Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

The Receptor Tyrosine Kinase FGFR4 Negatively Regulates NF-kappaB Signaling

  • Kristine A. Drafahl,

    Affiliation Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, California, United States of America

  • Christopher W. McAndrew,

    Affiliation Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, California, United States of America

  • April N. Meyer,

    Affiliation Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, California, United States of America

  • Martin Haas,

    Affiliation Moores Cancer Center, University of California San Diego, La Jolla, California, United States of America

  • Daniel J. Donoghue

    ddonoghue@ucsd.edu

    Affiliations Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, California, United States of America, Moores Cancer Center, University of California San Diego, La Jolla, California, United States of America

The Receptor Tyrosine Kinase FGFR4 Negatively Regulates NF-kappaB Signaling

  • Kristine A. Drafahl, 
  • Christopher W. McAndrew, 
  • April N. Meyer, 
  • Martin Haas, 
  • Daniel J. Donoghue
PLOS
x

Abstract

Background

NFκB signaling is of paramount importance in the regulation of apoptosis, proliferation, and inflammatory responses during human development and homeostasis, as well as in many human cancers. Receptor Tyrosine Kinases (RTKs), including the Fibroblast Growth Factor Receptors (FGFRs) are also important in development and disease. However, a direct relationship between growth factor signaling pathways and NFκB activation has not been previously described, although FGFs have been known to antagonize TNFα-induced apoptosis.

Methodology/Principal Findings

Here, we demonstrate an interaction between FGFR4 and IKKβ (Inhibitor of NFκB Kinase β subunit), an essential component in the NFκB pathway. This novel interaction was identified utilizing a yeast two-hybrid screen [1] and confirmed by coimmunoprecipitation and mass spectrometry analysis. We demonstrate tyrosine phosphorylation of IKKβ in the presence of activated FGFR4, but not kinase-dead FGFR4. Following stimulation by TNFα (Tumor Necrosis Factor α) to activate NFκB pathways, FGFR4 activation results in significant inhibition of NFκB signaling as measured by decreased nuclear NFκB localization, by reduced NFκB transcriptional activation in electophoretic mobility shift assays, and by inhibition of IKKβ kinase activity towards the substrate GST-IκBα in in vitro assays. FGF19 stimulation of endogenous FGFR4 in TNFα-treated DU145 prostate cancer cells also leads to a decrease in IKKβ activity, concomitant reduction in NFκB nuclear localization, and reduced apoptosis. Microarray analysis demonstrates that FGF19 + TNFα treatment of DU145 cells, in comparison with TNFα alone, favors proliferative genes while downregulating genes involved in apoptotic responses and NFκB signaling.

Conclusions/Significance

These results identify a compelling link between FGFR4 signaling and the NFκB pathway, and reveal that FGFR4 activation leads to a negative effect on NFκB signaling including an inhibitory effect on proapoptotic signaling. We anticipate that this interaction between an RTK and a component of NFκB signaling will not be limited to FGFR4 alone.

Introduction

NFκB is a transcription factor of pivotal importance as a regulator of genes that control cell differentiation, survival, and inflammatory responses in mammalian cells. Thus, NFκB has been the subject of intense research to identify clinically useful inhibitors, and to understand the intersection of NFκB signaling with signaling pathways that are important in cancer cell biology. Upon activation with TNFα, IKKβ phosphorylates IκB, the inhibitor of NFκB, which targets it for proteasomal degradation. Subsequently, NFκB is released from sequestration in the cytoplasm, permitting translocation of NFκB dimers into the nucleus where they activate the transcription of target genes [2], [3], [4], [5], [6], [7].

Members of the FGFR family of receptor tyrosine kinases are of tremendous significance in many aspects of normal development and, additionally, have been implicated in a variety of human cancers, such as FGFR4 with regards to prostate cancer [8], [9], [10]. Signaling by FGF2 has been shown to be important for inhibition of apoptosis through PI3K/AKT and IKKβ [11], [12], and FGF signaling has also been shown to decrease TNFα-induced apoptosis through activation of the p44/42 MAPK pathway [13]. Regulatory interactions between FGFR4 and NFκB signaling pathways have not previously been reported, although both pathways represent major axes of cell signaling. In this work, we describe the discovery of a two-hybrid interaction between the receptor tyrosine kinase FGFR4 and IKKβ, an important regulatory protein in the NFκB signaling pathway, and confirm this interaction in mammalian cells. We also present evidence demonstrating a negative regulatory effect upon NFκB signaling as a consequence of FGFR4 activation.

Results

Interaction of FGFR4 and IKKβ proteins

Using the intracellular domain of FGFR4 as bait, we conducted a yeast two-hybrid assay [1] and identified IKKβ as an interacting protein. The bait in this assay, fused to LexA, consisted of amino acids 373–803 of FGFR4, which includes the entirety of the intracellular domain. This was screened against a mouse embryonic cDNA library encoding fusion proteins with the VP16 transactivation domain. This novel interaction was initially detected with a β-galactosidase filter lift assay (Figure 1A, left panel), and confirmed by growth on selective media (Figure 1A, right panel). The VP16-IKKβ clone that interacted with the LexA-FGFR4 bait consisted of amino acids 607–757 of murine IKKβ (NCBI Gene: BC037723.1, NCBI Protein: NP_001153246.1), which exhibits complete identity with human IKKβ (NCBI Protein: NP_001547.1) in this region. This region includes the NEMO binding domain, residues 705–742 [14], and almost the entirety of the helix-loop-helix domain, residues 559–756, of human IKKβ [15].

thumbnail
Figure 1. IKKβ interacts with FGFR4.

A. Confirmation of yeast two-hybrid assay with the intracellular domain of FGFR4 bait protein and IKKβ clone isolated by β-gal filter lift assay (left panel) and growth on selective media (right panel). B. Full-length IKKβ and full-length FGFR4 derivatives were transfected in HEK293 cells to examine in vivo association. Cells were lysed in 1% NP-40 lysis buffer and immunoprecipitated with IKKβ (H-4) antibody. Immunoblot analysis was performed with FGFR4 (C-16) antibody (top panel). The membrane was stripped and reprobed with anti-IKKβ (middle panel). The expression of the FGFR4 derivatives in the whole cell lysate is shown in lower panel. C. Cells were transfected and lysed as in (B) then immunoprecipitated with FGFR4 (C-16) antibody. Immunoblot analysis was performed with IKKβ (H-4) antibody (top panel). The membrane was stripped and reprobed with anti-FGFR4 (second panel). The expression of IKKβ and FGFR4 in the whole cell lysate is shown in the two lower panels.

https://doi.org/10.1371/journal.pone.0014412.g001

To confirm the interaction of FGFR4 and IKKβ by coimmunoprecipitation using full-length proteins, human IKKβ was co-expressed with FGFR4 in HEK293 cells. IKKβ interacted with wild-type FGFR4 (FGFR4-WT), as well as with a constitutively-activated mutant of the receptor (FGFR4-K645E) (Figure 1B). Interestingly, IKKβ also interacted with a kinase-dead FGFR4 (FGFR4-KD), indicating that a functional FGFR4 kinase domain is not essential for the interaction of these two proteins. These interactions were further confirmed in the opposite direction. As before, IKKβ was detected in FGFR4 immunoprecipitates, whether kinase-active or kinase-dead (Figure 1C).

We also utilized mass spectrometry to characterize proteins recovered in IKKβ immunoprecipitates. Following expression of both the activated FGFR4-K645E and IKKβ in HEK293 cells, IKKβ immunoprecipitates were analyzed by immobilized metal affinity chromatography/nano-liquid chromatography/electrospray ionization mass spectrometry (IMAC/nano-LC/ESI-MS) [16], [17]. In two independent samples, in addition to approximately 30% coverage of IKKβ as indicated by tryptic peptides, FGFR4-derived peptides were unambiguously identified as presented in Table 1.

thumbnail
Table 1. Mass spec analysis identifies FGFR4 as binding partner of IKKβ.

https://doi.org/10.1371/journal.pone.0014412.t001

These results indicate a physical interaction between the intracellular domain of FGFR4, a receptor tyrosine kinase, and IKKβ, an important regulatory protein in NFκB signaling. The interaction described here of FGFR4 with IKKβ, or indeed with any protein involved in NFκB signaling, has not been previously reported.

Tyrosine phosphorylation of IKKβ with FGFR4 activation

The primary mode of IKKβ regulation is through phosphorylation of serine residues, which can be either activating as when Ser177 and Ser181 are phosphorylated, or inhibitory if phosphorylated on C-terminal residues [18], [19], [20], [21]. Tyrosine phosphorylation of IKKβ in response to growth factor receptor activation has not been previously reported. We investigated the possible tyrosine phosphorylation of IKKβ in HEK293 cells expressing FGFR4, and found that IKKβ was tyrosine phosphorylated (Figure 2). Expression of FGFR4 WT led to an increase in tyrosine phosphorylation of IKKβ, in contrast to the kinase-dead mutant of FGFR4, indicating a requirement for FGFR4 kinase activity in IKKβ tyrosine phosphorylation. Additionally, a strongly activated mutant of FGFR4 [22] led to a dramatic increase in tyrosine phosphorylation of IKKβ (Figure 2A). Importantly, all experiments were performed using a non-epitope-tagged IKKβ. In initial control experiments, we determined that the presence of the 3x-HA epitope tag (YPYDVPDYA) at the N-terminus of IKKβ resulted in a significant increase in the extent of tyrosine phosphorylation in response to FGFR4 activation (data not shown), presumably due to phosphorylation at some of the 9 Tyr residues contained within the 3x-HA-tag.

thumbnail
Figure 2. FGFR4 results in tyrosine phosphorylation of IKKβ.

A. HEK293 cells were tranfected with IKKβ and FGFR4 derivatives. Cells were lysed in RIPA and immunoprecipitated with IKKβ (H-4) antibody. Immunoblot analysis was performed with the phosphotyrosine-specific antibody 4G10 (top panel). The membrane was stripped and reprobed with IKKβ (H-4) antibody (second panel). The expression of the FGFR4 derivatives in the lysate is shown (lower panel). B. HEK293 cells were tranfected with IKKβ and FGFR4 derivatives that lack their extracellular domain and are targeted to the membrane with a myristylation signal (myr-FGFR4). Cells were lysed in 1% NP-40 lysis buffer and immunoprecipitated with IKKβ (H-4) antibody. After the proteins were transferred, the membrane was cut in half and the upper part was immunoblotted with the phosphotyrosine-specific antibody 4G10 (top panel). It was stripped and reprobed with IKKβ (H-4) antibody (second panel). The lower half of the membrane was immunoblotted with FGFR4 (C-16) antibody (third panel). The lysates were examined for the expression of IKKβ and myr-FGFR4 derivatives (bottom panels).

https://doi.org/10.1371/journal.pone.0014412.g002

By SDS PAGE, IKKβ migrates at ∼87 kDa while the lower, unmodified band of FGFR4 almost comigrates at ∼85 kDa. To ensure that the tyrosine phosphorylation observed was on IKKβ and not autophosphorylation of FGFR4 (Figure 2A), cells were lysed in RIPA buffer, and immunoprecipitations were washed over 10% sucrose to eliminate protein-protein interactions. In addition, we examined tyrosine phosphorylation of IKKβ when cotransfected with a truncated, myristylated FGFR4 containing only the intracellular domain of FGFR4 with a myristylation signal for membrane localization [22]. Using these shorter FGFR4 constructs allowed clear separation from IKKβ, and revealed that tyrosine phosphorylation of IKKβ was still present (Figure 2B). Furthermore, we examined the interaction of these proteins and demonstrated that the myr-FGFR4 proteins still interact with IKKβ in coimmunoprecipitation experiments (Figure 2B).

These experiments thus provide an explanation as to why tyrosine phosphorylation of IKKβ may not have been previously reported, due to the presence of a Tyr-containing epitope tag on the most commonly used IKKβ vectors [21], [23], allowing artifactual Tyr phosphorylation within the epitope tag. Expression of non-tagged IKKβ in the experiments of Fig. 2, however, reveals the presence of verifiable Tyr phosphorylation within IKKβ sequences, and which is observed only in the presence of activated FGFR4 but not kinase-dead FGFR4.

Activated and kinase-dead FGFR4 decrease TNFα-stimulated NFκB nuclear localization

Utilizing indirect immunofluoresence, we monitored changes in NFκB translocation to the nucleus in TNFα stimulated cells expressing FGFR4 proteins. In starved unstimulated cells, NFκB was observed to be predominantly cytoplasmic (Fig. 3A), presumably due to sequestration by IκB as described by others [24], [25], [26], [27]. In contrast, NFκB was observed to be predominatly nuclear following TNFα stimulation. Significantly, when cells expressing FGFR4 WT were stimulated with TNFα, we observed a 40% decrease in cells exhibiting NFκB nuclear localization compared to mock-transfected cells (Fig. 3B). Expression of a constitutively-activated mutant, FGFR4-K645E, led to a 65% decrease in cells exhibiting nuclear localization of NFκB. In contrast, the kinase-dead FGFR4-KD led to only a 30% decrease in NFκB nuclear localization. These results indicate that expression of FGFR4-WT, or of the activated mutant FGFR4-K645E, results in a significant decrease in the ability of TNFα to stimulate NFκB nuclear localization. Although more modest in its effects, even FGFR-KD was able to decrease the TNFα-stimulated nuclear localization of NFκB, possibly reflecting a dominant-negative effect involving recruitment of effector molecules to a kinase-dead complex.

thumbnail
Figure 3. FGFR4 expression relocalizes NFκB.

A. HeLa cells were seeded onto glass coverslips and transfected with FGFR4 derivatives. The cells were treated with TNFα for 30 min. Indirect immunofluorscence was performed. The localization of endogenous NFκB was dectected with NFκB p65 (F-6) antibody followed by FITC-conjugated anti-mouse antiserum. Cells expressing the FGFR4 derivatives were stained with anti-FGFR4 (C-16) and Rh-conjugated anti-rabbit secondary antibody. The nuclei were visualized with Hoechst dye. The endogenous localization of NFκB is shown in non-transfected cells −/+ TNFα treatment (top panels). The altered localization of NFκB in a cell expressing FGFR4 WT with TNFα treatment is shown in lower panels. B. Cells expressing FGFR4 derivatives were scored for the localization of NFκB. 100 cells were counted for each sample in three independent experiments. The error bars represent the standard deviation. *, P≤0.0001; **, P = 0.0061.

https://doi.org/10.1371/journal.pone.0014412.g003

FGFR4 activation decreases TNFα-stimulated IKK kinase activity assayed in vitro

To further examine the effects of FGFR4 expression on downstream NFκB signaling, changes in endogenous IKKβ activity were monitored in HEK293 cells expressing FGFR4 and/or treated with the FGFR4-specific ligand FGF19 [28]. FGFR4-WT, activated mutant FGFR4-K645E, and kinase-dead FGFR4-KD were expressed in HEK293 cells, followed by stimulation with TNFα. Immunoprecipitated IKK complexes from cell lysates were subjected to in vitro kinase assays utilizing GST-IκB(1–54) as the substrate [24], and GST-IκB(1–54) phosphorylation was visualized and quantified (Fig. 4A and B). Treatment with TNFα resulted in an almost 10-fold increase in the IKK complex activity, compared to unstimulated cells (Lane 2 versus Lane 1). Cells expressing FGFR4-WT exhibited a 30% reduction in IKK complex activity (Lane 3), which was further diminished by expression of the activated mutant FGFR4-K645E, resulting in a 45% reduction of IKK activity (Lane 4). When FGFR4-KD was examined in this assay, TNFα-stimulation of IKK complex activity was unimpaired (Lane 5). These results demonstrate that FGFR4 expression, particularly a constitutively-activated mutant, leads to significant reduction in TNFα-stimulated IKK kinase activity when assayed in vitro.

thumbnail
Figure 4. FGFR4 expression and/or FGF19 stimulation inhibits endogenous IKKβ activity.

A. HEK293 cells were transfected with empty vector or the indicated FGFR4 constructs, then starved for 16 h. Cells were then either stimulated with vehicle for 10 min or FGF19 for 10 min prior to the addition of TNFα for an additional 10 min. The IKK complex was then immunoprecipitated from cytoplasmic extracts and subjected to an in vitro kinase assay utilizing GST-IκB(1–54) as substrate. The top panel shows phosphorylation to produce 32P-GST-IκB(1–54) during the in vitro kinase reaction, as visualized by autoradiography. The second panel shows the substrate GST-IκB(1–54) present in each reaction, as determined by Coomassie staining. The lower panels show immunoblots of whole cell lysates from which immune complexes were prepared for the GST-IκB in vitro phosphorylation assays. These cell lysates were separated by SDS-PAGE, transferred to Immobilon-P, and probed with the indicated antibodies. B. Kinase reactions described in (A) were exposed to a Phosphorimager (Bio-Rad). Quantification of 32P incorporation into GST-IκB was performed using the Quantity One software (Bio-Rad). The average 32P incorporation from three independent experiments, normalized to mock-transfected cells stimulated with TNFα, is shown +/− std. dev. *, P≤0.0002; **, P = 0.004. C. DU145 cells were starved for 24 h prior to stimulation as described in (A). Kinase assays and immunoblots were performed as in (A). D. Quantification of 32P incorporation into GST-IκB(1–54) was performed as in (B). The average 32P incorporation from three independent experiments, normalized to mock-transfected cells stimulated with TNFα, is shown +/− std. dev. *, P<0.0001.

https://doi.org/10.1371/journal.pone.0014412.g004

Importantly, when mock-transfected cells were stimulated with FGF19 to activate endogenous FGFR4 signaling (Lane 6), a significant reduction (approximately 25%) was observed in IKK complex activity. This result demonstrates that activation of the endogenous FGFR4 pathway, in the absence of overexpressed or transfected FGFR4, is sufficient to negatively regulate NFκB signaling. This negative regulation was further enhanced when cells, stimulated with TNFα+FGF19, were expressing excess FGFR4-WT (Lane 7). The inhibitory effects of FGF19 were reversed, however, when cells stimulated with TNFα+FGF19 were expressing FGFR4-KD (Lane 8). Thus, in this assay, the kinase-dead receptor exhibited a dominant-negative effect.

Interaction of FGFR4 and NFκB pathways in DU145 prostate cancer cells

Since previous research has implicated FGFR4 in prostate cancer progression, we sought to examine the effect of FGFR4 activation on NFκB signaling in DU145 prostate cancer cells [9], [10], known to express high levels of endogenous FGFR4 [29]. When DU145 cells were stimulated with TNFα, and assayed for IKK complex activity, a significant increase was observed (Fig. 4C and D, Lane 2 versus Lane 1). When these cells were also stimulated with FGF19 in addition to TNFα, a significant decrease (approximately 65%) in IKK complex kinase activity was observed (Fig. 4C and D, Lane 3). These results demonstrate that FGF19-stimulated activation of endogenous FGFR4 in DU145 cells negatively regulates TNFα-stimulated activity of the IKK complex.

We also examined the interaction of endogenous IKKβ and FGFR4 in DU145 cells. As shown in Fig. 5A (Lane 2), this experiment revealed that endogenous FGFR4 protein can be recovered in an IKKβ immune complex. In addition, we examined NFκB localization in DU145 cells following treatment with TNFα and/or FGF19. Although we previously used indirect immunofluoresence, we found that DU145 cells did not sit down well on coverslips and produced equivocal images. Thus, we used cell fractionation to prepare nuclear and cytoplasmic fractions from DU145 cells. While NFκB was primarily cytoplasmic in untreated cells (Fig. 5B, compare Lanes 1 and 4), TNFα stimulation resulted in significant nuclear localization of NFκB (Lane 5). When DU145 cells were stimulated with TNFα, and also treated with FGF19, the nuclear localization of NFκB was significantly reduced to a level of 56% relative to TNFα alone (Lane 6, compare with Lane 5 which was set arbitrarily to 100%). Lastly, we examined the effects of FGF19 treatment on TNFα-induced NFκB DNA binding using EMSA assays (Figs. 5C and D). Compared with unstimulated DU145 cells, TNFα stimulated significant NFκB binding activity (Lane 2, compare with Lane 1). The addition of FGF19 decreased NFκB DNA binding activity by about 25% as measured by EMSA (Lane 3).

thumbnail
Figure 5. Endogenous FGFR4 and IKKβ interact in DU145 cells, and FGFR4 activation decreases TNFα-induced signaling.

A. Approximately 500 µg of total lysate was immunoprecipitated with 2 µg IKKβ (H-4) mouse mAB in 1% NP-40 lysis buffer. Immunoblot analysis was performed with FGFR4 (C-16) antibody (top panel). The membrane was stripped and reprobed with anti-IKKβ (10AG2) (lower panel). No IKKβ (H-4) antibody was added during the immunoprecipitation for the “No antibody” control (lane 1), whereas an equal amount of normal mouse IgG was added for the “IgG” control (lane 3). B. DU145 cells were treated with TNFα, or TNFα + FGF19. Cells were fractionated and the cytoplasmic and nuclear fractions were immunoblotted with NFκB p65 (F-6) antibody (top panel). Membranes were stripped and reprobed with β-tubulin and mSin3A antibodies to confirm cytoplasmic and nuclear fractions (lower panels). Quantitation of cytoplasmic NFκB in Lanes 1–3, for 3 independent experiments, was normalized relative to tubulin in lower blot, with NFκB in Lane 1 set to 100%: Lane 1, 100%; Lane 2, 79%±7%; Lane 3, 76%±9%. Quantitation of nuclear NFκB in Lanes 4–6, for 3 independent experiments, was normalized relative to Sin3A in lower blot, with NFκB in Lane 5 set to 100%: Lane 4, 16%±10%; Lane 5, 100%; Lane 6, 56%±18%. C. DU145 cells were stimulated with vehicle for 30 min, TNFα for 30 min, or FGF19 for 10 min prior to the addition of TNFα for an additional 30 min. Nuclear extracts were prepared and equal amounts of protein (2 µg) were subjected to EMSA with 32P-labeled 30 bp double-stranded oligonucleotide containing a consensus κB-site. D. Samples from (C) were exposed to a phosphorimager (Bio-Rad). Quantification of NF-κB binding to the probe was performed using the Quantity One software (Bio-Rad). The average NF-κB binding from three independent experiments, normalized to mock-transfected cells stimulated with TNFα, is shown +/− std. dev. *, P<0.0001. E. DU145 cells were treated with TSA, FGF19 and TNFα as indicated. Cell lysates were separated by SDS-PAGE and transferred to Immobilon-P. The membrane was cut and the top was incubated with antibody against cleaved-PARP (top panel). The lower portion was probed with β-tubulin antibody (bottom panel). F. The experiment from (E) was performed in triplicate and quantitated, with the amount of cleaved PARP normalized to the TNF sample, shown +/− sem. *, P<0.03.

https://doi.org/10.1371/journal.pone.0014412.g005

Using multiple assays, these experiments thus demonstrate that stimulation of the endogenous FGFR4 receptor in DU145 cells exerts an unequivocal negative regulatory effect on TNFα-stimulated outcomes.

FGF19 stimulation reduces TNFα-induced apoptosis in DU145 cells

Next we examined the effect of FGF19 treatment on TNFα-induced apoptosis in the DU145 prostate cancer cell line. Since this cell line has previously been found to be resistant to apoptosis induced by TNF-family ligands, we utilized trichostatin A (TSA), a histone deacetylase inhibitor, to sensitize the cells to TNFα [30], [31]. DU145 cells were treated with TSA and FGF19 prior to the addition of TNFα. Cells were examined for Poly(ADP-ribose) Polymerase (PARP) cleavage as an indicator of apoptosis. FGF19 treatment reduced the amount of cleaved PARP induced by TNFα by approximately 35% (Figs. 5E and F). These results indicate that activation of FGFR4 signaling pathways in DU145 cells by FGF19 is able to negatively regulate apoptosis induced by TNFα stimulation.

FGF19 treatment alters global TNFα-induced gene expression in DU145 cells

Changes in global gene expression were quantified by microarray analysis using DU145 cells treated with TNFα, FGF19, or both, and harvested at 1.5 h. Using Mock (−FGF19/−TNFα) as the control condition, 1148 out of 24,220 probesets satisfied a corrected p-value cut-off of 0.015 using ANOVA analysis; furthermore, of these, 307 satisfied a fold-change cut-off of 2.0. These results are presented graphically in the heat map shown in Fig. 6A, revealing that significant changes in global gene expression occur in DU145 cells treated with or without FGF19, and with or without TNFα, as early as 1.5 h. See Supporting Information Table S1 for complete data.

thumbnail
Figure 6. FGF19 alters TNFα-stimulated Gene Expression.

A. Microarray analysis profiles global expression changes in DU145 cells at 1.5 h after stimulation −/+ FGF19 and −/+ TNFα. Heat map presents expression changes for probesets at a p-value cut-off of 0.015, and which satisfy a fold change cut-off of 2.0 relative to the [Mock] sample. Complete data are presented in Supporting Information Table S1. B. Schematic showing possible interactions between FGFR4 and NFκB pathways.

https://doi.org/10.1371/journal.pone.0014412.g006

The microarray expression data were reanalyzed using the same statistical cutoff as before, but with the [+TNFα] as the control condition. Approximately 260 probesets exhibited a fold change cut-off of 2.0 or more (Supporting Information Table S2). A subset of these is presented in Table 2, showing all genes involved in the regulation of cell cycle, apoptosis, or NFκB signaling. The stimulation of DU145 cells with FGF19 + TNFα, in comparison to TNFα alone, exhibits the following general effects: 1) stimulation of cell proliferation by upregulation of proliferative genes such as GAB1, IRF2, and CCNK; 2) stimulation of cell proliferation by downregulation of cell cycle inhibitory genes such as CDKN1A and BTG1; 3) inhibition of genes involved in regulation of NFκB signaling, such as TNFRSF10B and FADD, and 4) inhibition of apoptotic responses by downregulation of genes such as MIF and MTCH1.

thumbnail
Table 2. Effects of FGF19 + TNFα treatment vsTNFα alone on gene expression in DU145 Cells.

https://doi.org/10.1371/journal.pone.0014412.t002

Discussion

In this report, we characterize a novel interaction between a receptor tyrosine kinase, FGFR4, and a key regulatory protein in the NFκB pathway, IKKβ. This interaction was initially identified by yeast two-hybrid screening (Fig. 1A), confirmed by coimmunoprecipitation in both directions in HEK293 cells (Fig. 1B and 1C), and subsequently validated by the identification of FGFR4-derived peptides by mass spectrometry analysis of IKKβ immune complexes (Table 1). Furthermore, we demonstrate that endogenous FGFR4 and IKKβ proteins interact in the DU145 prostate cancer cell line (Fig. 5A). This latter result is significant, as otherwise one could argue that the protein-protein interaction results from overexpression in HEK293 cells. We have additionally demonstrated a similar protein-protein interaction between the related receptor FGFR2 and IKKβ (data not shown). Although it seems likely that this may represent a direct interaction between these two proteins, at present, we cannot exclude the possibility that an additional unidentified protein may be involved in mediating this interaction.

These results raise the question of the biological significance of this interaction. In one approach to this question, we examined the kinase activity of IKKβ complexes recovered from cells expressing different mutants of FGFR4, using phosphorylation of GST-IκB(1–54) as the readout. We show that expression of FGFR4-WT or an activated FGFR4 K645E mutant, but not kinase-dead FGFR4, leads to a decrease in the in vitro kinase activity of endogenous IKKβ complexes (Fig. 4A and 4B), indicating that FGFR4 kinase activity is required for the reduction in IKKβ activity. Moreover, stimulation of endogenous FGFR4 with the ligand FGF19 leads to a decrease in the kinase activity of IKKβ complexes prepared from either HEK293 or DU145 cell lines (Fig. 4). In an alternate approach, we show that expression of FGFR4 and/or stimulation of endogenous FGFR4 with FGF19 leads to a reduction in NFκB nuclear localization as revealed by immunofluorescence localization (Fig. 3) and by cell fractionation (Fig. 5B). In a third approach, we also demonstrate a decrease in the amount of NFκB DNA binding using EMSA assays (Fig. 5C and 5D). In the three different cell lines used, similar effects of FGF19/FGFR4 activation were observed with regards to the downregulation of NFκB signaling. From these assays, we conclude that FGFR4 activation overall exerts an inhibitory effect upon IKKβ activity and NFκB signaling.

Using DU145 prostate cancer cells, we demonstrate that FGF19 stimulation results in a decrease in TNFα-induced apoptosis (Fig. 5E and 5F). In addition, we utilized microarray expression analysis to profile global changes in gene expression in a short time interval (1.5 h) following treatment of DU145 cells with FGF19, TNFα, or both. When microarray data for DU145 cells stimulated with FGF19 + TNFα were compared with cells stimulated with TNFα alone, we found that the addition of FGF19 in general favored proliferative changes, while decreasing the expression of inflammatory and apoptotic genes (Table 2). Key examples of proliferative functionalities are: the increased expression of GAB1 (GRB2-associated binding protein 1), which stimulates Ras/MAPK activity [32]; the increased expression of CCNK, cyclin K, which activates CDK9 and downregulates p27Kip1 [33], [34]; the downregulation of CDKN1A, the cyclin-dependent kinase inhibitor p21Cip1 [35]; and the downregulation of BTG1, a member of an anti-proliferative gene family that regulates cell growth and differentiation [36]. On the other hand, prominent examples of anti-apoptotic changes are: the decreased expression of the proinflammatory mediator MIF (macrophage migration inhibitory factor) [37]; decreased expression of TNFRSF10B (TNF receptor superfamily, member 10b), also known as TRAIL-R2 or DR5, a Death Receptor directly involved in apoptosis [38]; decreased expression of FADD (FAS-associated death domain protein), which functions as an adapter protein in assembly of the death-inducing signaling complex [39]; and decreased expression of the pro-apoptotic mitochondrial outer membrane protein MTCH1 (mitochondrial carrier homolog 1), also known as Presenilin 1-associated protein [40]. We interpret these changes to be generally pro-proliferative and anti-apoptotic in nature, without over-interpreting the importance of altered expression of any individual gene, which would require further detailed analysis.

The data presented in Fig. 2 demonstrate tyrosine phosphorylation of IKKβ in cells expressing a kinase-active FGFR4, but not kinase-dead FGFR4. The simplest interpretation of this result would be that FGFR4 directly phosphorylates IKKβ and modulates its activity and/or stability. However, many other proteins are likely to be recruited into a complex with FGFR4 and IKKβ, and so the possibility exists that IKKβ tyrosine phosphorylation may be the result of an ancillary protein kinase in the complex. Other FGFR family members have been shown to recruit a variety of regulatory proteins including Grb2-SOS [41], Pyk2/RAFTK [42], RSK2 [43], SH2-B [44] and others; any of these might mediate effects through interaction with NFκB family members. Although beyond the scope of the present paper, using mass spectrometry, we have identified multiple sites of Tyr phosphorylation on IKKβ (data not shown). Understanding the role of these multiple phosphorylation sites is an ongoing area of research and will require significant effort to unravel. We have also demonstrated that coexpression of IKKβ with other members of the FGFR family, FGFR1, FGFR2, and FGFR3, results in IKKβ Tyr phosphorylation (data not shown); thus we are confident that the interaction we report here is not restricted to FGFR4 alone.

Several previous studies have reported activation of NFκB signaling downstream of RTKs. For example, EGF stimulation of EGFR in A431 cells or in mouse embryo fibroblasts enhanced the degradation of IκBα and resulted in NFκB activation [45]. Using non-small cell lung adenocarcinoma cell lines, this effect was subsequently shown to require phosphorylation of IκBα Tyr-42 and to be independent of IKK [46]. EGF treatment of ER-negative breast cancer cells also led to NFκB activation and indirectly, through increased expression of cyclin D, increased cell cycle progression [47]. Overexpression of the related receptor, ErbB2, in MCF-7 breast carcinoma cells resulted in enhanced NFκB activation in response to ionizing radiation [48]. A recent study [49] analyzing a prostate cancer tissue microarray documented a significant role of ErbB/PI3K/Akt/NFκB signaling in the progression of prostate cancer. These studies thus present a fairly consistent picture of NFκB activation downstream of EGFR activation.

In contrast, however, inhibition of EGFR in cervical carcinoma cells by the small molecule inhibitor PD153035 led to a dose-dependent increase in NFκB activation [50]. In studies of an unrelated RTK, activation of Ron by its ligand, hepatocyte growth factor-like protein, decreases TNFα production in alveolar macrophages after LPS challenge, resulting in decreased NFκB activation and increased IκB activity [51]. Thus, it seems clear that the interplay between the many different human RTKs with NFκB signaling components will be complex and most likely will depend on cell type and specific conditions.

FGFR4 is widely expressed during development, especially during myogenesis and development of endodermally derived organs [52], [53]. In addition, FGFR4 may be constitutively-activated or overexpressed in a variety of human neoplasias, including hepatocellular carcinoma [54], [55], prostate cancer [9], [56], rhabdomyosarcoma [57] and breast cancer [58], [59], and the potential utility of FGF19 and/or FGFR4 as a target for growth inhibition has been proposed [54], [60], [61]. While chronic FGFR stimulation can undoubtedly serve as a driver for cellular proliferation, the results reported here indicate a more complex relationship in that FGFR4 also clearly interacts with IKKβ. FGFR4 activation leads to an inhibitory effect on NFκB signaling, including an inhibitory effect on proapoptotic signaling mediated by NFκB pathways.

Materials and Methods

Cell culture

HeLa and HEK293 cells were grown in DMEM with 10% FBS and 1% Pen/strep; DU 145 cells were grown in RPMI1640 with 10% FBS and 1% Pen/strep. HeLa and DU145 cells were maintained in 5% CO2; HEK-293 cells were maintained in 10% CO2. Cell lines were obtained from ATCC (American Type Culture Collection) (http://www.atcc.org/).

Plasmid constructs

The full-length FGFR4-WT and constitutively active FGFR4-K645E were described previously [22]. The kinase dead (K504M) and E681K derivatives were generated by QuikChange site-directed mutagenesis (Stratagene). The HA-IKKβ clone was received from Dr. Mark Hannink (University of Missouri). The HA-tag was removed by QuikChange site-directed mutagenesis and confirmed by DNA sequencing. The GST-IκB(1–54) plasmid was provided by Prof. Alexander Hoffmann (UCSD).

Antibodies, reagents, immunoprecipitation and immunoblot

Antibodies were obtained from the following sources: FGFR4 (C-16), IKKβ (H-4), IKKβ (10AG2), NFκB p65 (F-6), β-tubulin (H-235), IKKγ (FL-419), normal mouse IgG (sc-2025) from Santa Cruz Biotechnology; phospho-p44/42 MAPK (Thr202/Tyr204; E-10) and cleaved PARP (Asp214) from Cell Signaling; MAPK (ERK1+ERK2) from Zymed; 4G10 (antiphosphotyrosine) from Upstate Biotechnology; horseradish peroxidase (HRP) anti-mouse, HRP anti-rabbit from GE Healthcare; fluorescein-conjugated anti-mouse from Sigma and rhodamine-conjugated anti-rabbit from Boehringer-Mannheim. FGF19 and TNFα were obtained from R&D. mSin3A antibody (Santa Cruz, K-20) was a gift from Dr. Alexander Hoffmann. Poly(Glu, Tyr) was obtained from Sigma. Trichostatin A (TSA) was a gift from Dr. Leor Weinberger (UCSD). Techniques for immunoprecipitation and immunoblotting were as described previously [22], [42], [62]. Endogenous protein interactions were detected by coimmunoprecipitation using 500 µg of total cell lysate as previously described [42], [44]. To examine the effect of FGF19 stimulation on TNFα-induced apoptosis, DU145 cells were starved overnight, pre-treated with 100 ng/ml TSA as previously described [30], followed by 50 ng/ml FGF19 plus 50 µg/ml heparin for 25 min, after which TNFα was added at 1 ng/ml for 3 h.

Yeast two-hybrid assay

The yeast two-hybrid assay was conducted as described [1], [63]. Briefly, the Saccharomyces cerevisiae strain L40 generated by Dr. Stan Hollenberg was transformed with derivatives of pBTM116 (constructed by Dr. Paul Bartel and Dr. Stan Fields). A LexA bait plasmid was constructed containing the juxtamembrane and intracellular region of FGFR4 (amino acids 373–803), fused in frame with LexA in pBTM116. This was screened against a 9.5 d.p.c. mouse embryonic cDNA library encoding fusion proteins with the transactivation domain of pVP16, kindly provided by Dr. Stan Hollenberg. Controls for two-hybrid assays, LexA-lamin as a negative control, and VP16-PLCγ as a positive control, were previously described [63]. The two-hybrid screen, His± minimal media assays, lacZ reporter β-galactosidase filter assay, and the use of controls were performed as previously described [63].

Indirect immunofluorescence

Techniques for indirect immunofluorescence have been previously described [22], [42], [62]. Briefly, HeLa cells plated on glass coverslips were transfected using Fugene 6 (Roche) or calcium phosphate precipitation, starved the following day for 24 h, and treated with TNFα for 30 min prior to fixation.

In vitro kinase assays

HEK293 or DU145 cells were transfected as indicated prior to overnight starvation in DMEM, then treated with 25 ng/ml FGF19 for 10 min and/or followed by 10 ng/ml TNFα for 10 min. Cells lysates were prepared, immunoprecipitated with IKKγ antibody, collected on Protein A-Sepharose beads, and subjected to in vitro kinase assay utilizing GST-IκB(1–54) as the substrate [24], [64], [65]. In vitro kinase assays containing 1 µCi [γ-32P]-ATP in a total of 20 µM ATP were incubated at 30°C for 30 min, separated by 10% SDS-PAGE, exposed to film or phosphorimager screen, and quantitated.

Electrophoretic Mobility Shift Assay (EMSA)

EMSA assays were as described elsewhere [66]. Briefly, 2 µg of total nuclear protein was reacted at room temperature for 15 min with excess 32P-labeled 30 bp double-stranded oligonucleotide (AGCTTGCTACAAGGGACTTTCCGCTGTCTACTTT) containing a consensus κB-site in 6 µl binding buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl, 10% glycerol, 1% NP-40, 1 mM EDTA, 0.1 µg/µl Poly(dI,dC)). Complexes were resolved on a non-denaturing 5% acrylamide gel containing 5% glycerol, and visualized and quantified using a Phosphorimager (Bio-Rad). Experimental details and probe specificity have been described [67].

NFκB localization by cell fractionation

DU145 cells were plated on 10 cm dishes. Upon reaching 80% confluency, cells were starved overnight and treated the next day with 50 ng/ml FGF19 and 1 µg/ml heparin for 10 min prior to the addition of 10 ng/ml TNFα for 30 min. Cell lysates were fractionated as for EMSA.

Mass spectrometry analysis

HEK293 cells were plated (3×106 per 15 cm dish, 10 dishes total), 1 day prior to transfection with expression plasmids for both the activated FGFR4-K645E and IKKβ. After an additional 24 h, cell lysates were prepared as described [16], [17]. IKKβ immune complexes were prepared by incubation with IKKβ (H-4) antiserum at 4°C overnight, collected with Protein A-sepharose for an additional 2 h, and then trypsinized in 2 M urea. Peptides were analyzed by the Proteomics Facility of the Sanford-Burnham Medical Research Institute using immobilized metal affinity chromatography/nano-liquid chromatography/electrospray ionization mass spectrometry (IMAC/nano-LC/ESI-MS) [16], [17].

Microarray expression analysis

DU145 cells were plated (8×105 per 10 cm dish), and the following day cells were starved for 24 h. Cells were treated with 50 ng/ml FGF19 and 50 µg/ml heparin for 10 min prior to the addition of 10 ng/ml TNFα for 1.5 h. RNA was isolated using RNA-BEE (Tel-Test) per manufacturer's protocol. RNA was analyzed by the UCSD Moores Cancer Center Microarray Shared Resource using Affymetrix GeneChip Human Gene 1.0 ST Arrays (# 901085). Duplicate samples were analyzed in duplicate microarrays, and data were further analyzed by VAMPIRE and GeneSpring. All data is MIAME compliant and the raw data have been deposited in the Gene Expression Omnibus (GEO) (accession number GSE22807).

Supporting Information

Table S1.

Microarray Expression Data of DU145 Cells.

https://doi.org/10.1371/journal.pone.0014412.s001

(0.03 MB PDF)

Table S2.

Microarray Expression Data of DU145 Cells Using TNFalpha as Control.

https://doi.org/10.1371/journal.pone.0014412.s002

(0.12 MB PDF)

Acknowledgments

We thank Prof. Alexander Hoffmann, Shannon Werner and Ellen O'Dea for experimental advice; Dr. Larry Brill and the Proteomics Facility of the Sanford-Burnham Medical Research Institute for assistance with mass spectrometry; Dr. Majid Ghassemian of the Department of Chemistry & Biochemistry Biomolecular and Proteomics Mass Spectrometry Facility; Prof. Nick Webster and the UCSD Shared Resources Microarray Facility for assistance with microarray analysis; Prof. Mark Hannink and Prof. Leor Weinberger for reagents; Jason Liang for technical assistance; and Laura Castrejon for editorial assistance.

Author Contributions

Conceived and designed the experiments: KAD. Performed the experiments: KAD CWM ANM. Analyzed the data: KAD CWM ANM MH DJD. Contributed reagents/materials/analysis tools: MH DJD. Wrote the paper: KAD.

References

  1. 1. Vojtek AB, Hollenberg SM, Cooper JA (1993) Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74: 205–214.AB VojtekSM HollenbergJA Cooper1993Mammalian Ras interacts directly with the serine/threonine kinase Raf.Cell74205214
  2. 2. Schmid JA, Birbach A (2008) IkappaB kinase beta (IKKbeta/IKK2/IKBKB)—a key molecule in signaling to the transcription factor NF-kappaB. Cytokine Growth Factor Rev 19: 157–165.JA SchmidA. Birbach2008IkappaB kinase beta (IKKbeta/IKK2/IKBKB)—a key molecule in signaling to the transcription factor NF-kappaB.Cytokine Growth Factor Rev19157165
  3. 3. Sarkar FH, Li Y (2008) NF-kappaB: a potential target for cancer chemoprevention and therapy. Front Biosci 13: 2950–2959.FH SarkarY. Li2008NF-kappaB: a potential target for cancer chemoprevention and therapy.Front Biosci1329502959
  4. 4. Hacker H, Karin M (2006) Regulation and function of IKK and IKK-related kinases. Sci STKE 2006: re13.H. HackerM. Karin2006Regulation and function of IKK and IKK-related kinases.Sci STKE2006re13
  5. 5. Dutta J, Fan Y, Gupta N, Fan G, Gelinas C (2006) Current insights into the regulation of programmed cell death by NF-kappaB. Oncogene 25: 6800–6816.J. DuttaY. FanN. GuptaG. FanC. Gelinas2006Current insights into the regulation of programmed cell death by NF-kappaB.Oncogene2568006816
  6. 6. Karin M (2008) The IkappaB kinase - a bridge between inflammation and cancer. Cell Res 18: 334–342.M. Karin2008The IkappaB kinase - a bridge between inflammation and cancer.Cell Res18334342
  7. 7. Karin M (2006) Nuclear factor-kappaB in cancer development and progression. Nature 441: 431–436.M. Karin2006Nuclear factor-kappaB in cancer development and progression.Nature441431436
  8. 8. Wang J, Yu W, Cai Y, Ren C, Ittmann MM (2008) Altered fibroblast growth factor receptor 4 stability promotes prostate cancer progression. Neoplasia 10: 847–856.J. WangW. YuY. CaiC. RenMM Ittmann2008Altered fibroblast growth factor receptor 4 stability promotes prostate cancer progression.Neoplasia10847856
  9. 9. Sahadevan K, Darby S, Leung HY, Mathers ME, Robson CN, et al. (2007) Selective over-expression of fibroblast growth factor receptors 1 and 4 in clinical prostate cancer. J Pathol 213: 82–90.K. SahadevanS. DarbyHY LeungME MathersCN Robson2007Selective over-expression of fibroblast growth factor receptors 1 and 4 in clinical prostate cancer.J Pathol2138290
  10. 10. Gowardhan B, Douglas DA, Mathers ME, McKie AB, McCracken SR, et al. (2005) Evaluation of the fibroblast growth factor system as a potential target for therapy in human prostate cancer. Br J Cancer 92: 320–327.B. GowardhanDA DouglasME MathersAB McKieSR McCracken2005Evaluation of the fibroblast growth factor system as a potential target for therapy in human prostate cancer.Br J Cancer92320327
  11. 11. Huang J, Wu L, Tashiro S, Onodera S, Ikejima T (2006) Fibroblast growth factor-2 suppresses oridonin-induced L929 apoptosis through extracellular signal-regulated kinase-dependent and phosphatidylinositol 3-kinase-independent pathway. J Pharmacol Sci 102: 305–313.J. HuangL. WuS. TashiroS. OnoderaT. Ikejima2006Fibroblast growth factor-2 suppresses oridonin-induced L929 apoptosis through extracellular signal-regulated kinase-dependent and phosphatidylinositol 3-kinase-independent pathway.J Pharmacol Sci102305313
  12. 12. Vandermoere F, El Yazidi-Belkoura I, Adriaenssens E, Lemoine J, Hondermarck H (2005) The antiapoptotic effect of fibroblast growth factor-2 is mediated through nuclear factor-kappaB activation induced via interaction between Akt and IkappaB kinase-beta in breast cancer cells. Oncogene 24: 5482–5491.F. VandermoereI. El Yazidi-BelkouraE. AdriaenssensJ. LemoineH. Hondermarck2005The antiapoptotic effect of fibroblast growth factor-2 is mediated through nuclear factor-kappaB activation induced via interaction between Akt and IkappaB kinase-beta in breast cancer cells.Oncogene2454825491
  13. 13. Gardner AM, Johnson GL (1996) Fibroblast growth factor-2 suppression of tumor necrosis factor alpha-mediated apoptosis requires Ras and the activation of mitogen-activated protein kinase. J Biol Chem 271: 14560–14566.AM GardnerGL Johnson1996Fibroblast growth factor-2 suppression of tumor necrosis factor alpha-mediated apoptosis requires Ras and the activation of mitogen-activated protein kinase.J Biol Chem2711456014566
  14. 14. May MJ, Marienfeld RB, Ghosh S (2002) Characterization of the Ikappa B-kinase NEMO binding domain. J Biol Chem 277: 45992–46000.MJ MayRB MarienfeldS. Ghosh2002Characterization of the Ikappa B-kinase NEMO binding domain.J Biol Chem2774599246000
  15. 15. Kwak YT, Guo J, Shen J, Gaynor RB (2000) Analysis of domains in the IKKalpha and IKKbeta proteins that regulate their kinase activity. J Biol Chem 275: 14752–14759.YT KwakJ. GuoJ. ShenRB Gaynor2000Analysis of domains in the IKKalpha and IKKbeta proteins that regulate their kinase activity.J Biol Chem2751475214759
  16. 16. Brill LM, Salomon AR, Ficarro SB, Mukherji M, Stettler-Gill M, et al. (2004) Robust phosphoproteomic profiling of tyrosine phosphorylation sites from human T cells using immobilized metal affinity chromatography and tandem mass spectrometry. Anal Chem 76: 2763–2772.LM BrillAR SalomonSB FicarroM. MukherjiM. Stettler-Gill2004Robust phosphoproteomic profiling of tyrosine phosphorylation sites from human T cells using immobilized metal affinity chromatography and tandem mass spectrometry.Anal Chem7627632772
  17. 17. Mukherji M, Brill LM, Ficarro SB, Hampton GM, Schultz PG (2006) A phosphoproteomic analysis of the ErbB2 receptor tyrosine kinase signaling pathways. Biochemistry 45: 15529–15540.M. MukherjiLM BrillSB FicarroGM HamptonPG Schultz2006A phosphoproteomic analysis of the ErbB2 receptor tyrosine kinase signaling pathways.Biochemistry451552915540
  18. 18. Shambharkar PB, Blonska M, Pappu BP, Li H, You Y, et al. (2007) Phosphorylation and ubiquitination of the IkappaB kinase complex by two distinct signaling pathways. Embo J 26: 1794–1805.PB ShambharkarM. BlonskaBP PappuH. LiY. You2007Phosphorylation and ubiquitination of the IkappaB kinase complex by two distinct signaling pathways.Embo J2617941805
  19. 19. Schomer-Miller B, Higashimoto T, Lee YK, Zandi E (2006) Regulation of IkappaB kinase (IKK) complex by IKKgamma-dependent phosphorylation of the T-loop and C terminus of IKKbeta. J Biol Chem 281: 15268–15276.B. Schomer-MillerT. HigashimotoYK LeeE. Zandi2006Regulation of IkappaB kinase (IKK) complex by IKKgamma-dependent phosphorylation of the T-loop and C terminus of IKKbeta.J Biol Chem2811526815276
  20. 20. Zandi E, Chen Y, Karin M (1998) Direct phosphorylation of IkappaB by IKKalpha and IKKbeta: discrimination between free and NF-kappaB-bound substrate. Science 281: 1360–1363.E. ZandiY. ChenM. Karin1998Direct phosphorylation of IkappaB by IKKalpha and IKKbeta: discrimination between free and NF-kappaB-bound substrate.Science28113601363
  21. 21. Delhase M, Hayakawa M, Chen Y, Karin M (1999) Positive and negative regulation of IkappaB kinase activity through IKKbeta subunit phosphorylation. Science 284: 309–313.M. DelhaseM. HayakawaY. ChenM. Karin1999Positive and negative regulation of IkappaB kinase activity through IKKbeta subunit phosphorylation.Science284309313
  22. 22. Hart KC, Robertson SC, Kanemitsu MY, Meyer AN, Tynan JA, et al. (2000) Transformation and Stat activation by derivatives of FGFR1, FGFR3, and FGFR4. Oncogene 19: 3309–3320.KC HartSC RobertsonMY KanemitsuAN MeyerJA Tynan2000Transformation and Stat activation by derivatives of FGFR1, FGFR3, and FGFR4.Oncogene1933093320
  23. 23. Zandi E, Rothwarf DM, Delhase M, Hayakawa M, Karin M (1997) The IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB activation. Cell 91: 243–252.E. ZandiDM RothwarfM. DelhaseM. HayakawaM. Karin1997The IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB activation.Cell91243252
  24. 24. DiDonato JA, Hayakawa M, Rothwarf DM, Zandi E, Karin M (1997) A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB. Nature 388: 548–554.JA DiDonatoM. HayakawaDM RothwarfE. ZandiM. Karin1997A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB.Nature388548554
  25. 25. Verma IM, Stevenson JK, Schwarz EM, Van Antwerp D, Miyamoto S (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev 9: 2723–2735.IM VermaJK StevensonEM SchwarzD. Van AntwerpS. Miyamoto1995Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation.Genes Dev927232735
  26. 26. Baeuerle PA, Baltimore D (1996) NF-kappa B: ten years after. Cell 87: 13–20.PA BaeuerleD. Baltimore1996NF-kappa B: ten years after.Cell871320
  27. 27. Baldwin AS Jr (1996) The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu Rev Immunol 14: 649–683.AS Baldwin Jr1996The NF-kappa B and I kappa B proteins: new discoveries and insights.Annu Rev Immunol14649683
  28. 28. Xie MH, Holcomb I, Deuel B, Dowd P, Huang A, et al. (1999) FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4. Cytokine 11: 729–735.MH XieI. HolcombB. DeuelP. DowdA. Huang1999FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4.Cytokine11729735
  29. 29. Chandler LA, Sosnowski BA, Greenlees L, Aukerman SL, Baird A, et al. (1999) Prevalent expression of fibroblast growth factor (FGF) receptors and FGF2 in human tumor cell lines. Int J Cancer 81: 451–458.LA ChandlerBA SosnowskiL. GreenleesSL AukermanA. Baird1999Prevalent expression of fibroblast growth factor (FGF) receptors and FGF2 in human tumor cell lines.Int J Cancer81451458
  30. 30. Taghiyev AF, Guseva NV, Sturm MT, Rokhlin OW, Cohen MB (2005) Trichostatin A (TSA) sensitizes the human prostatic cancer cell line DU145 to death receptor ligands treatment. Cancer Biol Ther 4: 382–390.AF TaghiyevNV GusevaMT SturmOW RokhlinMB Cohen2005Trichostatin A (TSA) sensitizes the human prostatic cancer cell line DU145 to death receptor ligands treatment.Cancer Biol Ther4382390
  31. 31. Rokhlin OW, Glover RA, Taghiyev AF, Guseva NV, Seftor RE, et al. (2002) Bisindolylmaleimide IX facilitates tumor necrosis factor receptor family-mediated cell death and acts as an inhibitor of transcription. J Biol Chem 277: 33213–33219.OW RokhlinRA GloverAF TaghiyevNV GusevaRE Seftor2002Bisindolylmaleimide IX facilitates tumor necrosis factor receptor family-mediated cell death and acts as an inhibitor of transcription.J Biol Chem2773321333219
  32. 32. Cai T, Nishida K, Hirano T, Khavari PA (2002) Gab1 and SHP-2 promote Ras/MAPK regulation of epidermal growth and differentiation. J Cell Biol 159: 103–112.T. CaiK. NishidaT. HiranoPA Khavari2002Gab1 and SHP-2 promote Ras/MAPK regulation of epidermal growth and differentiation.J Cell Biol159103112
  33. 33. Baek K, Brown RS, Birrane G, Ladias JA (2007) Crystal structure of human cyclin K, a positive regulator of cyclin-dependent kinase 9. J Mol Biol 366: 563–573.K. BaekRS BrownG. BirraneJA Ladias2007Crystal structure of human cyclin K, a positive regulator of cyclin-dependent kinase 9.J Mol Biol366563573
  34. 34. Mann DJ, Child ES, Swanton C, Laman H, Jones N (1999) Modulation of p27(Kip1) levels by the cyclin encoded by Kaposi's sarcoma-associated herpesvirus. Embo J 18: 654–663.DJ MannES ChildC. SwantonH. LamanN. Jones1999Modulation of p27(Kip1) levels by the cyclin encoded by Kaposi's sarcoma-associated herpesvirus.Embo J18654663
  35. 35. Besson A, Dowdy SF, Roberts JM (2008) CDK inhibitors: cell cycle regulators and beyond. Dev Cell 14: 159–169.A. BessonSF DowdyJM Roberts2008CDK inhibitors: cell cycle regulators and beyond.Dev Cell14159169
  36. 36. Winkler GS (2010) The mammalian anti-proliferative BTG/Tob protein family. J Cell Physiol 222: 66–72.GS Winkler2010The mammalian anti-proliferative BTG/Tob protein family.J Cell Physiol2226672
  37. 37. Noels H, Bernhagen J, Weber C (2009) Macrophage migration inhibitory factor: a noncanonical chemokine important in atherosclerosis. Trends Cardiovasc Med 19: 76–86.H. NoelsJ. BernhagenC. Weber2009Macrophage migration inhibitory factor: a noncanonical chemokine important in atherosclerosis.Trends Cardiovasc Med197686
  38. 38. Chaudhari BR, Murphy RF, Agrawal DK (2006) Following the TRAIL to apoptosis. Immunol Res 35: 249–262.BR ChaudhariRF MurphyDK Agrawal2006Following the TRAIL to apoptosis.Immunol Res35249262
  39. 39. Wilson NS, Dixit V, Ashkenazi A (2009) Death receptor signal transducers: nodes of coordination in immune signaling networks. Nat Immunol 10: 348–355.NS WilsonV. DixitA. Ashkenazi2009Death receptor signal transducers: nodes of coordination in immune signaling networks.Nat Immunol10348355
  40. 40. Lamarca V, Sanz-Clemente A, Perez-Pe R, Martinez-Lorenzo MJ, Halaihel N, et al. (2007) Two isoforms of PSAP/MTCH1 share two proapoptotic domains and multiple internal signals for import into the mitochondrial outer membrane. Am J Physiol Cell Physiol 293: C1347–1361.V. LamarcaA. Sanz-ClementeR. Perez-PeMJ Martinez-LorenzoN. Halaihel2007Two isoforms of PSAP/MTCH1 share two proapoptotic domains and multiple internal signals for import into the mitochondrial outer membrane.Am J Physiol Cell Physiol293C13471361
  41. 41. Ong SH, Hadari YR, Gotoh N, Guy GR, Schlessinger J, et al. (2001) Stimulation of phosphatidylinositol 3-kinase by fibroblast growth factor receptors is mediated by coordinated recruitment of multiple docking proteins. Proc Natl Acad Sci U S A 98: 6074–6079.SH OngYR HadariN. GotohGR GuyJ. Schlessinger2001Stimulation of phosphatidylinositol 3-kinase by fibroblast growth factor receptors is mediated by coordinated recruitment of multiple docking proteins.Proc Natl Acad Sci U S A9860746079
  42. 42. Meyer AN, Gastwirt RF, Schlaepfer DD, Donoghue DJ (2004) The cytoplasmic tyrosine kinase Pyk2 as a novel effector of fibroblast growth factor receptor 3 activation. J Biol Chem 279: 28450–28457.AN MeyerRF GastwirtDD SchlaepferDJ Donoghue2004The cytoplasmic tyrosine kinase Pyk2 as a novel effector of fibroblast growth factor receptor 3 activation.J Biol Chem2792845028457
  43. 43. Kang S, Dong S, Gu TL, Guo A, Cohen MS, et al. (2007) FGFR3 activates RSK2 to mediate hematopoietic transformation through tyrosine phosphorylation of RSK2 and activation of the MEK/ERK pathway. Cancer Cell 12: 201–214.S. KangS. DongTL GuA. GuoMS Cohen2007FGFR3 activates RSK2 to mediate hematopoietic transformation through tyrosine phosphorylation of RSK2 and activation of the MEK/ERK pathway.Cancer Cell12201214
  44. 44. Kong M, Wang CS, Donoghue DJ (2002) Interaction of fibroblast growth factor receptor 3 and the adapter protein SH2-B. A role in STAT5 activation. J Biol Chem 277: 15962–15970.M. KongCS WangDJ Donoghue2002Interaction of fibroblast growth factor receptor 3 and the adapter protein SH2-B. A role in STAT5 activation.J Biol Chem2771596215970
  45. 45. Sun L, Carpenter G (1998) Epidermal growth factor activation of NF-kappaB is mediated through IkappaBalpha degradation and intracellular free calcium. Oncogene 16: 2095–2102.L. SunG. Carpenter1998Epidermal growth factor activation of NF-kappaB is mediated through IkappaBalpha degradation and intracellular free calcium.Oncogene1620952102
  46. 46. Sethi G, Ahn KS, Chaturvedi MM, Aggarwal BB (2007) Epidermal growth factor (EGF) activates nuclear factor-kappaB through IkappaBalpha kinase-independent but EGF receptor-kinase dependent tyrosine 42 phosphorylation of IkappaBalpha. Oncogene 26: 7324–7332.G. SethiKS AhnMM ChaturvediBB Aggarwal2007Epidermal growth factor (EGF) activates nuclear factor-kappaB through IkappaBalpha kinase-independent but EGF receptor-kinase dependent tyrosine 42 phosphorylation of IkappaBalpha.Oncogene2673247332
  47. 47. Biswas DK, Cruz AP, Gansberger E, Pardee AB (2000) Epidermal growth factor-induced nuclear factor kappa B activation: A major pathway of cell-cycle progression in estrogen-receptor negative breast cancer cells. Proc Natl Acad Sci U S A 97: 8542–8547.DK BiswasAP CruzE. GansbergerAB Pardee2000Epidermal growth factor-induced nuclear factor kappa B activation: A major pathway of cell-cycle progression in estrogen-receptor negative breast cancer cells.Proc Natl Acad Sci U S A9785428547
  48. 48. Guo G, Wang T, Gao Q, Tamae D, Wong P, et al. (2004) Expression of ErbB2 enhances radiation-induced NF-kappaB activation. Oncogene 23: 535–545.G. GuoT. WangQ. GaoD. TamaeP. Wong2004Expression of ErbB2 enhances radiation-induced NF-kappaB activation.Oncogene23535545
  49. 49. Koumakpayi IH, Le Page C, Mes-Masson AM, Saad F (2010) Hierarchical clustering of immunohistochemical analysis of the activated ErbB/PI3K/Akt/NF-kappaB signalling pathway and prognostic significance in prostate cancer. Br J Cancer 102: 1163–1173.IH KoumakpayiC. Le PageAM Mes-MassonF. Saad2010Hierarchical clustering of immunohistochemical analysis of the activated ErbB/PI3K/Akt/NF-kappaB signalling pathway and prognostic significance in prostate cancer.Br J Cancer10211631173
  50. 50. Woodworth CD, Michael E, Marker D, Allen S, Smith L, et al. (2005) Inhibition of the epidermal growth factor receptor increases expression of genes that stimulate inflammation, apoptosis, and cell attachment. Mol Cancer Ther 4: 650–658.CD WoodworthE. MichaelD. MarkerS. AllenL. Smith2005Inhibition of the epidermal growth factor receptor increases expression of genes that stimulate inflammation, apoptosis, and cell attachment.Mol Cancer Ther4650658
  51. 51. Nikolaidis NM, Gray JK, Gurusamy D, Fox W, Stuart WD, et al. (2010) Ron receptor tyrosine kinase negatively regulates TNFalpha production in alveolar macrophages by inhibiting NF-kappaB activity and Adam17 production. Shock 33: 197–204.NM NikolaidisJK GrayD. GurusamyW. FoxWD Stuart2010Ron receptor tyrosine kinase negatively regulates TNFalpha production in alveolar macrophages by inhibiting NF-kappaB activity and Adam17 production.Shock33197204
  52. 52. Stark KL, McMahon JA, McMahon AP (1991) FGFR-4, a new member of the fibroblast growth factor receptor family, expressed in the definitive endoderm and skeletal muscle lineages of the mouse. Development 113: 641–651.KL StarkJA McMahonAP McMahon1991FGFR-4, a new member of the fibroblast growth factor receptor family, expressed in the definitive endoderm and skeletal muscle lineages of the mouse.Development113641651
  53. 53. Korhonen J, Partanen J, Alitalo K (1992) Expression of FGFR-4 mRNA in developing mouse tissues. Int J Dev Biol 36: 323–329.J. KorhonenJ. PartanenK. Alitalo1992Expression of FGFR-4 mRNA in developing mouse tissues.Int J Dev Biol36323329
  54. 54. Ho HK, Pok S, Streit S, Ruhe JE, Hart S, et al. (2009) Fibroblast growth factor receptor 4 regulates proliferation, anti-apoptosis and alpha-fetoprotein secretion during hepatocellular carcinoma progression and represents a potential target for therapeutic intervention. J Hepatol 50: 118–127.HK HoS. PokS. StreitJE RuheS. Hart2009Fibroblast growth factor receptor 4 regulates proliferation, anti-apoptosis and alpha-fetoprotein secretion during hepatocellular carcinoma progression and represents a potential target for therapeutic intervention.J Hepatol50118127
  55. 55. Desnoyers LR, Pai R, Ferrando RE, Hotzel K, Le T, et al. (2008) Targeting FGF19 inhibits tumor growth in colon cancer xenograft and FGF19 transgenic hepatocellular carcinoma models. Oncogene 27: 85–97.LR DesnoyersR. PaiRE FerrandoK. HotzelT. Le2008Targeting FGF19 inhibits tumor growth in colon cancer xenograft and FGF19 transgenic hepatocellular carcinoma models.Oncogene278597
  56. 56. Murphy T, Darby S, Mathers ME, Gnanapragasam VJ (2010) Evidence for distinct alterations in the FGF axis in prostate cancer progression to an aggressive clinical phenotype. J Pathol 220: 452–460.T. MurphyS. DarbyME MathersVJ Gnanapragasam2010Evidence for distinct alterations in the FGF axis in prostate cancer progression to an aggressive clinical phenotype.J Pathol220452460
  57. 57. Taylor JGt, Cheuk AT, Tsang PS, Chung JY, Song YK, et al. (2009) Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models. J Clin Invest 119: 3395–3407.JGt TaylorAT CheukPS TsangJY ChungYK Song2009Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models.J Clin Invest11933953407
  58. 58. Roidl A, Foo P, Wong W, Mann C, Bechtold S, et al. (2009) The FGFR4 Y367C mutant is a dominant oncogene in MDA-MB453 breast cancer cells. Oncogene. A. RoidlP. FooW. WongC. MannS. Bechtold2009The FGFR4 Y367C mutant is a dominant oncogene in MDA-MB453 breast cancer cells.Oncogene
  59. 59. Roidl A, Berger HJ, Kumar S, Bange J, Knyazev P, et al. (2009) Resistance to chemotherapy is associated with fibroblast growth factor receptor 4 up-regulation. Clin Cancer Res 15: 2058–2066.A. RoidlHJ BergerS. KumarJ. BangeP. Knyazev2009Resistance to chemotherapy is associated with fibroblast growth factor receptor 4 up-regulation.Clin Cancer Res1520582066
  60. 60. Pai R, Dunlap D, Qing J, Mohtashemi I, Hotzel K, et al. (2008) Inhibition of fibroblast growth factor 19 reduces tumor growth by modulating beta-catenin signaling. Cancer Res 68: 5086–5095.R. PaiD. DunlapJ. QingI. MohtashemiK. Hotzel2008Inhibition of fibroblast growth factor 19 reduces tumor growth by modulating beta-catenin signaling.Cancer Res6850865095
  61. 61. St Bernard R, Zheng L, Liu W, Winer D, Asa SL, et al. (2005) Fibroblast growth factor receptors as molecular targets in thyroid carcinoma. Endocrinology 146: 1145–1153.R. St BernardL. ZhengW. LiuD. WinerSL Asa2005Fibroblast growth factor receptors as molecular targets in thyroid carcinoma.Endocrinology14611451153
  62. 62. Meyer AN, McAndrew CW, Donoghue DJ (2008) Nordihydroguaiaretic acid inhibits an activated fibroblast growth factor receptor 3 mutant and blocks downstream signaling in multiple myeloma cells. Cancer Res 68: 7362–7370.AN MeyerCW McAndrewDJ Donoghue2008Nordihydroguaiaretic acid inhibits an activated fibroblast growth factor receptor 3 mutant and blocks downstream signaling in multiple myeloma cells.Cancer Res6873627370
  63. 63. Kong M, Barnes EA, Ollendorff V, Donoghue DJ (2000) Cyclin F regulates the nuclear localization of cyclin B1 through a cyclin-cyclin interaction. Embo J 19: 1378–1388.M. KongEA BarnesV. OllendorffDJ Donoghue2000Cyclin F regulates the nuclear localization of cyclin B1 through a cyclin-cyclin interaction.Embo J1913781388
  64. 64. McAndrew CW, Gastwirt RF, Meyer AN, Porter LA, Donoghue DJ (2007) Spy1 enhances phosphorylation and degradation of the cell cycle inhibitor p27. Cell Cycle 6: 1937–1945.CW McAndrewRF GastwirtAN MeyerLA PorterDJ Donoghue2007Spy1 enhances phosphorylation and degradation of the cell cycle inhibitor p27.Cell Cycle619371945
  65. 65. Robertson SC, Meyer AN, Hart KC, Galvin BD, Webster MK, et al. (1998) Activating mutations in the extracellular domain of the fibroblast growth factor receptor 2 function by disruption of the disulfide bond in the third immunoglobulin-like domain. Proc Natl Acad Sci U S A 95: 4567–4572.SC RobertsonAN MeyerKC HartBD GalvinMK Webster1998Activating mutations in the extracellular domain of the fibroblast growth factor receptor 2 function by disruption of the disulfide bond in the third immunoglobulin-like domain.Proc Natl Acad Sci U S A9545674572
  66. 66. O'Dea EL, Barken D, Peralta RQ, Tran KT, Werner SL, et al. (2007) A homeostatic model of IkappaB metabolism to control constitutive NF-kappaB activity. Mol Syst Biol 3: 111.EL O'DeaD. BarkenRQ PeraltaKT TranSL Werner2007A homeostatic model of IkappaB metabolism to control constitutive NF-kappaB activity.Mol Syst Biol3111
  67. 67. Hoffmann A, Levchenko A, Scott ML, Baltimore D (2002) The IkappaB-NF-kappaB signaling module: temporal control and selective gene activation. Science 298: 1241–1245.A. HoffmannA. LevchenkoML ScottD. Baltimore2002The IkappaB-NF-kappaB signaling module: temporal control and selective gene activation.Science29812411245