Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Atrial Natriuretic Peptide Regulates Ca2+ Channel in Early Developmental Cardiomyocytes

  • Lin Miao,

    Affiliation National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China

  • Min Wang,

    Affiliation National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China

  • Wen-Xuan Yin,

    Affiliation National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China

  • Qi Yuan,

    Affiliation National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China

  • Ying-Xiao Chen,

    Affiliation National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China

  • Bernd Fleischmann,

    Affiliation Institute of Physiology, University of Bonn, Bonn, Germany

  • Jürgen Hescheler ,

    J.Hescheler@uni-koeln.de (JH); gj28@ibp.ac.cn (GJ)

    Affiliation Institute of Neurophysiology, University of Cologne, Köln, Germany

  • Guangju Ji

    J.Hescheler@uni-koeln.de (JH); gj28@ibp.ac.cn (GJ)

    Affiliation National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China

Atrial Natriuretic Peptide Regulates Ca2+ Channel in Early Developmental Cardiomyocytes

  • Lin Miao, 
  • Min Wang, 
  • Wen-Xuan Yin, 
  • Qi Yuan, 
  • Ying-Xiao Chen, 
  • Bernd Fleischmann, 
  • Jürgen Hescheler, 
  • Guangju Ji
PLOS
x

Abstract

Background

Cardiomyocytes derived from murine embryonic stem (ES) cells possess various membrane currents and signaling cascades link to that of embryonic hearts. The role of atrial natriuretic peptide (ANP) in regulation of membrane potentials and Ca2+ currents has not been investigated in developmental cardiomyocytes.

Methodology/Principal Findings

We investigated the role of ANP in regulating L-type Ca2+ channel current (ICaL) in different developmental stages of cardiomyocytes derived from ES cells. ANP decreased the frequency of action potentials (APs) in early developmental stage (EDS) cardiomyocytes, embryonic bodies (EB) as well as whole embryo hearts. ANP exerted an inhibitory effect on basal ICaL in about 70% EDS cardiomyocytes tested but only in about 30% late developmental stage (LDS) cells. However, after stimulation of ICaL by isoproterenol (ISO) in LDS cells, ANP inhibited the response in about 70% cells. The depression of ICaL induced by ANP was not affected by either Nω, Nitro-L-Arginine methyl ester (L-NAME), a nitric oxide synthetase (NOS) inhibitor, or KT5823, a cGMP-dependent protein kinase (PKG) selective inhibitor, in either EDS and LDS cells; whereas depression of ICaL by ANP was entirely abolished by erythro-9-(2-Hydroxy-3-nonyl) adenine (EHNA), a selective inhibitor of type 2 phosphodiesterase(PDE2) in most cells tested.

Conclusion/Significances

Taken together, these results indicate that ANP induced depression of action potentials and ICaL is due to activation of particulate guanylyl cyclase (GC), cGMP production and cGMP-activation of PDE2 mediated depression of adenosine 3′, 5′–cyclic monophophate (cAMP)–cAMP-dependent protein kinase (PKA) in early cardiomyogenesis.

Introduction

It has long been known that cardiac ICaL is under control of the atrial natriuretic peptide (ANP), a member of class of polypeptides that includes also brain natriuretic peptide (BNP) and C-type natriuretic peptide (CNP) [1], [2]. ANP is known to be ontogenetically expressed very early during development [3] and regulate a variety of physiological processes affecting cardiovascular homeostasis. It is preferentially secreted by atrial myocytes under conditions of tachycardia [2], [4]. The regulation through its receptors -ANPR-A and ANPR-B- which are part of a membrane-bound guanylyl cyclase complex and a clearance receptor (ANPR-C) [5], [6] has attracted much attention among cardiac physiologists. Recent studies demonstrate that the genes for all three natriuretic peptide receptor subtypes are expressed in human heart during development [7] as well as in ES cell derived cardiomyocytes [8]. ANP is known to act through direct stimulation of the particulate guanylyl cyclase/cGMP- as well as through a G protein mediated inhibition of the adenylyl cyclase/cAMP system [9][11]. However, it still remains under debate as to whether and how ANP modulates chronotropy and inotropy of the heart [12]. Several studies reported the negative inotropic effect induced by ANP, related to intracellular production of cGMP, activating PKG and altering Ca2+ channels to decrease intracellular transients [13][15]. However, Lainchbury et al. [16] reported a positive inotropic effect of ANP. ANP is known to depress ICaL, however the mechanism of this modulation is still controversial. Gisbert & Fischmeister [17] reported that ANP decreased β-adrenergic agonist pre-stimulated ICaL and had only a negligible effects on basal ICaL in frog isolated cardiac cells. While, Tohse et al [18] detected inhibition of the basal ICaL by ANP via production of cGMP and activation of PKG in guinea pig cardiomyocytes. An ANP induced decrease of the basal ICaL was also reported for guinea pig [19], rat [20], chick embryos, human atrial and rabbit heart cells [17], [21][23]. Moreover, some authors [24] reported that ANP decreased both basal and cAMP pre-stimulated ICaL in fetal heart cells and increased ICaL in human atrial cells [25]. However, the role of ANP in regulating ICaL in early developmental stages of cardiomyocytes has not been observed.

The embryonic stem cell-derived cardiomyocytes have been demonstrated to be a unique tool for functional studies on early cardiomyogenesis [26], [27]. This model of cardiomyocytes expresses all relevant membrane currents and signaling cascades link to embryonic heart. Previous studies also indicated that nitric oxide (NO) is highly expressed in early developmental stages of cardiomyocytes, and that ICaL was regulated and modulated by muscarinic agonists in cardiomyocytes through NO-dependent pathway [26], [27].

In the present study, we investigated the effects of ANP (rat ANP 3–28) on ICaL in cardiomyocytes derived from mouse ES cells as well as isolated myocytes from mouse embryonic hearts. We found that ANP depressed basal ICaL in early developmental stage and ISO pre-stimulated ICaL in late developmental stage cardiomyocytes. The mechanism by which ANP inhibits ICaL involves activation of the pGC/cGMP pathway, and cGMP-stumulation of PDE2 activity, leading to inhibition of the cAMP/PKA pathway.

Materials and Methods

Cell Culture and ES Cell Differentiation Procedure

The murine embryonic stem cell line D3 was used throughout this study. Cells were cultivated and differentiated into spontaneously beating cardiomyocytes in Dulbecco's modified Eagle's medium (DMEM) (Serva, Heidelberg. Germany) supplemented with non-essential amino acids, L-glutamine, β-mercaptoethanol (GIBCO BRL GmbH, Germany), and 15% fetal calf serum (FCS) (selected batches of GIBCO BRL) [26]. The D3 cell line was originally established by cultivation of a disaggregated single blastomere of an eight-cell stage 129/ter Sv mouse embryo on feeder layer cells in culture medium additionally supplemented with 5000 IU leukemia inhibiting factor(LIF). About 60 drops (20 µl of cultivation medium containing 400 cells) were placed on the lids of 10 cm petri dishes filled with phosphate-buffered saline (PBS) and cultivated for 2 days. Aggregates were then transferred from the hanging drops into 6 cm non-adhesive bacteriological petri dishes containing 5 ml cultivation medium and were further cultivated for 5 days (‘7 d’). The resulting embryoid bodies (EBs) were separately placed into each well of 24 well-microwell plates coated with gelatin. During further development of the attached EBs cells of endodermal, ectodermal and mesodermal origin were obtained in the outgrowths. First spontaneously beating cardiomyocyte clusters appeared one or two day (7+1/2 d) after plating of EBs in the outer region of the EB outgrowth. Single cardiomyocytes were prepared from beating cell clusters by collagenase (see below).

Preparation of Single Cardiomyocytes

Single cardiomyocyte-like cells were isolated at distinct developmental stages: 1) early developmental stage (EDS) when first spontaneously contracting clusters of cardiomyocytes appeared (7+1–4 d); 2) late developmental stage (LDS, 7+9–12 d). The following solutions were used (in mmol/L): a) low Ca2+ medium: NaCl 120, KCl 5.4, MgSO4 5, Na pyruvate 5, glucose 20, taurine 20, HEPES [N-(2-Hydroxyethyl) piperazine-N′-2-ethanesulfonic acid] 10, pH 6.9 at 24°C (adjusted with NaOH); b) enzyme medium: Low Ca2+ medium supplemented with 1 mg/ml collagenase (collagenase B, Boehringer Mannheim) and 30 µmol/L CaCl2; and c) KB medium: KCl 85, K2HPO4 30, MgSO4 5, EGTA 1, Na2ATP 2, Na pyruvate 5, creatine 5, taurine 20, glucose 20, pH 7.2 at 24°C (adjusted with NaOH).

Beating areas of EBs were dissociated using a microscalpel under microscope in a clean air laminar hood. The isolated beating areas were collected and washed in low Ca2+ medium for 30 to 60 min at room temperature. Tissue fragments were then incubated in the enzyme medium for 20 min at 37°C. The dissociation of tissue was completed in KB medium by gentle shaking for 20 min and resting for 40 min at room temperature. The isolated cells were resuspended in cultivation medium supplemented with 20% FCS and plated on sterile, gelatin-coated 12×12 glass cover slips and kept in the incubator for 12 to 24 hours at 37°C and 5% CO2. During the first 12 hours of incubation, the isolated cardiomyocytes attached to the surface of the glass cover slips and started spontaneous rhythmical contractions. Single embryonic cardiomyocytes were isolated as described previously [28]. All animal procedures described in this study were performed in adherence with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996), with approval from the Institute of Biophysics Committee on Animal Care. Electrophysiological and immunofluorescence investigations were performed on these cardiomyocytes.

Electrophysiological Measurements

The whole-cell configuration of the patch-clamp technique was used throughout the study on single cardiomyocytes. The glass cover slips with attached isolated single cardiac myocytes were transferred into the recording chamber and continuously superfused with extracellular solution E1 (table 1) for measurement of action potentials and E2 for the measurement of ICaL (table 1). Membrane potentials were recorded in the current clamp mode and membrane currents in the voltage-clamp mode using an Axopatch 200-B amplifier (Axon Instruments, USA). For measurement of ICaL, voltage-clamped cells were held at −40 mV in order to inactivate the sodium currents, and trains of 20 ms lasting depolarizing pulses were applied to a test potential of 0 mV at a frequency of 0.2 Hz. Membrane capacitance was determined using the acquisition/analysis software program ISO2 (MFK, Frankfurt, RG). Data were acquired at a sampling rate of 10 kHz, stored on hard disk and analyzed off-line.

EB and whole embryonic heart action potentials were monitored with conventional 3 M KCl-filled glass microelectrodes (10–20 MΩ) attached to a VF-1 preamplifier (World Precision Instruments, Sarasota, FL).

Pipettes and Solutions

The solutions used throughout the study are listed in Table 1. The patch pipettes (2–4 MΩ resistance when filled with the internal solution) were pulled from Hilgenberg (FRG) or Clark (England) borosilicate glass capillaries using a Zeitz puller (DMZ, Munich, FRG) and filled with the solution I1 for the measurement of APs. The internal solution I2 was used for the measurement of ICaL. Cs+ (in internal solution) and tetraethylammonium (TEA, in external solution) were used to block most K+ currents and 4-Aminopyridine was added to the extracellular solution to minimize the interference from the transient outward K+ current (Ito). To exclude the possible contamination of ICaL by Na-channel current TTX(10 µM) was added in external solution. The pH of all solutions was adjusted to 7.4 at a temperature of 37°C. Cells were constantly superfused using a gravitational perfusion system, the perfusion rate being approximately 2 ml/min. The chamber volume was 0.5 ml. The temperature of the bath as well as of the perfusion solutions was kept constant at 37°C.

RT-PCR and Immunofluorescence Study of ANP

Single cell preparations of EDS cardiomyocytes isolated from embryo heart were used for the immunocytochemical investigation of ANP and α-MHC staining. Single cell preparations were fixed in 4% paraformaldehyde in 0.1 M PBS for 20 minutes. Fixed samples were washed three times with PBS (pH 7.4). The cells were incubated with 0.1% triton X-100 for 10 min, followed by incubation with α-MHC antibody (goat anti mouse IgG) and ANP antibody (rabbit anti mouse IgG) in 1% BSA PBS for 2 hr and wash three times at room temperature. Thereafter, cell preparations were then indirectly immunolabelled with a dilution 1∶400 α-MHC donkey anti-goat antibody (labeled with Rhodamine Red-X) and ANP bovine anti-rabbit antibody (labeled with FTTC) for one and half hr at room temperature.

RT-PCR was performed by routine methods on embryo cardiomyocytes dissected from different developmental stages, i.e. E8.5d, E12.5 and E15.5 day, using the following specific primers (forward and reverse, respectively):CCTGTGTACAGTGCGGTGTC, AAGCTGTTGCAGCCTAGTCC.

Reagents

ANP(3–28,1–28), Met (o)12-ANP, ATP-γ-S and forskolin were purchased from Sigma; KT5823 and EHNA were from Calbiochem. All other substances used in the study were from Sigma. ANP 3–28 was used throughout the study, indicated,otherwise.

Analysis of Data

Averaged results are presented as mean ± standard error of the mean (SEM). Statistical analysis was performed using paired and unpaired Student's t-test, when more than one experimental condition was evaluated a Bonferroni correction was performed, p values of <0.05 were considered significant. The straight line connecting control amplitude of peak ICaL prior to ANP application and after wash-out was used as an estimate for ICaL run-down. For calculation of the ANP-dependent ICaL depression the control value was defined as the peak current taken on the line in the same time-point as the maximal inhibition of ICaL by ANP. For calculation of basal ICaL stimulation the control ICaL was taken as the reference value. Current densities are expressed as current amplitude divided by cell capacitance (pA/pF). To indicate that the recording of the currents is stable, we also analyzed the holding currents as indicated by black dots at 0 pA for each experiment. From the holding currents we know that the leakage of the currents is very small, so in the present study the leakage subtraction was not carried out. The results are expressed as means ± SEM. Significant differences between groups were determined by the Student's t test.

Results

Expression of ANP in Mouse Embryonic Cardiomyocytes

It has previously been reported that ANP is expressed in cardiomyocytes derived from monkey ES cells [8]. Since nothing was known in mouse embryonic cardiomyocytes, we examined the expression of ANP in this preparation. We first sought to detect the presence of ANP in mouse embryonic cardiomyocytes by double immunofluorescence staining for ANP (green) and α-MHC (red), and the results demonstrated that embryo cardiomyocytes contain ANP in the cytoplasm during all developmental stages (E8.5d, E12.5d, and E15.5d, Fig. 1A). RT-PCR studies also indicated that ANP was expressed at the mRNA level in different developmental stages of mouse embryo heart (Fig. 1B).

thumbnail
Figure 1. Expression of ANP in mouse embryonic cardiomyocytes.

A: double staining of ANP (left, green) and α-MHC (right, red) in E8.5d (a), E12.5d (b), and E15.5d (c) cardiomyocytes. B: PCR product of ANP. Lanes indicate 1 marker, 2 E8.5d, 3 E12.5d, and 4 E15.5d, respectively. The scale bar is 10 micron.

https://doi.org/10.1371/journal.pone.0008847.g001

Effect of ANP on Action Potentials in Early Developmental Stage Cardiomyocytes

First evidence for functional effects of ANP on EDS cells was obtained in current clamp experiments. Fast perfusion of spontaneously contracting cardiomyocytes derived from ES cells with 20 nM ANP [18], [23] resulted in a negative chronotropic effect, without concomitant hyperpolarization and this effect was reversible upon washout (Fig. 2A, upper traces). To unequivocally prove the effect of ANP on APs in ES derived cardiomyocytes, the effect of ANP on APs was also examined in cardiomyocytes isolated from early developmental mouse embryonic hearts (E8.5∼10.5d), and similar results as in ES cell- derived cardiomyocyte were obtained, i.e. a reversible decrease in AP frequency in 16 out of 18 experiments (Fig. 2A, lower traces). The effects of ANP were not only seen in single cells but also in integrated preparations, since ANP had also pronounced inhibitory effects on AP frequency in mouse EDS EBs (Fig. 2B, upper traces) and mouse whole embryo heart (E8.5d, Fig. 2B, lower traces). The negative effect of ANP on APs usually was observed about 20 s after fast perfusion in single cardiomyocytes, EBs, and even in E8.5d mouse heart. If the effects of ANP were not washed the APs could be completely inhibited with the time (Fig. S1B).

thumbnail
Figure 2. Inhibition of spontaneous action potentials by ANP.

A: Action potentials recorded from a spontaneously contracting EDS cell (upper) and an E8.5d cardiomyocyte (lower) in the current clamp mode. The frequency of action potentials was decreased by application of ANP in a reversible manner. B: action potentials recorded from an early developmental stage EB (upper) and an embryonic 8.5 day heart (lower). As seen in single EDS and E8.5d cells, application of ANP exerted a negative chronotropic effect that was washable.

https://doi.org/10.1371/journal.pone.0008847.g002

ANP Inhibits Basal ICaL in EDS Cardiomyocytes Derived from ES Cells

The negative chronotropic effect of ANP indicates that ANP must affect the activity of ion channels. Because ANP did not exhibit any effect on If and Iks (data not shown) we focused our interest on the L-type Ca2+ channel current and examined the effect of ANP on ICaL in cardiomyocytes derived from ES cells. The protocols used to measure ICaL was a 20 ms lasting depolarizing pulse to 0 mV from a holding potential of −40 mV (see Materials and Methods). Fig. 3A shows a typical experiment in which 20 nM ANP 3–28 induced a pronounced inhibition of the peak amplitude of ICaL. On average (Fig. 3D), ANP induced an inhibition of ICaL by 60.3±10.1% (n = 16, p<0.05) after application of ANP in about 70% cells tested (Fig. 3C), which is similar to our previous study (27). The effect of ANP was always reversible upon washout. The effect of ANP was not voltage-dependent, since ANP induced propotional reduction of peak ICaL at all potentials tested (Fig. 3B). Figure S1 shows concentration-response relation between ANP and the ICaL. ANP at concentration above 10 nM decreased the peak current.

thumbnail
Figure 3. ANP depresses basal ICaL in EDS cardiomyocytes.

A, Typical recording of ICaL from a single cell. Upon application of 20 nM ANP, rat 3–28, basal ICaL was decreased. This effect could be partially reversed by washout. The inset represents currents recorded as indicated by the mumbers in the time course diagram. B, I/V relationship: ANP decreased peak ICaL without a shift in the I/V relationship. C, percentage of cells responding to ANP. D, density of peak ICaL.

https://doi.org/10.1371/journal.pone.0008847.g003

It has reported that another type of ANP, ANP 1–28, also has inhibitory effect on ICaL in rabbit heart cells [18]. To examine if this type of ANP has the similar effect on ICaL as ANP 3–28 in our model, equal concentration of ANP1–28 was tested. The results suggested that ANP1–28 (20 nM) had little effect on basal ICaL in EDS cells, but increasing its concentration to 50 nM led to a similar inhibition of ICaL as 20 nM ANP 3–28 (data no shown). As a negative control, the inactive form of ANP, Met (o)12-ANP had no effect on ICaL at concentrations ranging from 10 to 100 nM (data not shown).

In parallel, the effect of ANP on ICaL was also examined in early myocytes isolated from mouse embryo heart (E8.5d). Similarly to EDS cardiomyocytes derived from ES cells, peak ICaL amplitude was reduced by 65.4±8.6% by ANP in embryo heart cells tested (data not shown, n = 16).

ANP Inhibits ISO Pre-Stimulated ICaL in LDS Cardiomyocytes

Next we tested whether ANP also regulated ICaL in LDS cardiomyocytes. Although ANP also decreased basal ICaL in LDS cells (Fig. 4Aa), the effect was much less frequent as compared to EDS cardiomyocytes, with only about 34% cells (n = 22) which responded to the peptide (Fig. 4Ab). However, when ICaL was pre-stimulated by ISO (100 nM), adding ANP on top of ISO induced a pronounced inhibition of ICaL (Fig. 4Ba) which occurred in about 70% cells (Fig. 4Bb) and averaged 58.6±18.6% inhibition (n = 8, Fig. 4Bc). This effect was reversible in most of cells upon washout (Fig. 4Ba & c).Thus, our data indicate that ANP also regulates ICaL in LDS cells, but, unlike the EDS cells, its effect requires, or at least is more prominent after a pre-stimulation of the current by β-adrenergic receptor.

thumbnail
Figure 4. Effect of ANP on basal and ISO stimulated ICaL in LDS cells.

Aa & Ba, time courses of peak ICaL recorded from single LDS cells. Both basal and ISO pre-stimulated ICaL were strongly depressed by application of ANP. Ab & Bb, percentage of cells responding to ANP. Note that the percentage of responding cell in EDS is much lower compared to LDS cells. Ac & Bc, current density of peak ICaL. *P<0.05, **P<0.01 compared with control, respectively.

https://doi.org/10.1371/journal.pone.0008847.g004

ATP-γ-S Plus Forskolin Block the Depression of ANP on ICaL in EDS Cardiomyocytes

The above results are reminiscent of the effect of the muscarinic agonist carbachol (CCh), which was reported in our earlier study to inhibit basal ICaL in EDS cells but required ISO pre-stimulation of ICaL to produce its inhibitory effect in LDS cells [27]. One possible difference between EDS and LDS cells is the higher intrinsic activation of the cAMP/PKA pathway in the former [27], pointing to a possible action of ANP on this pathway. In order to test this hypothesis, the effect of ANP was examined on EDS cells after pre-stimulation with the adenylyl cyclase activator forskolin (1 µM in bath solution) or ISO, and in the absence or presence of 2 mM ATP-γ-S in the patch pipette solution to block dephosphorylation. As shown in Fig. 5Aa, ANP decreased ICaL stimulated by forskolin, but had no effect when ATP-γ-S was present in the patch-pipette (Fig. 5Ba). On average, the stimulatory effect of forskolin was not different in the absence (61.4±7.4%, n = 8) and presence of ATP-γ-S (63.6±8.6%, n = 12), but the effect was irreversible upon washout in the latter case. However, the effect of ANP on pre-stimulated ICaL was abolished in almost all cells tested, suggesting that the effect of ANP on ICaL was via inhibition of the cAMP/PKA axis.

thumbnail
Figure 5. Effect of ATP-γ-S plus forskolin on ANP induced ICaL inhibition.

Aa, time course shows that ANP depressed forskolin pre-stimulated ICaL, however the depressed effect of ANP on forskolin pre-stimulated ICaL was abolished in the presence of ATP-γ-S (Ba). The insets are traces recorded in the same cells as time courses. Ab & Bb, percentage of cells with or without responding to ANP. Ac & Bc, density of peak ICaL. *P<0.05 compared with control.

https://doi.org/10.1371/journal.pone.0008847.g005

Role of Gi/o Proteins in the ANP-Mediated Inhibition of ICaL

Since ANP blocks the cAMP/PKA pathway, its effect could be either through an inhibition of adenylyl cyclase via activation of pertussis toxin (PTX)-sensitive Gi/o proteins [29][31], or through cGMP generated by activation of the particulate GC. To test the former hypothesis, EDS cells were incubated with 1 µg/ml PTX for 12 hours. Under this condition, application of ANP still depressed ICaL in 50% of both EDS (Fig. 6Aa and b) and LDS (data not shown) cells. Thus, the depression of ICaL by ANP was not related to PTX sensitive Gi/or Go proteins. Fig. 6B shows a positive control for PTX in LDS cells.

thumbnail
Figure 6. PTX did not abolish ANP induced ICaL inhibition.

Aa, time course demonstrates that in PTX pre-treated cardiomyocytes derived from ES cells ANP still inhibited ICaL. Ba, time course of PTX positive control experiment which indicates PTX abolished CCh caused inhibition on ICaL. Ab and Bb,percentage of cells with or without responding to ANP(Ab) or CCh (Bb). Ac and Bc, density of peak ICaL. *P<0.05 compared with control.

https://doi.org/10.1371/journal.pone.0008847.g006

Role of cGMP-Activated PDE2 in the Inhibitory Effect of ANP on ICaL in EDS Cardiomyocytes

As shown earlier [27], the NO/soluble GC pathway is not involved in the inhibition of basal ICaL in mouse EDS cells. However, since the ANP receptor activates the particulate GC, cGMP is a good candidate to mediate the inhibitory effect of ANP on basal ICa,L. cGMP could inhibit ICaL via either cGMP-dependent protein kinase (PKG) [32] or via activation of cAMP hydrolysis via stimulation of the cGMP-stimulated PDE2 [20], [33]. To discriminate between these two hypothesis, the effect of ANP on ICaL was tested in the presence of the PKG inhibitor KT5823 or the PDE2 inhibitor EHNA. As shown in Figure 7A, KT5823 (1 µM) did not eliminate the effect of ANP in EDS cells tested. Conversely, EHNA (20 µM), which as shown earlier [27] increased the basal ICaL (by 22.1±3.3%), blocked the ANP inhibitory effect on basal ICaL in 94% of EDS cells tested (see also Fig. 7Ba, Bb, and Bc). Unlike EHNA, the PDE3 inhibitor milrinone (10 µM) did not block the inhibitory effect of ANP (20 nM), which still decreased ICaL by 49.4±9.4% (data not shown). Taken together, these findings suggest that the decrease of ICaL by ANP is mediated through an increase of cGMP levels, thereafter activation of cGMP-stimulated PDE2, enhancement of cAMP breakdown, decrease of PKA levels, and ultimately reduced phosphorylation of voltage dependent Ca2+ channels (VDCC) or a closely associated protein.

thumbnail
Figure 7. PDE2-cAMP-PKA pathway of ANP depression on ICaL.

A, time course of ICaL (a) shows ANP still inhibits the current in KT5823, a PKG selective inhibitor, pre-treated myocytes in about 70% cells tested (b); Ac, density of peak ICaL. B, time course (a) demonstrates that ANP fails to depress ICaL in the presence of EHNA, a PDE2 selective inhibitor, in almost all cells tested (b). Bc, density of peak ICaL. *P<0.05 compared with control.

https://doi.org/10.1371/journal.pone.0008847.g007

In order to prove that the effect of ANP on ICaL is mediated by cGMP we examined the effect of 8-bromo-cGMP on ICaL in early developmental cardiomyocytes derived from ES cells as well. As displayed in figure S2, upon application of 200 µM 8-bromo-cGMP led to a significant suppression of the L-type Ca2+ current and this effect of 8-bromo-cGMP was abolished by pre-treatment of the cells with EHNA. The experimental results of 8-bromo-cGMP confirmed that the depression of ANP on ICaL was mediated by cGMP in early developmental cardiomyocytes.

Discussion

Here, we report that ANP (3–28) exerts negative chronotropic effect without hyperpolarization in EDS cardiomyocytes derived from ES cells, EDS EB as well as the whole embryo heart. This is probably mediated by a depression of the basal ICaL in EDS cardiomyocytes and in β-receptor pre-stimulated ICaL in LDS cardiomyocytes because ANP did not exhibit any effect on both If and IKs currents in the present study (data not shown). From the time course of ANP action on ICaL and APs we noted that when the ICaL was reduced by about 30% of maximal effect by ANP the negative chronotropic effect occurred, and when the reduction of the ICaL reached the maximum the APs were completely inhibited in almost all experiments conducted if washout was not followed (Fig. S1B). ANP depressed ICaL without an effect on the I/V relationship, indicating that the degree of ICaL inhibition was proportional at all potentials, and that the depressing effect of ANP on ICaL was completely abolished by clamping cAMP or PKA levels which suggests that ANP is only acting through activation of the cGMP stimulated PDE2. Indeed, EHNA, the selective PDE2 inhibitor, resulted in a complete abolishment of ANP action on ICaL implying that the inhibitory effect of ANP was through the cGMP/PDE2/cAMP pathway (Fig. 7B), and this was further proved by the results of 8-bromo-cGMP (supplemental Fig. S2). In the presence of L-NAME as well as of 1H-(1,2,4)oxadiazolo(4,3-a)quinoxalin-1-one (ODQ) [27], however, ANP-still decreased ICaL excluding a role of NO or sGC.

The evidence that ANP has a direct effect on ICaL in the heart is controversial. Most studies suggest that ANP has a direct effect only in the SA node in isolated atrial tissue preparations [12], [18], [34], [35]. Other reports support the notion that ANP has no direct effect on action potential duration (APD) or contractility of isolated guinea pig ventricular papillary muscle [36][38]. While ANP may not have a direct negative chronotropic effect, the receptor linkage to the guanylyl cyclase in rabbit atrium [39], rabbit [40] and rat ventricle [41], [42], as well as rabbit Purkinje fibers [43], [44] has been proven. Moreover, ANP receptor stimulation results in an increase of intracellular cGMP and thereafter a decrease of cAMP levels [14]. These findings are well in line with our results where the ANP effect in EDS cells was fully mediated by a PDE-II mediated decrease of cAMP levels. The negative chronotropic effect of ANP is in agreement with results reported by Favaretto-AL and co-workers [45].

ANP has been demonstrated to exert an effect on both basal ICaL as well as pre-stimulated ICaL. In human atrial cells, 10 nM ANP reduces ICaL [12] which suggests that ANP-induced inhibition of ICaL was via a cGMP-dependent mechanism [19]. Similar results have been found in chicken embryonic myocytes [46] and in rabbit ventricular cells. Both cell types are characterized by high intrinsic adenylyl cyclase activities. In rabbit ventricular cells, ANP also produced a concentration-dependent decrease of basal ICaL. This effect was blocked upon application of 8-bromo-cGMP, a non-metabolizable analog of cGMP. Single channel recordings revealed that ANP reduces the open probability of Ca2+ channel without affecting the unitary conductance [18]. The catecholamine-stimulated ICaL was also attenuated by ANP. In human cardiomyocytes, ANP reduced ISO-stimulated ICaL by 25% through a cGMP-dependent mechanism [23]. Gisbert and Fischmeister [17] demonstrated that ICaL was also inhibited by ANP in single frog ventricular myocytes. They suggested that ANP had a direct G-protein mediated effect on AC. However, we here demonstrate at least for the EDS cells that ANP action is still preserved in PTX incubated cells, but abolished after clamping cAMP levels.

It is known that ANP exerts its physiological and pathological role via an increase of cellular cGMP levels [18] due to specific activation of the particulate guanylyl cyclase [5]. Our previous data of ODQ as well as MB excluded an involvement of the soluble guanylyl-cyclase [27]. An involvement of PKG in the ANP-mediated depression of ICaL was excluded for ES cell-derived cardiomyocytes since in the presence of KT5823, a PKG selective inhibitor, ANP still inhibited the ICaL (Fig. 7A), and clamping of cAMP-PKA levels abolished ICaL depression. This is in clear contrast to a report [18], where ANP decreased basal ICaL through intracellular production of cGMP and activation of PKG in rabbit heart cells. Thus, we show that the depression of ANP on ICaL is through the particulate GC, cGMP and PDE2 mediated depression of cAMP-PKA.

It has previously reported that another fragment of ANP, ANP1–28, also possesses inhibitory effect on ICaL in rabbit heart cells [18]. In the present study we also examined this fragment in our models, and the results suggested that the inhibitory effect of ANP1–28 on ICaL was weaker compared to that of ANP3–28. The reason for the discrepancy between 3–28 ANP and 1–28 ANP was unclear though the model difference might be one possible reason.

In conclusion, ANP depresses ICaL via pGC/cGMP and PDE2 mediated cAMP/PKA breakdown pathway in early developmental cardiomyocytes.

Supporting Information

Figure S1.

Dose-response and inhibition of ANP on action potentials. A, concentration-response relation between ANP and the decrease in Ca2+ current. B, action potentials were almost completely inhibited by ANP (20 nM) if washout not followed. Data are mean ± s.e. mean. *P<0.05, **P<0.01.

https://doi.org/10.1371/journal.pone.0008847.s001

(0.92 MB TIF)

Figure S2.

Effects of 8-Bromo-cGMP on L-type Ca2+ current in EDS cardiomyocytes. Time course of ICaL demonstrates that 8-Bromo-cGMP (200 µM) depresses ICaL (A), and the effect of 8-Bromo-cGMP on ICaL is abolished by pre-treatment of the cells with EHNA, a specific inhibitor of PDE2 (B). C, percentage of cells responding to 8-Bromo-cGMP. D, density of peak ICaL. **P<0.01 compared with control.

https://doi.org/10.1371/journal.pone.0008847.s002

(0.70 MB TIF)

Acknowledgments

We thank Dr. Fischmeister (Directeur de Recherche INSERM) for critical reading of the manuscript.

Author Contributions

Conceived and designed the experiments: BKF JH GJ. Performed the experiments: LM MW WXY QY YXC BKF. Analyzed the data: LM MW WXY. Wrote the paper: GJ.

References

  1. 1. Nilius B, Boldt W, Benndorf K (1986) Properties of aconitine-modified sodium channels in single cells of mouse ventricular myocardium. Gen Physiol Biophys 5: 473–484.B. NiliusW. BoldtK. Benndorf1986Properties of aconitine-modified sodium channels in single cells of mouse ventricular myocardium.Gen Physiol Biophys5473484
  2. 2. Kohya T, Tomita F, Itoh K, Suzuki Y, Kawabata N, et al. (1989) Silent myocardial ischemia during Holter monitoring in ischemic heart disease. Jpn Circ J 53: 1399–1406.T. KohyaF. TomitaK. ItohY. SuzukiN. Kawabata1989Silent myocardial ischemia during Holter monitoring in ischemic heart disease.Jpn Circ J5313991406
  3. 3. Semmekort B, Guignard JP (1991) Atrial natriuretic peptide during early human development. Biol Neonate 60: 341–349.B. SemmekortJP Guignard1991Atrial natriuretic peptide during early human development.Biol Neonate60341349
  4. 4. Brenner BM, Ballermann BJ, Gunning ME, Zeidel ML (1990) Diverse biological actions of atrial natriuretic peptide. Physiol Rev 70: 665–699.BM BrennerBJ BallermannME GunningML Zeidel1990Diverse biological actions of atrial natriuretic peptide.Physiol Rev70665699
  5. 5. Chinkers M, Garbers DL, Chang MS, Lowe DG, Chin HM, et al. (1989) A membrane form of guanylate cyclase is an atrial natriuretic peptide receptor. Nature 338: 78–83.M. ChinkersDL GarbersMS ChangDG LoweHM Chin1989A membrane form of guanylate cyclase is an atrial natriuretic peptide receptor.Nature3387883
  6. 6. Schulz S, Singh S, Bellet RA, Singh G, Tubb DJ, et al. (1989) The primary structure of a plasma membrane guanylate cyclase demonstrates diversity within this new receptor family. Cell 58: 1155–1162.S. SchulzS. SinghRA BelletG. SinghDJ Tubb1989The primary structure of a plasma membrane guanylate cyclase demonstrates diversity within this new receptor family.Cell5811551162
  7. 7. Anand-Srivastava MB, Trachte GJ (1993) Atrial natriuretic factor receptors and signal transduction mechanisms. Pharmacol Rev 45: 455–497.MB Anand-SrivastavaGJ Trachte1993Atrial natriuretic factor receptors and signal transduction mechanisms.Pharmacol Rev45455497
  8. 8. Abdelalim EM, Takada T, Toyoda F, Omatsu-Kanbe M, Malsuura H, et al. (2006) In vitro expression of natriuretic peptides in cardiomyocytes differentiated from monkey embryonic stem cells. Biochemical and Biophysical Research Communications 340: 689–695.EM AbdelalimT. TakadaF. ToyodaM. Omatsu-KanbeH. Malsuura2006In vitro expression of natriuretic peptides in cardiomyocytes differentiated from monkey embryonic stem cells.Biochemical and Biophysical Research Communications340689695
  9. 9. Lin X, Hanze J, Heese F, Sodmann R, Lang RE (1995) Gene expression of natriuretic peptide receptors in myocardial cells. Circ Res 77: 750–758.X. LinJ. HanzeF. HeeseR. SodmannRE Lang1995Gene expression of natriuretic peptide receptors in myocardial cells.Circ Res77750758
  10. 10. Anand-Srivastava MB, Trachte GJ (1993) Atrial natriuretic factor receptors and signal transduction mechanisms. Pharmacol Rev 45: 455–497.MB Anand-SrivastavaGJ Trachte1993Atrial natriuretic factor receptors and signal transduction mechanisms.Pharmacol Rev45455497
  11. 11. Anand-Srivastava MB (1993) Differential regulation of ANF-R2 receptors coupled to adenylyl cyclase in cardiovascular tissues in hypertension. Am J Hypertens 6: 538–541.MB Anand-Srivastava1993Differential regulation of ANF-R2 receptors coupled to adenylyl cyclase in cardiovascular tissues in hypertension.Am J Hypertens6538541
  12. 12. Clemo HF, Baumgarten CM, Ellenbogen KA, Stambler BS (1996) Atrial natriuretic peptide and cardiac electrophysiology: autonomic and direct effects. J Cardiovasc Electrophysiol 7: 149–162.HF ClemoCM BaumgartenKA EllenbogenBS Stambler1996Atrial natriuretic peptide and cardiac electrophysiology: autonomic and direct effects.J Cardiovasc Electrophysiol7149162
  13. 13. McCall D, Fried TA (1990) Effect of atriopeptin II on Ca influx, contractile behavior and cyclic nucleotide content of cultured neonatal rat myocardial cell. J Mol Cell Cardiol 22: 01–212.D. McCallTA Fried1990Effect of atriopeptin II on Ca influx, contractile behavior and cyclic nucleotide content of cultured neonatal rat myocardial cell.J Mol Cell Cardiol2201212
  14. 14. Tajima M, Bartunek J, Weinberg EO, Ito N, Lorel lBH (1998) Atrial natriuretic peptide has different effects on contractility and intracellular PH in normal and hypertrophied myocytes from pressure-overloaded hearts. Circulation 98: 2760–2764.M. TajimaJ. BartunekEO WeinbergN. ItolBH Lorel1998Atrial natriuretic peptide has different effects on contractility and intracellular PH in normal and hypertrophied myocytes from pressure-overloaded hearts.Circulation9827602764
  15. 15. Doyle DD, Ambler SK, Upshaw-Earley J, Bastawrous A, Goings GE, et al. (1997) Type B atrial natriuretic peptide preceptor in cardiac myocytes caveolae. Circ Res 81: 86–91.DD DoyleSK AmblerJ. Upshaw-EarleyA. BastawrousGE Goings1997Type B atrial natriuretic peptide preceptor in cardiac myocytes caveolae.Circ Res818691
  16. 16. Lainchbury JG, Meyer DM, Jougasaki M, Burnett JC Jr, Redfield MM (2000) Effects of natriuretic peptides on load and myocardial function in normal and heart failure dogs. Am J Physiol Heart Circ Physiol 278: H33–H40.JG LainchburyDM MeyerM. JougasakiJC Burnett JrMM Redfield2000Effects of natriuretic peptides on load and myocardial function in normal and heart failure dogs.Am J Physiol Heart Circ Physiol278H33H40
  17. 17. Gisbert MP, Fischmeister R (1988) Atrial natriuretic factor regulates the calcium current in frog isolated cardiac cells. Circ Res 62: 660–667.MP GisbertR. Fischmeister1988Atrial natriuretic factor regulates the calcium current in frog isolated cardiac cells.Circ Res62660667
  18. 18. Tohse N, Nakaya H, Takeda Y, Kanno M (1995) Cyclic GMP-mediated inhibition of L-type Ca2+ channel activity by human natriuretic peptide in rabbit heart cells. Br J Pharmacol 114: 1076–1082.N. TohseH. NakayaY. TakedaM. Kanno1995Cyclic GMP-mediated inhibition of L-type Ca2+ channel activity by human natriuretic peptide in rabbit heart cells.Br J Pharmacol11410761082
  19. 19. Levi RC, Alloatti G, Fischmeister R (1989) Cyclic GMP regulates the Ca-channel current in guinea pig ventricular myocytes. Pflugers Arch 413: 685–687.RC LeviG. AlloattiR. Fischmeister1989Cyclic GMP regulates the Ca-channel current in guinea pig ventricular myocytes.Pflugers Arch413685687
  20. 20. Mery PF, Pavoine C, Belhassen L, Pecker F, Fischmeister R (1993) Nitric oxide regulates cardiac Ca2+ current. Involvement of cGMP- inhibited and cGMP-stimulated phosphodiesterases through guanylyl cyclase activation. J Biol Chem 268: 26286–26295.PF MeryC. PavoineL. BelhassenF. PeckerR. Fischmeister1993Nitric oxide regulates cardiac Ca2+ current. Involvement of cGMP- inhibited and cGMP-stimulated phosphodiesterases through guanylyl cyclase activation.J Biol Chem2682628626295
  21. 21. Ono K, Trautwein W (1991) Potentiation by cyclic GMP of beta-adrenergic effect on Ca2+ current in guinea-pig ventricular cells. J Physiol Lond 443: 387–404.K. OnoW. Trautwein1991Potentiation by cyclic GMP of beta-adrenergic effect on Ca2+ current in guinea-pig ventricular cells.J Physiol Lond443387404
  22. 22. Zongazo MA, Carayon A, Masson F, Isnard R, Eurin J, et al. (1992) Atrial natriuretic peptide during water deprivation or hemorrhage in rats. Relationship with arginine vasopressin and osmolarity. J Physiol Paris 86: 167–175.MA ZongazoA. CarayonF. MassonR. IsnardJ. Eurin1992Atrial natriuretic peptide during water deprivation or hemorrhage in rats. Relationship with arginine vasopressin and osmolarity.J Physiol Paris86167175
  23. 23. Le Grand B, Deroubaix E, Couetil JP, Coraboeuf E (1992) Effects of atrionatriuretic factor on Ca2+ current and Cai-independent transient outward K+ current in human atrial cells. Pflugers Arch 421: 486–491.B. Le GrandE. DeroubaixJP CouetilE. Coraboeuf1992Effects of atrionatriuretic factor on Ca2+ current and Cai-independent transient outward K+ current in human atrial cells.Pflugers Arch421486491
  24. 24. Han R, Li Y, Szabo G, Fischmeister R (1993) Agonist-independent effects of muscarinic antagonists on Ca2+ and K+ currents in frog and rat cardiac cells. J Physiol Lond 461: 743–765.R. HanY. LiG. SzaboR. Fischmeister1993Agonist-independent effects of muscarinic antagonists on Ca2+ and K+ currents in frog and rat cardiac cells.J Physiol Lond461743765
  25. 25. Le Grand B, Deroubaix E, Couetil JP, Coraboeuf E (1992) Effects of atrionatriuretic factor on Ca2+ current and Cai-independent transient outward K+ current in human atrial cells. Pflugers Arch 421: 486–491.B. Le GrandE. DeroubaixJP CouetilE. Coraboeuf1992Effects of atrionatriuretic factor on Ca2+ current and Cai-independent transient outward K+ current in human atrial cells.Pflugers Arch421486491
  26. 26. Hescheler J, Fleischmann BK, Lentini S, Bloch W, Ji G, et al. (1997) Embryonic stem cells: a model to study structural and functional properties in cardiomyogenesis. Cardiovasc Res (36): 149–162.J. HeschelerBK FleischmannS. LentiniW. BlochG. Ji1997Embryonic stem cells: a model to study structural and functional properties in cardiomyogenesis.Cardiovasc Res(36)149162
  27. 27. Ji GJ, Fleischmann BK, Bloch W, Feelisch M, Andressen C, et al. (1999) Regulation of the L-type Ca2+ channel during cardiomyogenesis: switch from NO to adenylyl cyclase-mediated inhibition. FASEB Journal 13: 313–324.GJ JiBK FleischmannW. BlochM. FeelischC. Andressen1999Regulation of the L-type Ca2+ channel during cardiomyogenesis: switch from NO to adenylyl cyclase-mediated inhibition.FASEB Journal13313324
  28. 28. Maln D, Ji GJ, Schmidt A, Addicks K, Hescheler J, et al. (2004) Nitric Oxide, a key signaling molecule in the murine early embryonic heart. FASEB J 18(10): 1108–10.D. MalnGJ JiA. SchmidtK. AddicksJ. Hescheler2004Nitric Oxide, a key signaling molecule in the murine early embryonic heart.FASEB J18(10)110810
  29. 29. Resink THJ, Panchenko MP, Tkachuk VA, Bühler FR (1988) Involvement of Ni protein in the functional coupling of the atrial natriuretic factor (ANF) receptor to adenylate cyclase in rat lung plasma membranes. Eur J Biochem 174: 531–535.THJ ResinkMP PanchenkoVA TkachukFR Bühler1988Involvement of Ni protein in the functional coupling of the atrial natriuretic factor (ANF) receptor to adenylate cyclase in rat lung plasma membranes.Eur J Biochem174531535
  30. 30. Savoie P, Dechamplain J, Anandsrivastava MB (1995) C-type natriuretic peptide and brain natriuretic peptide inhibit adenylyl cyclase activity: Interaction with ANF-R2/ANP-C receptors. FEBS Lett 370: 06–10.P. SavoieJ. DechamplainMB Anandsrivastava1995C-type natriuretic peptide and brain natriuretic peptide inhibit adenylyl cyclase activity: Interaction with ANF-R2/ANP-C receptors.FEBS Lett3700610
  31. 31. Pedram A, Razandi M, Kehrl J, Levin ER (2000) Natriuretic peptides inhibit G protein activation - Mediation through cross-talk between cyclic GMP-dependent protein kinase and regulators of G protein-signaling proteins. J Biol Chem 275: 7365–7372.A. PedramM. RazandiJ. KehrlER Levin2000Natriuretic peptides inhibit G protein activation - Mediation through cross-talk between cyclic GMP-dependent protein kinase and regulators of G protein-signaling proteins.J Biol Chem27573657372
  32. 32. Méry PF, Lohmann SM, Walter U, Fischmeister R (1991) Ca2+ current is regulated by cyclic GMP-dependent protein kinase in mammalian cardiac myocytes. Proc Natl Acad Sci USA 88: 1197–1201.PF MérySM LohmannU. WalterR. Fischmeister1991Ca2+ current is regulated by cyclic GMP-dependent protein kinase in mammalian cardiac myocytes.Proc Natl Acad Sci USA8811971201
  33. 33. Fischmeister R, Castro L, Abi-Gerges A, Rochais F, Vandecasteele G (2005) Species- and tissue-dependent effects of NO and cyclic GMP on cardiac ion channels. Comp Biochem Physiol A Mol Integr Physiol 142: 136–143.R. FischmeisterL. CastroA. Abi-GergesF. RochaisG. Vandecasteele2005Species- and tissue-dependent effects of NO and cyclic GMP on cardiac ion channels.Comp Biochem Physiol A Mol Integr Physiol142136143
  34. 34. Yoshida T, Niwano S, Niwano H, Imaki R, Satoh D, et al. (2008) Atrial natriuretic peptide (ANP) suppresses acute atrial electrical remodeling in the canine rapid atrial stimulation model. Int J Cardiol 123(2): 147–54.T. YoshidaS. NiwanoH. NiwanoR. ImakiD. Satoh2008Atrial natriuretic peptide (ANP) suppresses acute atrial electrical remodeling in the canine rapid atrial stimulation model.Int J Cardiol123(2)14754
  35. 35. Bkaily G, Perron Nk, Wang S, Sculptoreanu A, Jacques D, et al. (1993) Atrial natriuretic peptide factor blocks the high-threshold Ca2+ current and increases K+ current in fetal single ventricular cells. J Mol Cell Cardiol 25: 1305–1316.G. BkailyNk PerronS. WangA. SculptoreanuD. Jacques1993Atrial natriuretic peptide factor blocks the high-threshold Ca2+ current and increases K+ current in fetal single ventricular cells.J Mol Cell Cardiol2513051316
  36. 36. Hiwatari M, Satoh K, Angus JA, Johnston CI (1986) No effect of atrial natriuretic factor on cardiac rate, force and transmitter release. Clin Exp Pharmacol Physiol 13: 163–8.M. HiwatariK. SatohJA AngusCI Johnston1986No effect of atrial natriuretic factor on cardiac rate, force and transmitter release.Clin Exp Pharmacol Physiol131638
  37. 37. Semigran MJ, Aroney CN, Hermann HC, Dec GW, Boucher CA, et al. (1992) Effects of atrial natriuretic peptide on myocardial contractile and diastolic function in patients with heart failure. J Am Coll Cardiol 20: 98–106.MJ SemigranCN AroneyHC HermannGW DecCA Boucher1992Effects of atrial natriuretic peptide on myocardial contractile and diastolic function in patients with heart failure.J Am Coll Cardiol2098106
  38. 38. Sheets MF, Hanck DA (1991) Atronatriuretic peptide and calcium-conducting sodium channels. Science 252: 449–452.MF SheetsDA Hanck1991Atronatriuretic peptide and calcium-conducting sodium channels.Science252449452
  39. 39. Baumgarten CM, Dudley SC Jr, Rogart RB, Fozzard HA (1995) Unitary conductance of Na+ channel isoforms in cardiac and nb2a neuroblastoma cells. Am J Physiol 269: C1356–63.CM BaumgartenSC Dudley JrRB RogartHA Fozzard1995Unitary conductance of Na+ channel isoforms in cardiac and nb2a neuroblastoma cells.Am J Physiol269C135663
  40. 40. Clemo HF, Feher JJ, Baumgarten CM (1992) Modulation of rabbit ventricular cell volume and Na+/K+/2Cl− cotransport by cGMP and atrial natriuretic factor. J Gen Physiol 100: 89–114.HF ClemoJJ FeherCM Baumgarten1992Modulation of rabbit ventricular cell volume and Na+/K+/2Cl− cotransport by cGMP and atrial natriuretic factor.J Gen Physiol10089114
  41. 41. Rugg EL, Aiton JF, Cramb G (1989) Atrial natriuretic peptide receptors and activation of guanylate cyclase in rat cardiac sarcolemma. Biochem Biophys Res Commun 162: 1339–1345.EL RuggJF AitonG. Cramb1989Atrial natriuretic peptide receptors and activation of guanylate cyclase in rat cardiac sarcolemma.Biochem Biophys Res Commun16213391345
  42. 42. Gaposchkin CG, Tornheim K, Sussman I, Ruderman NB, McCall AL (1990) Glucose is required to maintain ATP/ADP ratio of isolated bovine cerebral microvessels. Am J Physiol 258: E543–7.CG GaposchkinK. TornheimI. SussmanNB RudermanAL McCall1990Glucose is required to maintain ATP/ADP ratio of isolated bovine cerebral microvessels.Am J Physiol258E5437
  43. 43. Kirstein M, Rivet Bastide M, Hatem S, Benardeau A, Mercadier JJ, et al. (1995) Nitric oxide regulates the calcium current in isolated human atrial myocytes. J Clin Invest 95: 794–802.M. KirsteinM. Rivet BastideS. HatemA. BenardeauJJ Mercadier1995Nitric oxide regulates the calcium current in isolated human atrial myocytes.J Clin Invest95794802
  44. 44. McCall D, Fried TA (1990) Effect of atriopeptin II on Ca influx, contractile behavior and cyclic nucleotide content of cultured neonatal rat myocardial cells. J Mol Cell Cardiol 22: 201–212.D. McCallTA Fried1990Effect of atriopeptin II on Ca influx, contractile behavior and cyclic nucleotide content of cultured neonatal rat myocardial cells.J Mol Cell Cardiol22201212
  45. 45. Favaretto AL, Ballejo GO, Albuquerque-Araujo WI, Gutkowska J (1997) Antunes-Oxytocin releases atrial natriuretic peptide from rat atria in vitro that exerts negative inotropic and chronotropic action. Peptides 18: 1377–1381.AL FavarettoGO BallejoWI Albuquerque-AraujoJ. Gutkowska1997Antunes-Oxytocin releases atrial natriuretic peptide from rat atria in vitro that exerts negative inotropic and chronotropic action.Peptides1813771381
  46. 46. Zhou Z, Lipsius SL (1992) Properties of the pacemaker current (If) in latent pacemaker cells isolated from cat right atrium. J Physiol (Lond) 453: 503–523.Z. ZhouSL Lipsius1992Properties of the pacemaker current (If) in latent pacemaker cells isolated from cat right atrium.J Physiol (Lond)453503523