Browse Subject Areas

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Chlamydia pneumoniae Hides inside Apoptotic Neutrophils to Silently Infect and Propagate in Macrophages

Chlamydia pneumoniae Hides inside Apoptotic Neutrophils to Silently Infect and Propagate in Macrophages

  • Jan Rupp, 
  • Lisa Pfleiderer, 
  • Christiane Jugert, 
  • Sonja Moeller, 
  • Matthias Klinger, 
  • Klaus Dalhoff, 
  • Werner Solbach, 
  • Steffen Stenger, 
  • Tamas Laskay, 
  • Ger van Zandbergen



Intracellular pathogens have developed elaborate strategies for silent infection of preferred host cells. Chlamydia pneumoniae is a common pathogen in acute infections of the respiratory tract (e.g. pneumonia) and associated with chronic lung sequelae in adults and children. Within the lung, alveolar macrophages and polymorph nuclear neutrophils (PMN) are the first line of defense against bacteria, but also preferred host phagocytes of chlamydiae.

Methodology/Principal Findings

We could show that C. pneumoniae easily infect and hide inside neutrophil granulocytes until these cells become apoptotic and are subsequently taken up by macrophages. C. pneumoniae infection of macrophages via apoptotic PMN results in enhanced replicative activity of chlamydiae when compared to direct infection of macrophages, which results in persistence of the pathogen. Inhibition of the apoptotic recognition of C. pneumoniae infected PMN using PS- masking Annexin A5 significantly lowered the transmission of chlamydial infection to macrophages. Transfer of apoptotic C. pneumoniae infected PMN to macrophages resulted in an increased TGF-ß production, whereas direct infection of macrophages with chlamydiae was characterized by an enhanced TNF-α response.


Taken together, our data suggest that C. pneumoniae uses neutrophil granulocytes to be silently taken up by long-lived macrophages, which allows for efficient propagation and immune protection within the human host.


Chlamydia pneumoniae is an obligate intracellular pathogen that enters the human body after respiratory infection. Infection activates airway epithelial cells resulting in a rapid recruitment of polymorph nuclear neutrophil granulocytes (PMN) [1], [2]. Consequently, in the lung, PMN are among the first leukocytes to encounter C. pneumoniae [3]. Importantly, phagocytosed C. pneumoniae are not killed; the ingested bacteria survive and multiply within PMN [4]. During the later course of the infection, viable chlamydiae are found inside alveolar macrophages (AM), bronchial/alveolar epithelial cells, vascular endothelial/smooth muscle cells and monocyte- derived macrophages (MF) [4][8].

Chlamydiae undergo a biphasic developmental cycle inside an internalized vesicle termed inclusion. Non dividing elementary bodies (EBs) change into the dividing and metabolically active reticulate bodies (RBs), re-differentiate to EBs and finally escape from the host cell [9]. Productive infection and chlamydial growth can be analyzed by inclusion morphology and size, but also by monitoring transcriptional activity of chlamydial genes involved in pathogen metabolism and pathogenicity throughout the developmental cycle [10][12]. Increased production of the pro-inflammatory cytokines IL-1ß and TNF-α have been demonstrated as markers of direct host immune responses to chlamydial infections in phagocytes [13], [14], which may result in intracellular killing of the bacteria.

One possible strategy to implement a productive infection is to silently infect respective host cells. It has been suggested that chlamydiae can benefit from a silent uptake resulting in increased survival and growth [15]. The most extensively studied example of a silent uptake into phagocytes is the clearance of apoptotic cells which is a well organized three step process [16]. First, apoptotic cells release “find-me” signals to recruit phagocytes to the site of apoptotic death [17]. Second, phagocytes recognize the presence of phosphatidylserine (PS) termed as “eat-me” signal on the membrane of apoptotic cells [16]. The final step is an active suppression of inflammation and immune response and can be termed as a “forget me” signal. This step is characterized by the release of anti-inflammatory cytokine TGF-ß and down-regulation of the pro-inflammatory cytokine TNF-α.

In this study we could show, that C. pneumoniae make use of these silent entry mechanisms to be taken up by monocyte- derived macrophages or alveolar macrophages via apoptotic PMN. Thus, C. pneumoniae efficiently infect and replicate inside PMN, which upon activation recruit monocytic phagocytes. C. pneumoniae infected PMN then become apoptotic as shown by PS and TUNEL positivity and are ingested by MF and AM, which secrete increased amounts of anti-inflammatory TGF-ß.


C. pneumoniae remains transcriptionally active inside PMN

To determine whether C. pneumoniae survives the uptake by PMN and remains viable intracellularly, we compared the infection with productive C. pneumoniae infection in HEp-2 cells. Using FACS we could show that 79%±2% (n = 3) of the HEp-2 cells and 83%±7% (n = 3) of the PMN stained C. pneumoniae- LPS positive 66 h p.i. (MOI 1), whereas non-infected cells alone stained negative (Fig. 1A,B). Microscopically, we observed that intracellular C. pneumoniae inclusions in PMN were morphologically different, showing multiple, smaller inclusions than in HEp-2 cells (Fig. 1C,D).

Figure 1. C. pneumoniae survives inside PMN.

C. pneumoniae (Cp) infected HEp-2 cells and neutrophils (PMN) were analyzed 66 h p.i. for intracellular positivity of chlamydial LPS by FACS analysis (A, B; representative experiment out of 3) and fluorescence microscopy (C, D; magnification 630×). To analyze intracellular progeny of C. pneumoniae in PMN we performed real-time RT-PCRs of the 16S rRNA in comparison to host cell 18S rRNA using the ΔΔct- method for relative quantification. Viable (open bars) but not heat-killed (HK, closed bars) chlamydiae showed a significant increase in 16S rRNA expression (E) within 66 h p.i. (p = 0.02; n = 3). Enhanced transcriptional activity of C. pneumoniae inside PMN was proven by determining the expression of chlamydial genes pyk (open bars, p = 0.03) and rpoA (closed bars, p = 0.01) mRNA (F; n = 3).

To prove intracellular viability of chlamydiae inside PMN we analyzed the transcriptional activity of chlamydial genes involved in pathogen replication and metabolism. Expression of the 16S rRNA of C. pneumoniae significantly increased from 3 h p.i. to 66 h p.i. when compared to the 18S rRNA expression of the host cells, indicating replication of chlamydiae inside PMN (Fig. 1E, p = 0.02). As a control, co- incubation of PMN with heat-killed (HK) chlamydiae did not result in detectable amounts of 16S rRNA (Fig. 1E). Key factors that indicate intracellular activity of chlamydiae like the RNA polymerase (rpo) and the pyruvate kinase (pyk) significantly increased within 66 h after PMN infection (Fig. 1F, p = 0.01 and p = 0.03, respectively).

C. pneumoniae hides inside phosphatidylserine (PS)- positive apoptotic PMN

PMN are short living cells. Even though C. pneumoniae infection delays apoptosis of PMN, 48%±8% of infected PMN become apoptotic 66 h p.i. [4]. Using Annexin A5 (AnxA5) staining to detect phosphatidylserine (PS) as an early marker of apoptosis on the outer cell membrane, we could detect that both non- infected (>95%, n = 3) and C. pneumoniae- infected (82%±12%, n = 3) PMN become PS- positive within 66 h (Fig. 2A,B). Additional staining with PI showed that C. pneumoniae infection does not increase the amount of necrotic cells compared to non- infected PMNs (Fig. 2A,B). To visualize whether C. pneumoniae- infected PMN stain positive for PS we performed a double staining using a FITC- labeled anti-C. pneumoniae LPS and Alexa568-labeled AnxA5 mAb (Fig. 2C). Within 66 h p.i. we observed that 86%±6% (n = 3) of C. pneumoniae- positive cells were expressing PS on the cell surface (Fig. 2C).

Figure 2. C. pneumoniae hides inside PS- positive PMN.

To analyze early and late apoptotic markers, PMN were infected with C. pneumoniae or left in medium alone. Using Anxa5-fluos and propidium iodide (PI) staining we could show that both non- infected (>95%, A) and C. pneumoniae- infected (82%±12%, B) PMN become PS- positive within 66 h without significant changes in the amount of PI- positive necrotic cells (representative experiment out of 3). To visualize whether C. pneumoniae- infected PMN stain positive for PS we performed a double staining using a FITC- labeled anti-C. pneumoniae LPS mAb and Alexa568-labeled AnxA5 (C). In contrast, late apoptotic cells as determined by TUNEL staining (closed line) were more often found in the medium control than in C. pneumoniae- infected PMN (D, E; representative experiment out of 3).

To analyze late apoptotic PMNs we further performed the TUNEL assay which reveals the apoptotic fragmentation of nuclear DNA. Whereas only 62%±3% (n = 3) of the C. pneumoniae- infected PMN became TUNEL- positive, more than 80% stained positive in the non- infected control 66 h p.i. (Fig. 2D,E).

C. pneumoniae infected PMN release MIP-1ß, recruit and enter macrophages

Macrophages (MF) represent the first line of defense in the lung and are supposed to clear the lung from bacterial pathogens as well as apoptotic cells. First, we addressed the question whether MF are recruited by C. pneumoniae- infected PMN. A screening of chemotactic proteins revealed that C. pneumoniae- infection of PMN resulted in an increased production of MIP-1ß as compared to mock- stimulated PMN (Fig. 3A). Using an in vitro chemotaxis assay we found, that supernatants taken from C. pneumoniae- infected PMN attracted monocytes significantly better when compared to supernatants taken from mock- stimulated PMN (Fig. 3B, p = 0.04; n = 3). Having shown that PS- positive apoptotic PMN harbor viable chlamydiae and subsequently recruit monocytes, we wondered whether these cells are ingested by monocyte- derived macrophages. In a co- culture of PS- positive C. pneumoniae- infected PMN with MF, PMN were rapidly engulfed by MF (15 min) and could be observed within the MF phagosome by electron microscopy (Fig. 3C).

Figure 3. Increased MIP-1ß release in C. pneumoniae infected PMN.

PMN were infected with C. pneumoniae (closed circles) or mock infected with HEp-2 lysates (open circles) (A). Increased secretion of MIP-1ß was observed in the supernatants of C. pneumoniae- infected PMN at the given time points by ELISA (A). The chemotactic index (specific migration/migration towards medium) indicates that monocytes are significantly better attracted by supernatants taken from C. pneumoniae- infected PMN than mock- infected control cells (B, p = 0.04; n = 3). Using transmission electron microscopy we could show that C. pneumoniae- infected PMN are engulfed by monocyte- derived macrophages (C). Arrows indicate the phagosomal membrane (PM) of the macrophage; containing a complete apoptotic PMN with condensed nucleus (N) (bar equals 1 µm, magnification 6000×).

PMN passage increases transmission of C. pneumoniae to macrophages

To follow the intracellular fate of C. pneumoniae in monocyte- derived macrophages (MF) and alveolar macrophages (AM) we used intracellular C. pneumoniae LPS- staining and FACS analysis. Whereas only 21%±5% (n = 3) of MF stained C. pneumoniae LPS- positive after direct C. pneumoniae infection (18 h p.i.), co- incubation of MF with C. pneumoniae- infected apoptotic PMN resulted in significantly higher amount of C. pneumoniae LPS- positive MF (65%±6%, p = 0.004; n = 3) (Fig. 4A). The higher efficacy in C. pneumoniae- infection of MF via apoptotic PMN was still observed 90 h p.i., showing more than 5-fold more C. pneumoniae LPS- positive cells compared to the direct infection of MF (75%±5% vs. 14%±8%, p = 0.004; n = 3). Increased bacterial load in MF that were infected through apoptotic PMN corresponded to larger intracellular C. pneumoniae inclusions (Fig. 4B) in comparison to directly infected MF (Fig. 4C).

Figure 4. PMN passage increases chlamydial transmission to macrophages.

C. pneumoniae alone (open bars) or C. pneumoniae- infected PMN (closed bars, 66 h p.i.) were co incubated with autologous macrophages (MF) at ratio of 1∶1 (A–C). The amount of C. pneumoniae- positive (C. pneumoniae LPS- staining) MF increased significantly after 18 and 90 h when MF were co incubated with C. pneumoniae- infected apoptotic PMN (A, p = 0.004), but not upon direct C. pneumoniae infection. Fluorescence microscopy revealed that co incubation of MF with C. pneumoniae- infected apoptotic PMN for 90 h resulted in multiple large inclusions (B) whereas directly infected MF showed smaller “persistent-like” inclusions (C; magnification 630×).

To bring the PMN passage strategy closer to respiratory C. pneumoniae infection, we repeated the experiments using purified alveolar macrophages (AM) from bronchoalveolar lavage (BAL) fluid. To analyze difference in the infection pattern of AM that were directly infected with C. pneumoniae vs. AM that were co- incubated with C. pneumoniae- infected apoptotic PMN we calculated the amount of small and large inclusions inside these cells (Fig. 5A–C). Thus, large inclusions were almost exclusively observed in AM that were infected by PS- positive C. pneumoniae- infected PMN (6%±1.8% vs. 0.5±0.5%, p = 0.02; n = 3), whereas the appearance of small inclusions did not differ between both conditions (Fig. 5A). The same pattern of intracellular chlamydial inclusions was observed in AM isolated from C. pneumoniae- DNA positive BAL fluids of patients with community-acquired pneumonia, but not in C. pneumoniae- DNA negative samples (Fig. 5D,E).

Figure 5. Alveolar macrophages harbor intracellular chlamydiae in vivo.

Alveolar macrophages (AM) isolated from BAL fluids of C. pneumoniae- DNA negative patients were either directly infected with C. pneumoniae (open bars) or co incubated with C. pneumoniae infected PMN at a ratio of 1∶1 (closed bars, 66 h p.i.). The percentage of AM harvesting large and small inclusions were calculated 90 h p.i. by counting a minimum of 200 cells/slide using a FITC- labeled anti- C. pneumoniae LPS- staining protocol (A). Significantly more large chlamydial inclusions were detected in AM co incubated with C. pneumoniae- infected apoptotic PMN than in directly infected AM (A–C, p = 0.02). In addition, we analyzed AM from BAL fluids of patients suffering from community-acquired pneumonia (CAP) by fluorescence microscopy (D, E; representative experiment out of 4), showing both small, persistent-like inclusions (downward arrows) and large inclusions (upward arrows) in C. pneumoniae- DNA positive BAL (D) but not in C. pneumoniae- DNA negative BAL (E).

Transmission of C. pneumoniae infection from PMN to macrophages depend on PS

To investigate the mechanisms of C. pneumoniae transfer from apoptotic PMN to MF we tried to inhibit the uptake of apoptotic cells by blocking the apoptotic eat me signal PS on infected PMN. We compared MF that were co- incubated with C. pneumoniae- infected apoptotic PMN with MF that were co- incubated with C. pneumoniae- infected apoptotic PMN after preincubation with PS-binding AnxA5. Both types of MF stained positive for C. pneumoniae-LPS (Fig. 6A,B). However, the C. pneumoniae staining pattern in MF that were infected in the presence of PS- masking AnxA5 revealed less and smaller inclusions (Fig. 6B) similar to the staining we observed after direct infection of macrophages (Fig. 4C and Fig. 5B). We found that AnxA5 significantly reduced the number of large inclusions in MF, indicative for reduced bacterial load and replicative activity (Fig. 6C, p = 0.02). Using an AnxA5-based MACS separation system we were able to separate PS- positive C. pneumoniae- infected PMN from PS- negative cells, showing that only co- incubation with PS- positive PMN resulted in transfer of C. pneumoniae infection to MF (data not shown). Furthermore, expression of the chlamydial 16S rRNA in MF was decreased more than 2-fold when the PMN uptake was blocked by AnxA5 (Fig. 6D, n = 3). Reduced bacterial load in MF pre- incubated with AnxA5 was accompanied by reduced transcriptional activity of the rpo and pyk gene indicative for impaired growth and progeny of chlamydiae (Fig. 6E, n = 3).

Figure 6. PS- dependent transmission of C. pneumoniae infection.

Blocking of phosphatidylserine (PS) expression on C. pneumoniae- infected PMN by preincubation with recombinant AnxA5 significantly reduced the uptake of chlamydiae (A, B) and the formation of large inclusions (C, p = 0.02; n = 3) as shown by fluorescence microscopy with FITC- labeled anti- C. pneumoniae LPS- staining (representative experiment out of 3, magnification 630×) and calculation of a minimum of 200 cells/slide (C). Replicative activity of C. pneumoniae, indicated by the amount of 16S rRNA (D), pyk (open bars) and rpo (closed bars) mRNA expression compared to host cell 18S rRNA expression (E), decreased in MF when C. pneumoniae- infected PMN were preincubated with AnxA5 (representative experiment out of 3).

PS- dependent uptake of C. pneumoniae infected PMN silences MF immune response

We wondered whether the uptake of apoptotic C. pneumoniae- infected PMN would induce activation or silencing of MF, and therefore analyzed the expression of the pro- inflammatory and anti- inflammatory cytokines TNF-α and TGF-ß. We observed a significant reduction of TNF-α release from MF after uptake of C. pneumoniae- infected apoptotic PMN as compared to direct infection with C. pneumoniae (Fig. 7A, p = 0.01). In contrast, PMN that were not- infected by C. pneumoniae became secondarily necrotic after 3 days, and the uptake of these late apoptotic PMN resulted in enhanced TNF-α release when compared to non- stimulated macrophages alone (data not shown). In contrast, the uptake of C. pneumoniae- infected apoptotic PMN significantly increased the production of TGF-ß as compared to direct infection with C. pneumoniae (Fig. 7B, p = 0.02). Blocking PS on apoptotic PMN by AnxA5 pre- incubation reduced the production of TGF-ß but without reaching statistical significance (n = 3).

Figure 7. Silencing of MF immune response to chlamydial infection by PMN passage.

Immune responses of directly C. pneumoniae- infected MF were analyzed in comparison to MF either co incubated with C. pneumoniae- infected PMN (66 h p.i.) or with C. pneumoniae- infected PMN after precinubation with recombinant AnxA5. Within 18 h p.i. supernatants of MF were collected to determine total amounts of TNF-α (A) and TGF-ß (B) by ELISA. Direct infection of MF with C. pneumoniae significantly increased TNF-α production (A, p = 0.01; n = 3), whereas the uptake of C. pneumoniae- infected apoptotic PMN was characterized by a significant up regulation of TGF-ß in MF (B, p = 0.02; n = 3).


The life span of infectious C. pneumoniae elementary bodies (EB) is limited outside a human host cell. The pathogen strongly depends on the host cell environment for progeny and systemic dissemination. Alveolar macrophages (AM) are the pre-dominant cells in the human lung and represent the first line of defense in respiratory infections. Upon bacterial challenge the amount of PMN increases dramatically in the lung, accounting for more than 80% of the cells in acute respiratory tract infections. Whereas direct infection of macrophages results in clearance of the pathogen, uptake of C. pneumoniae by PMN has been shown to promote intracellular survival [4]. Nevertheless, although C. pneumoniae is frequently found inside PMN in early respiratory infections, the infection of macrophages seems crucial for systemic dissemination of the pathogen [1], [18]. C. pneumoniae survive and replicate inside PMN as shown by the transcriptional activity data and increased LPS expression, however, we did not succeed to transmit chlamydial infection from PMN to epithelial cells, which are primarily used for culture of chlamydiae. We found that in the presence of PMN lysates, containing high amounts of degrading enzymes from disrupted granules, chlamydial growth was precluded, even when epithelial cells were directly infected with C. pneumoniae (data not shown). Importantly, there is good evidence from in vivo data that the influx of PMN in acute lung infection with C. pneumoniae favors chlamydial growth and results in increased bacterial load in mice [19]. In contrast, lack of PMN recruitment in MyD88-deficient mice resulted in lower bacterial load of infected lungs, although the underlying mechanisms for enhanced chlamydial progeny and dissemination in the presence of PMN remained to be explained [19]. Gueinzius et al. could previously show, that PMN might serve as a vector for systemic C. pneumoniae dissemination as the infection can be transmitted to vascular endothelial cells [20]. However, mechanisms of cell to cell transfer of obligate intracellular bacteria are largely unknown, but it has been speculated that chlamydiae might profit from hiding inside apoptotic cells [15]. First evidence supporting this hypothesis came up recently as it has been demonstrated that C. pneumoniae can be transferred from UV-killed, PS-positive mouse embryonic fibroblasts to mouse DCs [21].

Blood monocytes and monocyte- derived macrophages are supposed to be the vector for systemic dissemination of C. pneumoniae throughout the human body. In up to 25% of healthy blood donors C. pneumoniae can be detected in circulating monocytes by PCR or culture [22]. Blood monocytes have been shown to harbor viable chlamydiae [23] which allow the transmission of the infection to endothelial or smooth muscle cells in vitro [24], [25]. Of clinical importance is the fact, that most of the chlamydiae enter a persistent-like state in monocytes that is refractory to current antibiotic treatment strategies [26], [27]. When compared to the infection of epithelial cells, growth of C. pneumoniae is strongly restricted in monocytes and monocyte- derived macrophages upon direct infection [24], [28].

The data presented here underline the importance for C. pneumoniae to be taken up by PMN to increase viability and virulence in macrophages. Sheltered by the “PMN envelope” and recognized by an apoptotic “eat-me signal” C. pneumoniae is ingested by MF and AM without being visible for the innate immune system.

The physiological clearance of tissue granulocytes is normally silent, but can under certain situations shift to become a pro-inflammatory event. For example, apoptotic cells that escape phagocytosis, disintegrate in a pro-inflammatory process called secondary necrosis. Importantly, uptake of non- infected late apoptotic PMN by MF did not result in “silencing” of the macrophage immune response. This is in line with findings from Afonso et al. showing decreased intracellular survival of Leishmania amazonensis when late apoptotic PMN were uptaken [29]. Recent studies demonstrated that also viruses and parasites misuse the apoptotic “eat-me signal” PS for productive infection [30], [31]. In general, phosphatidylserine (PS) on the outer membrane of apoptotic cells is the key element for induction of an anti-inflammatory environment. Therefore the mere presence of apoptotic cells at the site of infection is beneficial during the transfer of obligate intracellular pathogens from one to the next host cell. Blocking experiments with AnxA5 revealed that PS expression on apoptotic C. pneumoniae infected PMN is important for the productive transfer of not only C. pneumoniae but also C. trachomatis L2 (Fig. S1) from PMN into macrophages.

Regarding acute C. pneumoniae infections of the lower respiratory tract in humans, it seems to be a footrace between direct clearance of C. pneumoniae by AM and ingestion of C. pneumoniae by PMN which might increase chlamydial pathogenicity. Whether direct clearance of C. pneumoniae by MF results in complete eradication of the pathogen or promotes persistence of chlamydiae in the lung still has to be determined. Morphological analysis of C. pneumoniae inclusions in AM from C. pneumoniae- DNA positive BAL fluids suggests that direct and indirect ingestion of chlamydiae may occur in vivo.

These data show that C. pneumoniae infection of MF results in increased pathogen activity and silenced immune response when transferred by apoptotic PMN. However in acute infection, the innate and acquired immune mechanisms will be turned on by direct host-pathogen interactions in order to limit infection to the lungs. Thus, pro- inflammatory immune responses will be generated by direct contact of chlamydial TLR- ligands with its specific receptors [19], [32] and MHC class I-restricted lysis of infected cells by CD8(+) CTL will occur to prevent systemic dissemination of the pathogen [33].

We demonstrated that C. pneumoniae remain transcriptionally active inside PMN and induce the release of macrophage attracting MIP-1ß. C. pneumoniae hiding inside apoptotic PMN were phagocytosed by MF and developed multiple large inclusions inside MF. In contrast, direct C. pneumoniae infection of MF resulted in a persistent-like infection. Efficient uptake and intracellular development of C. pneumoniae in MF via apoptotic PMN was dependent on the expression of phosphatidylserine on infected cells. Our data suggest that C. pneumoniae misuses central pathways of apoptotic cell clearance to survive inside human cells. Further studies are needed to elucidate the functional role of this mechanism in the dissemination of chlamydiae from the lung to the circulation in humans after acute respiratory infection.

Materials and Methods

Bacterial strain, cell preparation and infection experiments

The C. pneumoniae strain CV-6, used in this study, was isolated from a coronary artery plaque and continuously propagated on HEp-2 cells as described [34].

PMN and monocyte- derived macrophages (MF) were generated from buffy coat blood as described previously [4], [35]. Alveolar macrophages (AM) were isolated from bronchoalveolar lavage (BAL) fluid [8] from healthy volunteers (C. pneumoniae- DNA negative) and patients with acute C. pneumoniae infection as proven by C. pneumoniae- DNA positive PCR results from BAL (n = 4). Cells were cultured for 1 to 4 days at 37°C in a humidified atmosphere (5% CO2) in RPMI 1640 medium, containing 50 µM 2-mercaptoethanol, 2 mM L-glutamine, 10 mM HEPES complemented with 10% FCS (all Sigma-Aldrich, Munich, Germany).

PMN (1×107/ml) were co- incubated with C. pneumoniae at a ratio of 1∶1 (MOI 1), equivalent amounts of heat-killed C. pneumoniae, or with mock infected HEp-2 cell lysates as negative controls. 3 hours after co incubation PMN were separated from extracellular C. pneumoniae by several washing and centrifugation steps at 200×g. MF or AM were co- incubated with C. pneumoniae- infected PMN (66 h p.i.) at a PMN to macrophage ratio of 1∶1, or directly infected with C. pneumoniae with a MOI 1. Blocking experiments for phosphatidylserine specific uptake of C. pneumoniae- infected PMN were performed with recombinant Annexin A5 (AnxA5; Responsif GmbH, Erlangen Germany) at a concentration of 5 µg/1×106 PMN.

Immunohistochemistry, Western blot analysis and electron microscopy of infected cells

For C. pneumoniae- specific staining the cells were cytocentrifuged, fixed in methanol and stained using a FITC-conjugated anti-C. pneumoniae mAb (clone RR402, IgG3, Dako, Hamburg, Germany) or a FITC-conjugated isotype matched control mAb (Dako), followed by counterstaining with Evans blue. Inclusion morphology was analyzed under a Zeiss Axioskop-2® fluorescent microscope fitted with HRS- Axiocam® and Axiovision software 4.5®. Percentages of C. pneumoniae- LPS positivity was calculated by counting a minimum of 200 cells/slide. For structure preservation electron microscopy, MF were co- incubated for 15 min with C. pneumoniae - infected PMN at a ratio of 1∶1. Cells were fixed and examined with a Philips EM 400 electron microscope as described [35].

Flow cytometry analysis

Intracellular C. pneumoniae LPS was quantified using FACS analysis. Cells were permeabilized using the Cytofix/Cytoperm Plus Kit (BD Biosciences, Heidelberg, Germany) as recommended by the manufacturer and stained with a FITC-conjugated anti- C. pneumoniae mAb or an isotype matched control (both Dako). Annexin A5 (AnxA5), propidium iodide and TUNEL staining were performed as described [4]. In addition we stained cells with Alexa568-conjugated AnxA5 followed by an intracellular C. pneumoniae LPS staining as described above. To maintain AnxA5 binding to PS the intracellular C. pneumoniae staining was performed in the presence of 5 mM CaCl2.

Real-Time PCR

Total RNA isolation, generation of cDNA and PCR amplification was performed as described [36]. The expression of the chlamydial 16S rRNA (forward [TCG CCT GGG AAT AAG AGA GA]; reverse [AAT GCT GAC TTG GGG TTG AG]), rpoA (forward [GCAATCGAAGGGGTTATTGA]; reverse [TGATCTGGGTTAACG GCTTC]), pyk (forward [AGC TTG CGG ATG GAA TTA TG]; reverse [ATG CAG TTT CCC CTG ACA AC]), and 18S rRNA (forward [TCA AGA ACG AAA GTC GGA GG], reverse [GGA CAT CTA AGG GCA TCA CA]) was analyzed by relative quantification using the ΔΔct- method as shown before [36]. Changes in the mRNA expression profile over time were calculated by comparing values for 66 h p.i. to values for 3 h p.i. which were set to 1 for clear presentation.

Cytokine measurement and chemotaxis assay

Cells were cultured and supernatants were collected after given time points and stored at -20°C until cytokine determination. MIP-1ß, TNF-α and TGF-ß was measured using ELISA (R&D Systems, Wiesbaden, Germany) according to the manufacturer's instructions (duplicate assays for at least 3 independent experiments). Chemotaxis assays were performed with freshly isolated monocytes in 24-well Transwell plates (Costar, Bodenheim, Germany) as described before [35]. The chemotactic index (CI) was calculated by dividing the number of migrated cells towards supernatants taken from C. pneumoniae- infected PMN, divided by the number of cells migrated in medium alone.

Statistical analysis

Data are depicted as mean±standard error of the mean. Statistical significance of the results was analyzed with Student's t test and Microsoft Excel 8.0® software. Results were considered statistically significant at p<0.05 (*) and p<0.005 (**).

Supporting Information

Figure S1.

PS- dependent transmission of C. trachomatis infection. Blocking of phosphatidylserine (PS) expression on C. trachomatis (L2) infected PMN by preincubation with recombinant AnxA5 significantly reduced the uptake of chlamydiae (n = 4, p = 0.005). Percentages of C. trachomatis - LPS positivity was calculated by counting a minimum of 200 cells/slide stained with FITC- labeled anti- chlamydial - LPS staining.

(0.64 MB TIF)


The authors thank Matthias Maass (University Hospital Salzburg, Austria) for providing us with the CV-6 strain.

Author Contributions

Conceived and designed the experiments: JR GvZ. Performed the experiments: LP CJ SM MK KD TL. Analyzed the data: JR MK KD WS SS TL GvZ. Wrote the paper: JR GvZ. Critical discussion of the manuscript: WS.


  1. 1. Gieffers J, van Zandbergen G, Rupp J, Sayk F, Kruger S, Ehlers S, Solbach W, Maass M (2004) Phagocytes transmit Chlamydia pneumoniae from the lungs to the vasculature. Eur Respir J 23: 506–510.J. GieffersG. van ZandbergenJ. RuppF. SaykS. KrugerS. EhlersW. SolbachM. Maass2004Phagocytes transmit Chlamydia pneumoniae from the lungs to the vasculature.Eur Respir J23506510
  2. 2. Yang ZP, Cummings PK, Patton DL, Kuo CC (1994) Ultrastructural lung pathology of experimental Chlamydia pneumoniae pneumonitis in mice. J Infect Dis 170: 464–467.ZP YangPK CummingsDL PattonCC Kuo1994Ultrastructural lung pathology of experimental Chlamydia pneumoniae pneumonitis in mice.J Infect Dis170464467
  3. 3. Jahn HU, Krull M, Wuppermann FN, Klucken AC, Rosseau S, Seybold J, Hegemann JH, Jantos CA, Suttorp N (2000) Infection and activation of airway epithelial cells by Chlamydia pneumoniae. J Infect Dis 182: 1678–1687.HU JahnM. KrullFN WuppermannAC KluckenS. RosseauJ. SeyboldJH HegemannCA JantosN. Suttorp2000Infection and activation of airway epithelial cells by Chlamydia pneumoniae.J Infect Dis18216781687
  4. 4. van Zandbergen G, Gieffers J, Kothe H, Rupp J, Bollinger A, Aga E, Klinger M, Brade H, Dalhoff K, Maass M, Solbach W, Laskay T (2004) Chlamydia pneumoniae multiply in neutrophil granulocytes and delay their spontaneous apoptosis. J Immunol 172: 1768–1776.G. van ZandbergenJ. GieffersH. KotheJ. RuppA. BollingerE. AgaM. KlingerH. BradeK. DalhoffM. MaassW. SolbachT. Laskay2004Chlamydia pneumoniae multiply in neutrophil granulocytes and delay their spontaneous apoptosis.J Immunol17217681776
  5. 5. Bartels C, Maass M, Bein G, Malisius R, Brill N, Bechtel JF, Sayk F, Feller AC, Sievers HH (1999) Detection of Chlamydia pneumoniae but not cytomegalovirus in occluded saphenous vein coronary artery bypass grafts. Circulation 99: 879–882.C. BartelsM. MaassG. BeinR. MalisiusN. BrillJF BechtelF. SaykAC FellerHH Sievers1999Detection of Chlamydia pneumoniae but not cytomegalovirus in occluded saphenous vein coronary artery bypass grafts.Circulation99879882
  6. 6. Quinn TC, Gaydos CA (1999) In vitro infection and pathogenesis of Chlamydia pneumoniae in endovascular cells. Am Heart J 138: S507–S511.TC QuinnCA Gaydos1999In vitro infection and pathogenesis of Chlamydia pneumoniae in endovascular cells.Am Heart J138S507S511
  7. 7. Register KB, Davis CH, Wyrick PB, Shafer WM, Spitznagel JK (1987) Nonoxidative antimicrobial effects of human polymorphonuclear leukocyte granule proteins on Chlamydia spp. in vitro. Infect Immun 55: 2420–2427.KB RegisterCH DavisPB WyrickWM ShaferJK Spitznagel1987Nonoxidative antimicrobial effects of human polymorphonuclear leukocyte granule proteins on Chlamydia spp. in vitro.Infect Immun5524202427
  8. 8. Rupp J, Kothe H, Mueller A, Maass M, Dalhoff K (2003) Imbalanced secretion of IL-1beta and IL-1RA in Chlamydia pneumoniae-infected mononuclear cells from COPD patients. Eur Respir J 22: 274–279.J. RuppH. KotheA. MuellerM. MaassK. Dalhoff2003Imbalanced secretion of IL-1beta and IL-1RA in Chlamydia pneumoniae-infected mononuclear cells from COPD patients.Eur Respir J22274279
  9. 9. Byrne GI (2003) Chlamydia uncloaked. Proc Natl Acad Sci U S A 100: 8040–8042.GI Byrne2003Chlamydia uncloaked.Proc Natl Acad Sci U S A10080408042
  10. 10. Dreses-Werringloer U, Gerard HC, Whittum-Hudson JA, Hudson AP (2006) Chlamydophila (Chlamydia) pneumoniae infection of human astrocytes and microglia in culture displays an active, rather than a persistent, phenotype. Am J Med Sci 332: 168–174.U. Dreses-WerringloerHC GerardJA Whittum-HudsonAP Hudson2006Chlamydophila (Chlamydia) pneumoniae infection of human astrocytes and microglia in culture displays an active, rather than a persistent, phenotype.Am J Med Sci332168174
  11. 11. Maurer AP, Mehlitz A, Mollenkopf HJ, Meyer TF (2007) Gene expression profiles of Chlamydophila pneumoniae during the developmental cycle and iron depletion-mediated persistence. PLoS Pathog 3: e83.AP MaurerA. MehlitzHJ MollenkopfTF Meyer2007Gene expression profiles of Chlamydophila pneumoniae during the developmental cycle and iron depletion-mediated persistence.PLoS Pathog3e83
  12. 12. Rupp J, Gieffers J, Klinger M, van Zandbergen G, Wrase R, Maass M, Solbach W, Deiwick J, Hellwig-Burgel T (2007) Chlamydia pneumoniae directly interferes with HIF-1alpha stabilization in human host cells. Cell Microbiol. J. RuppJ. GieffersM. KlingerG. van ZandbergenR. WraseM. MaassW. SolbachJ. DeiwickT. Hellwig-Burgel2007Chlamydia pneumoniae directly interferes with HIF-1alpha stabilization in human host cells.Cell Microbiol
  13. 13. Kaukoranta-Tolvanen SS, Teppo AM, Laitinen K, Saikku P, Linnavuori K, Leinonen M (1996) Growth of Chlamydia pneumoniae in cultured human peripheral blood mononuclear cells and induction of a cytokine response. Microb Pathog 21: 215–221.SS Kaukoranta-TolvanenAM TeppoK. LaitinenP. SaikkuK. LinnavuoriM. Leinonen1996Growth of Chlamydia pneumoniae in cultured human peripheral blood mononuclear cells and induction of a cytokine response.Microb Pathog21215221
  14. 14. Yang J, Hooper WC, Phillips DJ, Tondella ML, Talkington DF (2003) Induction of proinflammatory cytokines in human lung epithelial cells during Chlamydia pneumoniae infection. Infect Immun 71: 614–620.J. YangWC HooperDJ PhillipsML TondellaDF Talkington2003Induction of proinflammatory cytokines in human lung epithelial cells during Chlamydia pneumoniae infection.Infect Immun71614620
  15. 15. Byrne GI, Ojcius DM (2004) Chlamydia and apoptosis: life and death decisions of an intracellular pathogen. Nat Rev Microbiol 2: 802–808.GI ByrneDM Ojcius2004Chlamydia and apoptosis: life and death decisions of an intracellular pathogen.Nat Rev Microbiol2802808
  16. 16. Lauber K, Blumenthal SG, Waibel M, Wesselborg S (2004) Clearance of apoptotic cells: getting rid of the corpses. Mol Cell 14: 277–287.K. LauberSG BlumenthalM. WaibelS. Wesselborg2004Clearance of apoptotic cells: getting rid of the corpses.Mol Cell14277287
  17. 17. Lauber K, Bohn E, Krober SM, Xiao YJ, Blumenthal SG, Lindemann RK, Marini P, Wiedig C, Zobywalski A, Baksh S, Xu Y, Autenrieth IB, Schulze-Osthoff K, Belka C, Stuhler G, Wesselborg S (2003) Apoptotic cells induce migration of phagocytes via caspase-3-mediated release of a lipid attraction signal. Cell 113: 717–730.K. LauberE. BohnSM KroberYJ XiaoSG BlumenthalRK LindemannP. MariniC. WiedigA. ZobywalskiS. BakshY. XuIB AutenriethK. Schulze-OsthoffC. BelkaG. StuhlerS. Wesselborg2003Apoptotic cells induce migration of phagocytes via caspase-3-mediated release of a lipid attraction signal.Cell113717730
  18. 18. Blasi F, Centanni S, Allegra L (2004) Chlamydia pneumoniae: crossing the barriers? Eur Respir J 23: 499–500.F. BlasiS. CentanniL. Allegra2004Chlamydia pneumoniae: crossing the barriers?Eur Respir J23499500
  19. 19. Rodriguez N, Fend F, Jennen L, Schiemann M, Wantia N, Prazeres da Costa CU, Durr S, Heinzmann U, Wagner H, Miethke T (2005) Polymorphonuclear neutrophils improve replication of Chlamydia pneumoniae in vivo upon MyD88-dependent attraction. J Immunol 174: 4836–4844.N. RodriguezF. FendL. JennenM. SchiemannN. WantiaCU Prazeres da CostaS. DurrU. HeinzmannH. WagnerT. Miethke2005Polymorphonuclear neutrophils improve replication of Chlamydia pneumoniae in vivo upon MyD88-dependent attraction.J Immunol17448364844
  20. 20. Gueinzius K, Magenau A, Erath S, Wittke V, Urbich C, Ferrando-May E, Dimmeler S, Hermann C (2008) Endothelial cells are protected against phagocyte-transmitted Chlamydophila pneumoniae infections by laminar shear stress Gueinzius: Shear stress protects from C. pneumoniae infection 1. Atherosclerosis 198: 256–263.K. GueinziusA. MagenauS. ErathV. WittkeC. UrbichE. Ferrando-MayS. DimmelerC. Hermann2008Endothelial cells are protected against phagocyte-transmitted Chlamydophila pneumoniae infections by laminar shear stress Gueinzius: Shear stress protects from C. pneumoniae infection 1.Atherosclerosis198256263
  21. 21. Ying S, Fischer SF, Pettengill M, Conte D, Paschen SA, Ojcius DM, Hacker G (2006) Characterization of host cell death induced by Chlamydia trachomatis. Infect Immun 74: 6057–6066.S. YingSF FischerM. PettengillD. ConteSA PaschenDM OjciusG. Hacker2006Characterization of host cell death induced by Chlamydia trachomatis.Infect Immun7460576066
  22. 22. Cirino F, Webley WC, West C, Croteau NL, Andrzejewski C Jr, Stuart ES (2006) Detection of Chlamydia in the peripheral blood cells of normal donors using in vitro culture, immunofluorescence microscopy and flow cytometry techniques. BMC Infect Dis 6: 23.F. CirinoWC WebleyC. WestNL CroteauC. Andrzejewski JrES Stuart2006Detection of Chlamydia in the peripheral blood cells of normal donors using in vitro culture, immunofluorescence microscopy and flow cytometry techniques.BMC Infect Dis623
  23. 23. Boman J, Soderberg S, Forsberg J, Birgander LS, Allard A, Persson K, Jidell E, Kumlin U, Juto P, Waldenstrom A, Wadell G (1998) High prevalence of Chlamydia pneumoniae DNA in peripheral blood mononuclear cells in patients with cardiovascular disease and in middle-aged blood donors. J Infect Dis 178: 274–277.J. BomanS. SoderbergJ. ForsbergLS BirganderA. AllardK. PerssonE. JidellU. KumlinP. JutoA. WaldenstromG. Wadell1998High prevalence of Chlamydia pneumoniae DNA in peripheral blood mononuclear cells in patients with cardiovascular disease and in middle-aged blood donors.J Infect Dis178274277
  24. 24. Gaydos CA, Summersgill JT, Sahney NN, Ramirez JA, Quinn TC (1996) Replication of Chlamydia pneumoniae in vitro in human macrophages, endothelial cells, and aortic artery smooth muscle cells. Infect Immun 64: 1614–1620.CA GaydosJT SummersgillNN SahneyJA RamirezTC Quinn1996Replication of Chlamydia pneumoniae in vitro in human macrophages, endothelial cells, and aortic artery smooth muscle cells.Infect Immun6416141620
  25. 25. Rupp J, Koch M, van Zandbergen G, Solbach W, Brandt E, Maass M (2005) Transmission of Chlamydia pneumoniae infection from blood monocytes to vascular cells in a novel transendothelial migration model. FEMS Microbiol Lett 242: 203–208.J. RuppM. KochG. van ZandbergenW. SolbachE. BrandtM. Maass2005Transmission of Chlamydia pneumoniae infection from blood monocytes to vascular cells in a novel transendothelial migration model.FEMS Microbiol Lett242203208
  26. 26. Gieffers J, Fullgraf H, Jahn J, Klinger M, Dalhoff K, Katus HA, Solbach W, Maass M (2001) Chlamydia pneumoniae infection in circulating human monocytes is refractory to antibiotic treatment. Circulation 103: 351–356.J. GieffersH. FullgrafJ. JahnM. KlingerK. DalhoffHA KatusW. SolbachM. Maass2001Chlamydia pneumoniae infection in circulating human monocytes is refractory to antibiotic treatment.Circulation103351356
  27. 27. Peters J, Hess S, Endlich K, Thalmann J, Holzberg D, Kracht M, Schaefer M, Bartling G, Klos A (2005) Silencing or permanent activation: host-cell responses in models of persistent Chlamydia pneumoniae infection. Cell Microbiol 7: 1099–1108.J. PetersS. HessK. EndlichJ. ThalmannD. HolzbergM. KrachtM. SchaeferG. BartlingA. Klos2005Silencing or permanent activation: host-cell responses in models of persistent Chlamydia pneumoniae infection.Cell Microbiol710991108
  28. 28. Wolf K, Fischer E, Hackstadt T (2005) Degradation of Chlamydia pneumoniae by peripheral blood monocytic cells. Infect Immun 73: 4560–4570.K. WolfE. FischerT. Hackstadt2005Degradation of Chlamydia pneumoniae by peripheral blood monocytic cells.Infect Immun7345604570
  29. 29. Afonso L, Borges VM, Cruz H, Ribeiro-Gomes FL, DosReis GA, Dutra AN, Clarencio J, de Oliveira CI, Barral A, Barral-Netto M, Brodskyn CI (2008) Interactions with apoptotic but not with necrotic neutrophils increase parasite burden in human macrophages infected with Leishmania amazonensis 3. J Leukoc Biol 84: 389–396.L. AfonsoVM BorgesH. CruzFL Ribeiro-GomesGA DosReisAN DutraJ. ClarencioCI de OliveiraA. BarralM. Barral-NettoCI Brodskyn2008Interactions with apoptotic but not with necrotic neutrophils increase parasite burden in human macrophages infected with Leishmania amazonensis 3.J Leukoc Biol84389396
  30. 30. Mercer J, Helenius A (2008) Vaccinia virus uses macropinocytosis and apoptotic mimicry to enter host cells. Science 320: 531–535.J. MercerA. Helenius2008Vaccinia virus uses macropinocytosis and apoptotic mimicry to enter host cells.Science320531535
  31. 31. van Zandbergen G, Bollinger A, Wenzel A, Kamhawi S, Voll R, Klinger M, Muller A, Holscher C, Herrmann M, Sacks D, Solbach W, Laskay T (2006) Leishmania disease development depends on the presence of apoptotic promastigotes in the virulent inoculum. Proc Natl Acad Sci U S A 103: 13837–13842.G. van ZandbergenA. BollingerA. WenzelS. KamhawiR. VollM. KlingerA. MullerC. HolscherM. HerrmannD. SacksW. SolbachT. Laskay2006Leishmania disease development depends on the presence of apoptotic promastigotes in the virulent inoculum.Proc Natl Acad Sci U S A1031383713842
  32. 32. Rodriguez N, Wantia N, Fend F, Durr S, Wagner H, Miethke T (2006) Differential involvement of TLR2 and TLR4 in host survival during pulmonary infection with Chlamydia pneumoniae 8. Eur J Immunol 36: 1145–1155.N. RodriguezN. WantiaF. FendS. DurrH. WagnerT. Miethke2006Differential involvement of TLR2 and TLR4 in host survival during pulmonary infection with Chlamydia pneumoniae 8.Eur J Immunol3611451155
  33. 33. Wizel B, Starcher BC, Samten B, Chroneos Z, Barnes PF, Dzuris J, Higashimoto Y, Appella E, Sette A (2002) Multiple Chlamydia pneumoniae antigens prime CD8+ Tc1 responses that inhibit intracellular growth of this vacuolar pathogen 5. J Immunol 169: 2524–2535.B. WizelBC StarcherB. SamtenZ. ChroneosPF BarnesJ. DzurisY. HigashimotoE. AppellaA. Sette2002Multiple Chlamydia pneumoniae antigens prime CD8+ Tc1 responses that inhibit intracellular growth of this vacuolar pathogen 5.J Immunol16925242535
  34. 34. Maass M, Harig U (1995) Evaluation of culture conditions used for isolation of Chlamydia pneumoniae. Am J Clin Pathol 103: 141–148.M. MaassU. Harig1995Evaluation of culture conditions used for isolation of Chlamydia pneumoniae.Am J Clin Pathol103141148
  35. 35. van Zandbergen G, Klinger M, Mueller A, Dannenberg S, Gebert A, Solbach W, Laskay T (2004) Cutting edge: neutrophil granulocyte serves as a vector for Leishmania entry into macrophages. J Immunol 173: 6521–6525.G. van ZandbergenM. KlingerA. MuellerS. DannenbergA. GebertW. SolbachT. Laskay2004Cutting edge: neutrophil granulocyte serves as a vector for Leishmania entry into macrophages.J Immunol17365216525
  36. 36. Rupp J, Hellwig-Burgel T, Wobbe V, Seitzer U, Brandt E, Maass M (2005) Chlamydia pneumoniae infection promotes a proliferative phenotype in the vasculature through Egr-1 activation in vitro and in vivo. Proc Natl Acad Sci U S A 102: 3447–3452.J. RuppT. Hellwig-BurgelV. WobbeU. SeitzerE. BrandtM. Maass2005Chlamydia pneumoniae infection promotes a proliferative phenotype in the vasculature through Egr-1 activation in vitro and in vivo.Proc Natl Acad Sci U S A10234473452