eur J Anaesthesiol 16: 547–549.
  8. 8. Volakli E, Spies C, Michalopoulos A, Groeneveld AB, Sakr Y, et al. Infections of respiratory or abdominal origin in ICU patients: what are the differences? Crit Care 14: R32.
  9. 9. Marik PE, Corwin HL (2008) Efficacy of red blood cell transfusion in the critically ill: a systematic review of the literature. Crit Care Med 36: 2667–2674.
  10. 10. Safdar N, Dezfulian C, Collard HR, Saint S (2005) Clinical and economic consequences of ventilator-associated pneumonia: a systematic review. Crit Care Med 33: 2184–2193.
  11. 11. Gramlich L, Kichian K, Pinilla J, Rodych NJ, Dhaliwal R, et al. (2004) Does enteral nutrition compared to parenteral nutrition result in better outcomes in critically ill adult patients? A systematic review of the literature. Nutrition 20: 843–848.
  12. 12. Goldfarb G, Belghiti J, Gautero H, Boivin P (1984) In vitro effect of benzodiazepines on polymorphonuclear leukocyte oxidative activity. Anesthesiology 60: 57–60.
  13. 13. Morisaki H, Tanaka T, Ishimura Y, Takeda J, Sekiguchi H, et al. (1991) In vitro effect of additives in benzodiazepine solutions on the superoxide anion-generating system in polymorphonuclear leucocytes. Br J Anaesth 66: 97–102.
  14. 14. Weiss M, Mirow N, Birkhahn A, Schneider M, Wernet P (1993) Benzodiazepines and their solvents influence neutrophil granulocyte function. Br J Anaesth 70: 317–321.
  15. 15. den Eynden JV, Ali SS, Horwood N, Carmans S, Brone B, et al. (2009) Glycine and glycine receptor signalling in non-neuronal cells. Front Mol Neurosci 2: 9.
  16. 16. Shiratsuchi H, Kouatli Y, Yu GX, Marsh HM, Basson MD (2009) Propofol inhibits pressure-stimulated macrophage phagocytosis via the GABAA receptor and dysregulation of p130cas phosphorylation. Am J Physiol Cell Physiol 296: C1400–1410.
  17. 17. Tian J, Chau C, Hales TG, Kaufman DL (1999) GABAA receptors mediate inhibition of T cell responses. J Neuroimmunol 96: 21–28.
  18. 18. Krasowski MD, Harrison NL (1999) General anaesthetic actions on ligand-gated ion channels. Cell Mol Life Sci 55: 1278–1303.
  19. 19. Tian J, Lu Y, Zhang H, Chau CH, Dang HN, et al. (2004) Gamma-aminobutyric acid inhibits T cell autoimmunity and the development of inflammatory responses in a mouse type 1 diabetes model. J Immunol 173: 5298–5304.
  20. 20. Vansant G, Trauger RJ, Cameron A, Vendemelio M, Kreitschitz S, et al. (2007) Propofol hemisuccinate suppression of experimental autoimmune encephalomyelitis. Autoimmunity 40: 180–186.
  21. 21. Bhat R, Axtell R, Mitra A, Miranda M, Lock C, et al. (2010) Inhibitory role for GABA in autoimmune inflammation. Proc Natl Acad Sci USA 107: 2580–2585.
  22. 22. Stuckey DJ, Anthony DC, Lowe JP, Miller J, Palm WM, et al. (2005) Detection of the inhibitory neurotransmitter GABA in macrophages by magnetic resonance spectroscopy. J Leukoc Biol 78: 393–400.
  23. 23. Ferrer NL, Gomez AB, Neyrolles O, Gicquel B, Martin C (2010) Interactions of attenuated Mycobacterium tuberculosis phoP mutant with human macrophages. PLoS One 5: e12978.
  24. 24. Frow EK, Reckless J, Grainger DJ (2004) Tools for anti-inflammatory drug design: in vitro models of leukocyte migration. Med Res Rev 24: 276–298.
  25. 25. Sigel E, Buhr A (1997) The benzodiazepine binding site of GABAA receptors. Trends Pharmacol Sci 18: 425–429.
  26. 26. Sieghart W, Sperk G (2002) Subunit composition, distribution and function of GABAA receptor subtypes. Curr Top Med Chem 2: 795–816.
  27. 27. Alam S, Laughton DL, Walding A, Wolstenholme AJ (2006) Human peripheral blood mononuclear cells express GABAA receptor subunits. Mol Immunol 43: 1432–1442.
  28. 28. Farrant M, Nusser Z (2005) Variations on an inhibitory theme: phasic and tonic activation of GABAA receptors. Nat Rev Neurosci 6: 215–229.
  29. 29. Brown N, Kerby J, Bonnert TP, Whiting PJ, Wafford KA (2002) Pharmacological characterization of a novel cell line expressing human α4β3δ GABAA receptors. Br J Pharmacol 136: 965–974.
  30. 30. Bali M, Akabas MH (2004) Defining the propofol binding site location on the GABAA receptor. Mol Pharmacol 65(1): 68–76.
  31. 31. Cestari IN, Uchida I, Li L, Burt D, Yang J (1996) The agonistic action of pentobarbital on GABAA β-subunit homomeric receptors. Neuroreport 7: 943–947.
  32. 32. Cordato DJ, Herkes GK, Mather LE, Gross AS, Finfer S, et al. (2001) Prolonged thiopentone infusion for neurosurgical emergencies: usefulness of therapeutic drug monitoring. Anaesth Intensive Care 29: 339–348.
  33. 33. Stuart PC, Stott SM, Millar A, Kenny GN, Russell D (2000) Cp50 of propofol with and without nitrous oxide 67%. Br J Anaesth 84: 638–639.
  34. 34. Dawidowicz AL, Kalitynski R, Kobielski M, Pieniadz J (2006) Influence of propofol concentration in human plasma on free fraction of the drug. Chem Biol Interact 159: 149–155.
  35. 35. Strom T, Martinussen T, Toft P (2010) A protocol of no sedation for critically ill patients receiving mechanical ventilation: a randomised trial. Lancet 375: 475–480.
  36. 36. Kress JP, Pohlman AS, O'Connor MF, Hall JB (2000) Daily interruption of sedative infusions in critically ill patients undergoing mechanical ventilation. N Engl J Med 342: 1471–1477.
  37. 37. Stankevicius D, Rodrigues-Costa EC, Camilo Florio J, Palermo-Neto J (2008) Neuroendocrine, behavioral and macrophage activity changes induced by picrotoxin effects in mice. Neuropharmacology 54: 300–308.
  38. 38. Lubick K, Radke M, Jutila M (2007) Securinine, a GABAA receptor antagonist, enhances macrophage clearance of phase II C. burnetii: comparison with TLR agonists. J Leukoc Biol 82: 1062–1069.
  39. 39. Haslett C, Guthrie LA, Kopaniak MM, Johnston RB Jr, Henson PM (1985) Modulation of multiple neutrophil functions by preparative methods or trace concentrations of bacterial lipopolysaccharide. Am J Pathol 119: 101–110.
  40. 40. Hsieh AH, Bishop MJ, Kubilis PS, Newell DW, Pierson DJ (1992) Pneumonia following closed head injury. Am Rev Respir Dis 146: 290–294.
  41. 41. Maddox FN, Valeyev AY, Poth K, Holohean AM, Wood PM, et al. (2004) GABAA receptor subunit mRNA expression in cultured embryonic and adult human dorsal root ganglion neurons. Brain Res Dev Brain Res 149: 143–151.