Browse Subject Areas

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Low Enzymatic Activity Haplotypes of the Human Catechol-O-Methyltransferase Gene: Enrichment for Marker SNPs

  • Andrea G. Nackley,

    Affiliation Center for Neurosensory Disorders, School of Dentistry, University of North Carolina, Chapel Hill, North Carolina, United States of America

  • Svetlana A. Shabalina,

    Affiliation National Center for Biotechnology Information, National Institutes of Health, Bethesda, Maryland, United States of America

  • Jason E. Lambert,

    Affiliation Department of Endodontics, School of Dentistry, University of North Carolina, Chapel Hill, North Carolina, United States of America

  • Mathew S. Conrad,

    Affiliation Center for Neurosensory Disorders, School of Dentistry, University of North Carolina, Chapel Hill, North Carolina, United States of America

  • Dustin G. Gibson,

    Affiliation Center for Neurosensory Disorders, School of Dentistry, University of North Carolina, Chapel Hill, North Carolina, United States of America

  • Alexey N. Spiridonov,

    Affiliation Department of Mathematics, Massachusetts Institute of Technology, Cambridge, Massachusetts, United States of America

  • Sarah K. Satterfield,

    Affiliation Center for Neurosensory Disorders, School of Dentistry, University of North Carolina, Chapel Hill, North Carolina, United States of America

  • Luda Diatchenko

    Affiliation Center for Neurosensory Disorders, School of Dentistry, University of North Carolina, Chapel Hill, North Carolina, United States of America

Low Enzymatic Activity Haplotypes of the Human Catechol-O-Methyltransferase Gene: Enrichment for Marker SNPs

  • Andrea G. Nackley, 
  • Svetlana A. Shabalina, 
  • Jason E. Lambert, 
  • Mathew S. Conrad, 
  • Dustin G. Gibson, 
  • Alexey N. Spiridonov, 
  • Sarah K. Satterfield, 
  • Luda Diatchenko


Catechol-O-methyltransferase (COMT) is an enzyme that plays a key role in the modulation of catechol-dependent functions such as cognition, cardiovascular function, and pain processing. Three common haplotypes of the human COMT gene, divergent in two synonymous and one nonsynonymous (val158met) position, designated as low (LPS), average (APS), and high pain sensitive (HPS), are associated with experimental pain sensitivity and risk of developing chronic musculoskeletal pain conditions. APS and HPS haplotypes produce significant functional effects, coding for 3- and 20-fold reductions in COMT enzymatic activity, respectively. In the present study, we investigated whether additional minor single nucleotide polymorphisms (SNPs), accruing in 1 to 5% of the population, situated in the COMT transcript region contribute to haplotype-dependent enzymatic activity. Computer analysis of COMT ESTs showed that one synonymous minor SNP (rs769224) is linked to the APS haplotype and three minor SNPs (two synonymous: rs6267, rs740602 and one nonsynonymous: rs8192488) are linked to the HPS haplotype. Results from in silico and in vitro experiments revealed that inclusion of allelic variants of these minor SNPs in APS or HPS haplotypes did not modify COMT function at the level of mRNA folding, RNA transcription, protein translation, or enzymatic activity. These data suggest that neutral variants are carried with APS and HPS haplotypes, while the high activity LPS haplotype displays less linked variation. Thus, both minor synonymous and nonsynonymous SNPs in the coding region are markers of functional APS and HPS haplotypes rather than independent contributors to COMT activity.


Catechol-O-methyltransferase (COMT) is a ubiquitously expressed enzyme that maintains basic biologic functions by inactivating a broad range of catechol substrates, including catecholamines (epinephrine, norepinephrine, and dopamine) and catecholestrogens. The human COMT gene is located on chromosome 22, band q11.2 where it encodes two distinct proteins, soluble COMT (S-COMT) and membrane-bound COMT (MB-COMT), through the use of alternative promoters and translation initiation sites [1], [2]. S-COMT is predominately expressed in peripheral tissues, while MB-COMT is predominatly expressed in brain. The specific cell and tissue distribution of these isoforms largely overlaps with that of its catechol substrates.

To date, the role of COMT in catechol metabolism has prompted over 600 investigations of its variants in the etiology of numerous disorders. Functional polymorphisms in the COMT gene are associated with dopamine and norepinephrine-dependent neuropsychiatric disorders such as schizophrenia [3], [4], bipolar disorder [5], obsessive compulsive disorder [6], [7], anxiety disorders [8][10], attention deficit hyperactivity disorder [11], [12], addiction [13], and anorexia nervosa [14], [15] as well as neurodegenerative disorders such as Parkinson's disease [16], [17]. COMT polymorphisms have also been associated with the development of disorders such as cardiovascular disease [18], [19] and estrogen-induced hormonal cancers [20], [21], which are characterized by increased levels of catecholamines and their reactive products in peripheral tissues.

More recently, COMT has been implicated in the modulation of persistent pain. Studies show that reduced COMT activity results in increased pain sensitivity and proinflammatory cytokine production in animal models [22], [23]. These results are consistent with clinical studies demonstrating that facial pain patients exhibit lower COMT activity relative to controls [24]. Furthermore, functional polymorphisms in the COMT gene resulting in reduced enzyme activity are associated with fibromyalgia [25], [26], temporomandibular disorder (TMD) onset [27], experimental pain sensitivity [27], [28], and altered morphine efficacy in cancer pain treatment [29]. Collectively, results of these investigations demonstrate that low activity variants of COMT negatively impact many aspects of physiology and behavior.

Most of these association studies focused on the common single nucleotide polymorphism (SNP) rs4680 located at codon 158. The minor 675A allele produces a valine to methionine substitution, resulting in a less thermostable COMT enzyme that exhibits a 3-fold reduction in activity [30]. Until late, the nonsynonymous val158met allele has been generally accepted as the main source of individual variation in COMT activity. However, observed associations between catechol-related disorders and the met158 allele are modest and often inconsistent. In the hope of capturing additional functional COMT polymorphisms that contribute to disease phenotype, investigators have begun casting larger nets that extend beyond rs4680. Recent reports have demonstrated associations between the minor alleles of rs2097603 located in the MB-COMT promoter region, rs737865 located in intron 1, rs6267 located in exon 3, and rs165599 located in the 3′ untranslated region and enzyme amount/activity as well as COMT-dependent phenotypes [31][35]. Thus, emerging evidence suggests that there are multiple functional interacting SNPs within the COMT gene locus.

Applying this approach to the study of pain disorders, our group identified three major COMT haplotypes consisting of three SNPs in the coding region, rs4633 (C/T), rs4818 (C/G), and the commonly studied rs4680 (G/A), that are strongly associated with experimental pain sensitivity and likelihood of developing TMD [27], [36]. On the basis of subjects' pain responsiveness, haplotypes were designated as low (LPS; CGG), average (APS; TCA), or high (HPS; CCG) pain sensitive. Individuals carrying APS/APS or HPS/APS diplotypes were nearly 2.5 times more likely to develop TMD. In a related study, Vargas-Alarcon and colleagues found that the HPS haplotype was associated with fibromyalgia risk and symptom severity [26]. APS and HPS haplotypes associated with pain sensitivity code for functional changes in COMT. In cells expressing S- or MB-COMT, the APS haplotype displays a modest 3-fold reduction in enzymatic activity likely due to the previously reported decrease in protein thermostability coded by the met158 allele. The HPS haplotype, however, exhibits a marked 20-fold reduction in enzymatic activity paralleled by reduced protein translation efficiency due to formation of a longer more stable mRNA secondary structure with a 17 kcal/mol reduction in Gibbs free energy [37]. Thus, combinations of commonly observed alleles in the coding region of the human COMT gene can impair the activity of enzyme crucial for a variety of essential functions such as cognition, cardiovascular tone, and pain processing.

While LPS, APS, and HPS haplotypes of the COMT gene are common in the population, accounting for nearly 96% of all detected haplotypes in the coding region [27], a significant number of less common minor SNPs are also situated in this region. The presence of such minor SNPs in the major COMT haplotypes could be 1) compensatory, rescuing COMT activity by annulling the effects of their parent haplotypes [38], 2) neutral, carried with common selectively favored variants [39], or 3) deleterious, further reducing COMT activity through independent mechanisms or through interactions with other functional variants [40].

Thus, the purpose of the present study was to identify and characterize the potential functional effects of additional SNPs within the COMT gene. An EST database search was first performed to identify minor SNPs situated in the transcript region of the COMT gene that were linked with the major haplotypes. We identified a total of four minor SNPs that were linked to haplotypes associated with heightened pain sensitivity: rs769224 (800A) was carried with the APS haplotype, while rs6267 (417T), rs740602 (422A) and rs8192488 (641T) were carried with the HPS haplotype. Subsequent in vitro and in silico experiments were performed to assess the functional impact of minor SNPs on mRNA secondary structure formation, RNA transcription, protein translation, and enzymatic activity.


EST-based identification of minor SNPs linked to common haplotypes of the COMT gene

We first investigated the occurrence of SNPs within the COMT transcript region with lower frequency compared to commonly observed SNPs constituting the three major haplotypes. To identify minor COMT SNPs potentially linked to major haplotypes, we searched the existing NCBI expressed sequence tag (EST) database. As this database contains over 6 million human ESTs obtained from many unrelated sources, the variation in ESTs reflects genotypic variation naturally existing in the population.

We identified 939 human ESTs that shared greater than 95% sequence similarity over 100 nucleotides with MB-COMT mRNA. Of these, 306 ESTs included the positions of all three SNPs in the coding region (rs4633, rs4818 and rs4680) needed to identify the major COMT haplotypic structure. Based on their sequence, 138 ESTs were assigned to the LPS haplotype, 109 to the APS haplotype, and 53 to the HPS haplotype. Six ESTs were not linked to any of the three major COMT haplotypes and were thus excluded. Of the remaining 300 ESTs, 19 carried one known SNP with frequency of at least 1% ([41]; Table 1). Six ESTs carried the minor 417T allele of SNP rs6267, 4 carried the minor 422A allele of SNP rs740602, 3 carried the minor 641T allele of SNP rs8192488, and 6 carried the minor 800A allele of SNP rs769224. The 800A minor SNP was linked to the APS haplotype, while the 417T, 422A and 641T minor SNPs were linked to the HPS haplotype.

Table 1. EST-based identification of minor SNPs linked to common COMT haplotypes.

Compared to SNPs constituting the LPS, APS, and HPS haplotypes, the above minor SNPs were less frequent in the population and did not coexist with one another. Therefore, these minor SNPs likely represent younger mutations that should be linked to the major haplotypes [42]. Interestingly, there was an inverse relationship between the frequency of minor SNPs and major haplotypes in the EST database. Three minor SNPs were identified in the least frequent HPS haplotype, one minor SNP was identified in the APS haplotype, and no minor SNPs were identified in the most frequent LPS haplotype. As LPS is the older haplotype, showing inter-species conservation at the level of RNA secondary structure [37], deviation from this haplotype may have functional implications- negative or positive. The polymorphic pattern exhibited by the more recent APS and HPS haplotypes could indicate the evolution of compensatory SNPs that counteract deleterious effects of low activity haplotypes [39], [43], [44]. Alternatively, the presence of additional variation in the low activity APS and HPS haplotypes could simply be neutral or nearly neutral. Thus, subsequent studies were conducted to determine if these minor frequency SNPs naturally occurring within the APS and HPS haplotypes produce compensatory, neutral, or negative effects on COMT enzymatic activity at various levels along the canonical pathway from gene to RNA to active protein.

Effect of minor SNPs on mRNA secondary structure associated with common COMT haplotypes

Next, we tested whether minor SNPs linked to haplotypes associated with heightened pain sensitivity restore function of the COMT enzyme through modification of mRNA secondary structure which impacts protein translation efficiency [45]. The 800A and 641T minor alleles carried with the APS and HPS haplotypes, respectively, are situated in a stem-loop structure in the val158 region shown to be important for COMT protein translation [37]. Thus, 800A and 641T minor alleles may modify this local stem-loop and ultimately affect protein translation. While the 417T and 422A minor alleles carried with the HPS haplotype are located further away from the val158 region in linear space, they could interact with this region when folded or alter a remote stem-loop structure also important for protein translation.

To determine whether minor SNPs linked to APS and HPS haplotypes modify mRNA secondary structure, secondary structures were predicted for the APS, APS+800A, HPS, HPS+417T, HPS+422A, and HPS+641T mRNA transcripts using the RNA Mfold [46] and Afold [47] programs. Several structural domains were predicted within the 449 nucleotide region that contained the previously studied val158 SNP as well as the newly studied minor SNPs (Fig. 1). In line with previous studies [37], the HPS haplotype codes for a longer more stable secondary structure in the val158 region relative to the APS haplotype. The 800A and 641T minor alleles located within the structural domain of the val158 region did not significantly alter this local stem-loop structure or nearby structural domains associated with the APS and HPS haplotypes, respectively. The 417T or 422A minor alleles were located outside of the structural domain of the val158 region, within separate stem-loop structures. Inclusion of either 417T or 422A minor alleles in the HPS haplotype did not alter their local stem-loop structure or that of the nearby structural domain of the val158 region. These computer modeling results as well as potential independent effects of minor SNPs carried with the major haplotypes were studied further in in vitro cell transfection experiments.

Figure 1. Effect of minor SNPs linked to APS and HPS haplotypes on predicted mRNA secondary structures.

Polymorphic alleles C389T, C611G, and G675A that define the three major haplotypes are indicated, minor SNPs underlined, and the major functional RNA stem-loop structure associated with APS and HPS circled. Relative to the APS haplotype, the HPS haplotype coded for a longer, more stable secondary structure. Transcripts carrying the 800A or 641T mutations in the val158 region or the 417T or 422A mutations in the nearby stem-loop did not significantly alter mRNA secondary structure.

Effect of minor SNPs on COMT RNA abundance, protein expression, and enzymatic activity

To assess the potential functional impact of minor SNPs at the level of RNA transcription, PC12 cells were transiently transfected in duplicate with expression constructs corresponding to the major LPS, APS, and HPS haplotypes as well as the APS (APS+800A) and HPS (HPS+417T, HPS+422A, and HPS+641T) haplotypes containing individual alleles of minor SNPs and then RNA abundance was measured using real time PCR.

In agreement with results from previous reports [27], [37], LPS, APS, and HPS haplotypes exhibited uniform levels of COMT RNA abundance (Fig. 2A). Inclusion of the 800A minor allele in the APS haplotype or the 417T, 422A, or 641T minor alleles in the HPS haplotype did not alter RNA abundance relative to that exhibited by the respective parent haplotypes. As previous studies demonstrated that COMT haplotype-dependent RNA abundance does not parallel protein expression or enzyme activity [27], [37], minor SNPs may produce effects downstream of RNA transcription.

Figure 2. Effect of minor SNPs linked to the APS and HPS haplotypes on COMT RNA abundance, protein expression, and enzymatic activity.

(A) The relative abundance of RNA was uniform among cells transfected with constructs corresponding to the LPS, APS, and HPS haplotypes. Inclusion of the 800A mutation in the APS construct or the 417T, 422A, or 641T mutation in the HPS construct did not alter RNA abundance relative to that exhibited by the respective parent haplotypes. Data from (B) independent and (C) pooled Western blot experiments reveal that in cells expressing COMT, the HPS haplotype exhibited a significant reduction in protein expression compared to the LPS haplotype. This effect was not altered by inclusion of the 417T, 422A, or 641T mutations. (D) Both the APS and HPS haplotypes showed reduced enzymatic activity compared to the LPS haplotype. The modest reduction in enzymatic activity displayed by the APS haplotype and the marked reduction displayed by the HPS haplotype was not altered by inclusion of individual allelic variants of minor SNPs. Data are Mean±SEM. *P<0.05 and **P<0.01 different from the LPS haplotype.

To directly assess the potential functional impact of minor SNPs at the level of protein translation and activity, PC12 cells were transiently transfected in duplicate with constructs corresponding to the three major haplotypes or with the APS or HPS haplotype constructs containing individual allelic variants of minor SNPs (as listed above). Protein expression and enzymatic activity were subsequently measured using Western blot analysis and normetanephrine ELISA, respectively.

Consistent with previous studies [37], protein expression levels exhibited by the APS haplotype did not differ relative to the LPS haplotype, while expression levels displayed by the HPS haplotype were reduced 4.5-fold (F6,7 = 6.13, P<0.02; Fig. 2B and 2C). Inclusion of the 800A minor allele in the APS haplotype or the 417T, 422A, or 641T minor allele in the HPS haplotype did not alter protein expression relative to that exhibited by the respective parent haplotypes.

Also consistent with previous studies [37], enzymatic activity corresponding to both the APS and HPS haplotypes was reduced compared to the LPS haplotype (F6,7 = 9.24, P<0.005; Fig. 2D). The APS haplotype showed a moderate 3.5-fold reduction, while the HPS haplotype displayed a marked 58-fold reduction in enzymatic activity. Again, inclusion of individual minor alleles in the APS or HPS haplotypes did not produce effects significantly different from those associated with the parent haplotypes. It is important to note that the NMN ELISA has adequate sensitivity to detect reductions in enzymatic activity beyond those associated with the HPS haplotype. Cells transfected with clones corresponding to the HPS haplotype exhibited 5.6 ng/ml absolute NMN protein (the enzymatic activity values displayed in Figure 2 are relative values, as defined by the y-axis label). The kit is sensitive enough to detect 0.6 ng/ml NMN protein, and thus capable of capturing a 9.3–fold decrease in enzymatic activity relative to the HPS haplotype. Taken together, these results suggest that the synonymous and nonsynonymous minor SNPs tested herein do not significantly alter functional effects on COMT enzymatic activity produced by the met158 allele associated with the APS haplotype and the mRNA secondary structure associated with the HPS haplotype and, thus, can be considered neutral.


Our results are in line with those from previous studies demonstrating that the APS and HPS haplotypes, albeit to a different degree and through different mechanisms, both impair COMT function. The met158 allele included in the APS haplotype codes for a ∼3-fold reduction in COMT activity, but not amount, that is due to reduced stability of the enzyme at normal physiologic temperature. The HPS haplotype codes for a ≥20-fold reduction in COMT activity that is due to the longer more stable local stem-loop structure in the val158 region that reduces protein translation efficiency.

As an extension of this work, we next tested whether additional SNPs situated in the transcript region that occur at lower frequency in the population contribute to variation in COMT activity. We identified a total of four such minor SNPs that were linked to APS or HPS haplotypes. Interestingly, there was an inverse relationship between the frequency of minor SNPs and major haplotypes in the EST database. Three out of the four minor SNPs were linked to the least frequent HPS haplotype coding for the least COMT activity, while one was linked to the APS haplotype coding for average COMT activity, and none were linked to the most common LPS haplotype coding for the highest COMT activity. The distribution of minor SNPs exclusively within haplotypes coding for reduced COMT activity may suggest different evolutionary models (e.g., enrichment for functional compensatory mutations or positive selection leading to carrying of neutral mutations) depending on the functional contribution of these SNPs.

Compensatory SNPs have been shown to restore fitness by suppressing the deleterious effects of nonsynonymous mutations on receptor folding, DNA-binding, and enzymatic activity [31], [43], [48], [49]. Thus, minor SNPs linked to the APS haplotype may compensate for the decreased enzyme thermostability produced by the met158 allele. Compensatory SNPs have also been shown to normalize RNA secondary structure formation altered by synonymous pathogenic mutations [38], [45], [50], [51]. Thus, minor SNPs linked to the HPS haplotype may compensate for the loss of Gibbs free energy in the RNA stem-loop structure. In contrast to compensatory SNPs, the existence of neutral SNPs in APS and/or HPS haplotypes would indicate positive selection for haplotypes associated with reduced COMT activity. As COMT regulates neuronal and non-neuronal cellular pathways important for a vast number of basic and complex biologic functions, reduced COMT leading to elevated catecholamine levels could also be beneficial.

To test whether minor SNPs linked to APS or HPS haplotypes rescue COMT activity, further reduce it, or produce neutral effects, a series of molecular modeling and cell culture studies were performed. Inclusion of the 800A (rs769224) minor allele in the APS haplotype or the 417T (rs6267), 422A (740602), or 641T (rs8192488) minor alleles in the HPS haplotype did not alter mRNA folding, RNA transcription, protein translation, or enzymatic activity. The possibility remains that inclusion of minor SNPs with APS and HPS haplotypes produces very subtle effects that were not detected using our methods and might still have effects on individual fitness or that inclusion of minor SNPs produces functional effects on molecular phenotypes not evaluated in the present study.

Therefore, these minor SNPs are likely neutral variations versus functional contributors to COMT activity. However, these data are inconsistent with a simple model of an ancestral selectively advantageous haplotype and two derived deleterious haplotypes. Under a typical population genetic model the ancestral LPS haplotype should have the highest number of neutral variants, even if undergoing strong purifying selection for high activity [52]. Likewise, the more recent APS and HPS haplotypes should have a smaller number of neutral variants if undergoing background selection for deleterious low activity [52]. Why these haplotypes are more variable than the LPS haplotype is puzzling. What evolutionary processes could cause a departure from a simple model of ancestral selectivity? One possibility is that APS and HPS haplotypes are not unconditionally deleterious, but under balancing selection due to pleiotropic effects on traits other than pain sensitivity. For example, the counterintuitive selection for low activity COMT haplotypes associated with high pain, anxiety, and stress response may be driven by a gain of cognitive function related to higher dopamine and norepinephrine levels. An inverted U-shaped relationship exists between catecholamine levels and cortical function, such that intermediate levels are optimal for cognition [3]. Reduced COMT activity would produce a rightward shift in the inverted U-shaped curve, leading to higher levels of catecholamines associated with increased cognitive function advantageous for memory and attention tasks. Thus, both high and low activity haplotypes, each with opposing advantages and disadvantages, may be maintained in the population due to balancing selection [53]. While there is no evidence, to date, of greater sequence variation in the COMT locus than that expected under a neutral model [54], the distribution of minor SNPs exclusively within haplotypes associated with reduced COMT activity requires further study. The balancing selection hypothesis would need to be addressed by 1) thorough re-sequencing of the COMT gene locus followed by haplotype-based and linkage-disequilibrium-based analyses [52], [55], 2) thorough phenotyping of individuals for multiple traits (e.g., pain, cognition, and memory function), and 3) development of more complex population genetic models to account for pleiotropic selection. Whether advantageous or disadvantageous phenotypes associated with low activity COMT haplotypes are ultimately expressed, is probably determined by additional genetic and non-genetic factors.Although the significant functional impact of common APS and HPS haplotypes is independent of minor SNPs situated in the coding region of the gene, it is possible that effects of APS and HPS haplotypes are modified by epistatic interactions occurring at nearby COMT gene loci not investigated here. A previous report demonstrated that the minor allele of rs2097603 located in the MB-COMT promoter region associated with schizophrenia [34] was found to produce a 1.5-fold reduction in lymphocyte COMT activity independent of the val158met allele [56]. Additionally, a haplotype consisting of two noncoding SNPs, rs737865 in intron 1 and rs165599 in the 3′ untranslated region was associated with Schizophrenia [35] and reduced expression of COMT mRNA [57]. These SNPs are not in high LD with the SNPs constituting the three major haplotypes, however may still interact with the coding SNPs to influence the net size and direction of effect. Furthermore, a haplotype consisting of the minor alleles of rs737865 and rs4818 in the HPS haplotype are associated with increased thermal threshold variance, implicating a role for additional unobserved functional polymorphisms [40]. It is also possible that the effects of APS and HPS haplotypes are modified by epistatic interactions with mutations located in convergent molecular pathways. For example, hyperhomocysteinemia is an important risk factor for a variety of conditions associated with low COMT activity, including neurodegenerative disorders, cardiovascular disease, and hormonal cancers [58]. Homocysteine is a precursor for the biosynthesis of S-adenosyl-L-homocysteine (SAH) which is a strong, noncompetitive inhibitor of COMT. Functional polymorphisms in genes relevant to homocysteine metabolism (e.g., 5,10-methylenetetrahydrofolate reductase; MTHFR and glutamate carboxypepidase II; GCPII [59][61]) that result in accumulation of SAH likely augment the effects of APS and HPS haplotypes. In fact, a recent report demonstrated that individuals homozygous for low enzyme activity alleles of the COMT and MTHFR genes in combination, but not alone, are at increased risk for schizophrenia [62]. Thus, it is possible that minor SNPs situated within APS and HPS haplotypes compensate for low COMT activity not at the level we define, but instead through interactions with other genes or genotypes.

Additionally, the effects of APS and HPS haplotypes may be modified by nongenetic factors, such as environmental events that lead to a sustained elevation in catecholamines (e.g., physical and emotional stress, inflammation, and injury [63][65]) and nutritional deficiencies that contribute to hyperhomocysteinemia (e.g., reduced dietary folate, vitamin B12, or vitamin B6 [66], [67]). An example of COMT gene-environment interaction was recently illustrated by Slade and colleagues, who found that among individuals with the APS or HPS haplotype, TMD incidence was 23% for those with a history of orthodontic treatment and 0% for those with no history of orthodontic treatment [68]. In order to truly understand the dynamic etiology of complex catechol-dependent phenotypes, flashlights used to examine the relationship between one SNP and one phenotype need to be traded in for floodlights that will illuminate dynamic relationships between genetic and epigenetic factors. Thus, future studies necessitate careful consideration as to how polymorphisms within and between distinct genetic loci interact with one another as well as with nongenetic factors to place individuals at risk.

The 417T allele was previously associated with clinical effects. This minor SNP, producing an alanine to serine substitution at codon 72, has been associated with aggressive behavior and schizophrenia risk as well as with COMT activity in red blood cells collected from study participants [32], [33]. However, we found that the functional impact of common APS and HPS haplotypes is independent of this less frequent second-site mutation situated in the coding region of the human COMT gene. In light of this, we can revisit the conclusion regarding effects previously associated with 417T. In that study, individuals homozygous for 417G (ala72) had the highest activity, while those homozygous for 417T (ser72) had the lowest activity. Individuals exhibiting both the highest and lowest COMT activity were homozygous for the val158 allele, which is present in both the LPS and HPS haplotypes. In correspondence with the APS haplotype, individuals exhibiting average COMT activity were homozygous for the met158 allele. As 417T is carried exclusively with the HPS haplotype and its inclusion in this parent haplotype does not alter enzymatic activity, we can conclude that 417T is a marker of HPS haplotype and that the low activity associated with the nonsynonymous ser72 allele is in fact due to alterations in RNA secondary structure and protein translation efficiency coded for by the parent HPS haplotype.

In summary, we demonstrated that the impact of common COMT haplotypes on enzymatic activity is independent of additional minor SNPs in the coding region of the human COMT gene. Tight linkage of these neutral polymorphisms with more recently acquired low activity APS and HPS haplotypes does not satisfy a simple ancestral model and requires the development of a more complex population genetic model to account for pleiotropic selection. The counterintuitive selection for low activity COMT haplotypes may be driven by a gain of cognitive function, for example, related to increased catecholamine levels. Thus, the expression “no pain – no gain” may have literal meaning when applied to evolution of the human COMT locus.

Materials and Methods

EST database analysis

Using an approach similar to that used previously [69], we first performed a BLAST search of the human EST database (dbEST release May 09, 2008) to identify all allelic combinations occurring within the complete nucleotide sequence of MB-COMT mRNA (NM_000754.2, length = 1289 nucleotides). We then selected all matching ESTs longer than 100 nucleotides, so that at least 80% of their length overlapped with the COMT sequence with 95% similarity. The list of ESTs was then constrained to those containing all three SNPs in the coding region (rs4633, rs4818 and rs4680) needed to identify the three major COMT haplotypes. Analysis of nucleotide variation within the three haplotypes was restricted to SNPs with frequency of at least 1%. The minor allele frequency of minor SNPs in our constrained EST list corresponded to that annotated in the NCBI dbSNP.

Prediction of RNA secondary structure

Secondary structures of the full-length APS, APS+800A, HPS, HPS+417T, HPS+422A, and HPS+641T mRNA transcripts were predicted using the RNA Mfold program (versions 3.1 and 3.2) [46] and the Afold program [47]. Energy minimization was performed by a dynamic programming method that finds the secondary structure with the minimum free energy with sums comprised of stacking, loop length, etc. [47], [70]. The RNA folding parameters were developed and published by the Turner group [71]. Suboptimal stem-loop structures were analyzed by the Hybrid program [72], [73] for the full-length COMT transcripts, and for truncated transcript sequences of different lengths ranging from the rs4633 to the rs769224 region with 449 nucleotide window length.

Construction of COMT variants

Previously constructed full-length cDNA COMT clones that differed only in three nucleotides corresponding to the LPS, APS, and HPS haplotypes were used [37]. Four individual minor SNPs were introduced in the parent APS (rs769224; 800G→A) or HPS (rs6267; 417G→T, rs740602; 422G→A, or rs8192488; 641C→T) constructs by site directed mutagenesis using the Quickchange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). Plasmid DNA was purified using the EndoFree Plasmid Maxi purification kit (Qiagen, Germantown, MD, USA). Once plasmids were isolated, DNA sequences were confirmed by double sequencing at the UNC core sequencing facility.

Transient transfection of COMT cDNA clones

A rat adrenal cell line (PC-12) was transiently transfected in six-well plates using FuGENE 6 Transfection Reagent (Roche, Basel, Switzerland) in accordance with manufacture's recommendations. The amount of plasmid was kept at 1 µg/well. Cells were cotransfected with pSV-βGalactosidase (0.1 µg/well) and SEAP (0.1 µg/well) plasmids to control for transfection efficiency and RNA abundance, respectively (Promega, Madison, WI, USA). Transfections with the vector lacking the insert were also done for each experiment. The same cell line was used for analysis of total RNA, protein expression, and enzymatic activity. Transfection experiments for analysis of total RNA and protein expression/enzymatic activity were performed in duplicate concurrently. Cell lysate was then collected approximately 48 hours post-transfection.

Real-time PCR

Total RNA was isolated using the Trizol reagent (Invitrogen, Carlsbad, CA, USA). The isolated RNA was treated with RNase free-DNase I (Promega) and reverse transcribed by Superscript III reverse transcriptase (Invitrogen). The cDNA for COMT and SEAP was amplified with SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) using forward and reverse PCR primers (TGAACGTGGGCGACAAGAAAGGCAAGAT and TGACCTTGTCCTTCACGCCAGCGAAAT, respectively, for COMT and GCCGACCACTCCCACGTCTT and CCCGCTCTCGCTCTCGGTAA, respectively, for SEAP). SEAP was used to normalize COMT RNA abundance for transfection efficiency. The MCEP Realplex 2S System (Eppendorf, Westbury, NY, USA) was used for measuring fluorescence.

Western blot

Purified lysates, normalized for protein content using a BCA assay, were run on 12% Novex Tris-Glycine gels (Invitrogen) and transferred to nitrocellulose membranes (Whatman, Florham Park, NJ, USA). Blots containing COMT protein were blocked with 5% nonfat milk for 30 min at room temperature, incubated with COMT polyclonal primary antibody (1∶10,000; Chemicon, Temecula, CA, USA) overnight at 4°C, and then incubated with Goat Anti-Rabbit IgG HRP polyclonal secondary antibody (1∶10,000; Chemicon) for 1 hr at room temperature. Blots were washed with PBST for 10 min at RT, exposed to chemiluminescence reagent (Pierce, Milwaukee, WI, USA), and developed. Blots were then stripped using Restore western stripping buffer (Pierce) and equal loading of samples verified by β-actin staining. Blots were incubated with β-actin polyclonal primary antibody (1∶10,000; Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 hr at RT followed by Goat Anti-Rabbit IgG HRP polyclonal secondary antibody (1∶10,000; Chemicon) for 1 hr at RT and chemiluminescent reagent.

Enzymatic assay

After removal of the media, the cells were washed twice with 0.9% saline (1 ml/well) and covered with deionized water containing 10 mM CDTA (300 µl/well). The cells were freeze/thawed (−80°C/room temperature) five times and the lysate collected in 1.7 ml tubes. The tubes were centrifuged at 2,000 g for 20 minutes and the filtrate removed. The enzymatic COMT assay procedure followed the protocol described by Masuda's group [74]. Purified lysates (8 µl) were incubated with 200 µM Sadenosyl-L-methionine (SAMe; ICN Chemicals, Aurora OH, USA), 7.5 mM L-norepinephrine (NE; Sigma Chemical Co., St. Louis MO, USA) and 2 mM MgCl2 in 50 mM phosphate buffered saline for 60 min in the final volume of 22 µl. The reaction was terminated using 20 µl of 0.4 M hydrocholoric acid and 1 µl of 330 mM EDTA. The same reaction in the presence of 15 mM EDTA was carried out in parallel for each lysate to bind Mg+2 ions required for COMT activity. COMT activity was assessed as measurement of normetanephrine (NMN) by Normetanephrine ELISA kit (IBL, Hamburg, Germany) in accordance with manufacture's recommendations using 10 µl of above reaction mixture. COMT activity was determined after subtracting the amount of NMN produced by endogenous enzymatic activity (transfection with empty vector). The non-specific background was determined in parallel assays performed in the presence of EDTA and then subtracted from each reading. COMT activity was then normalized for transfection efficiency by measuring the β-galactosidase activity for each lysate. β-galactosidase activity was determined using β-galactosidase enzyme systems (Promega) in accordance with manufacture's recommendations. The standard curve for ELISA was determined using a 4 parameter sigmoidal dose-response model for one-site competitive binding systems. The lowest detectable level that can be distinguished from the zero standard is 0.6 ng/ml.

Statistical analysis

COMT RNA abundance, protein expression, and enzyme activity levels from duplicate experiments were analyzed by one-way analysis of variance (ANOVA). Post hoc comparisons were performed using Bonferroni's Multiple Comparison Test. P<0.05 was considered significant.


The authors would like to express their deep gratitude to Dr. Trudy Mackay for her constructive and insightful feedback on our manuscript and interpretation of results.

Author Contributions

Conceived and designed the experiments: AGN LD SAS. Performed the experiments: AGN SAS JEL MSC DGG SKS. Analyzed the data: AGN SAS JEL MSC DGG ANS. Wrote the paper: AGN LD SAS.


  1. 1. Lundstrom K, Salminen M, Jalanko A, Savolainen R, Ulmanen I (1991) Cloning and characterization of human placental catechol-O-methyltransferase cDNA. DNA Cell Biol 10: 181–189.K. LundstromM. SalminenA. JalankoR. SavolainenI. Ulmanen1991Cloning and characterization of human placental catechol-O-methyltransferase cDNA.DNA Cell Biol10181189
  2. 2. Tenhunen J, Salminen M, Jalanko A, Ukkonen S, Ulmanen I (1993) Structure of the rat catechol-O-methyltransferase gene: separate promoters are used to produce mRNAs for soluble and membrane-bound forms of the enzyme. DNA Cell Biol 12: 253–263.J. TenhunenM. SalminenA. JalankoS. UkkonenI. Ulmanen1993Structure of the rat catechol-O-methyltransferase gene: separate promoters are used to produce mRNAs for soluble and membrane-bound forms of the enzyme.DNA Cell Biol12253263
  3. 3. Tunbridge EM, Harrison PJ, Weinberger DR (2006) Catechol-o-methyltransferase, cognition, and psychosis: Val158Met and beyond. Biol Psychiatry 60: 141–151.EM TunbridgePJ HarrisonDR Weinberger2006Catechol-o-methyltransferase, cognition, and psychosis: Val158Met and beyond.Biol Psychiatry60141151
  4. 4. Williams HJ, Owen MJ, O'Donovan MC (2007) Is COMT a susceptibility gene for schizophrenia? Schizophr Bull 33: 635–641.HJ WilliamsMJ OwenMC O'Donovan2007Is COMT a susceptibility gene for schizophrenia?Schizophr Bull33635641
  5. 5. Hayden EP, Nurnberger JI Jr (2006) Molecular genetics of bipolar disorder. Genes Brain Behav 5: 85–95.EP HaydenJI Nurnberger Jr2006Molecular genetics of bipolar disorder.Genes Brain Behav58595
  6. 6. Alsobrook JP 2nd, Zohar AH, Leboyer M, Chabane N, Ebstein RP, et al. (2002) Association between the COMT locus and obsessive-compulsive disorder in females but not males. Am J Med Genet 114: 116–120.JP Alsobrook 2ndAH ZoharM. LeboyerN. ChabaneRP Ebstein2002Association between the COMT locus and obsessive-compulsive disorder in females but not males.Am J Med Genet114116120
  7. 7. Karayiorgou M, Altemus M, Galke BL, Goldman D, Murphy DL, et al. (1997) Genotype determining low catechol-O-methyltransferase activity as a risk factor for obsessive-compulsive disorder. Proc Natl Acad Sci U S A 94: 4572–4575.M. KarayiorgouM. AltemusBL GalkeD. GoldmanDL Murphy1997Genotype determining low catechol-O-methyltransferase activity as a risk factor for obsessive-compulsive disorder.Proc Natl Acad Sci U S A9445724575
  8. 8. Domschke K, Freitag CM, Kuhlenbaumer G, Schirmacher A, Sand P, et al. (2004) Association of the functional V158M catechol-O-methyl-transferase polymorphism with panic disorder in women. Int J Neuropsychopharmacol 7: 183–188.K. DomschkeCM FreitagG. KuhlenbaumerA. SchirmacherP. Sand2004Association of the functional V158M catechol-O-methyl-transferase polymorphism with panic disorder in women.Int J Neuropsychopharmacol7183188
  9. 9. McGrath M, Kawachi I, Ascherio A, Colditz GA, Hunter DJ, et al. (2004) Association between catechol-O-methyltransferase and phobic anxiety. Am J Psychiatry 161: 1703–1705.M. McGrathI. KawachiA. AscherioGA ColditzDJ Hunter2004Association between catechol-O-methyltransferase and phobic anxiety.Am J Psychiatry16117031705
  10. 10. Woo JM, Yoon KS, Choi YH, Oh KS, Lee YS, et al. (2004) The association between panic disorder and the L/L genotype of catechol-O-methyltransferase. J Psychiatr Res 38: 365–370.JM WooKS YoonYH ChoiKS OhYS Lee2004The association between panic disorder and the L/L genotype of catechol-O-methyltransferase.J Psychiatr Res38365370
  11. 11. Qian Q, Wang Y, Zhou R, Li J, Wang B, et al. (2003) Family-based and case-control association studies of catechol-O-methyltransferase in attention deficit hyperactivity disorder suggest genetic sexual dimorphism. Am J Med Genet B Neuropsychiatr Genet 118B: 103–109.Q. QianY. WangR. ZhouJ. LiB. Wang2003Family-based and case-control association studies of catechol-O-methyltransferase in attention deficit hyperactivity disorder suggest genetic sexual dimorphism.Am J Med Genet B Neuropsychiatr Genet118B103109
  12. 12. Sengupta S, Grizenko N, Schmitz N, Schwartz G, Bellingham J, et al. (2008) COMT Val(108/158)Met Polymorphism and the Modulation of Task-Oriented Behavior in Children with ADHD. Neuropsychopharmacology. S. SenguptaN. GrizenkoN. SchmitzG. SchwartzJ. Bellingham2008COMT Val(108/158)Met Polymorphism and the Modulation of Task-Oriented Behavior in Children with ADHD.Neuropsychopharmacology
  13. 13. Oroszi G, Goldman D (2004) Alcoholism: genes and mechanisms. Pharmacogenomics 5: 1037–1048.G. OrosziD. Goldman2004Alcoholism: genes and mechanisms.Pharmacogenomics510371048
  14. 14. Frisch A, Laufer N, Danziger Y, Michaelovsky E, Leor S, et al. (2001) Association of anorexia nervosa with the high activity allele of the COMT gene: a family-based study in Israeli patients. Mol Psychiatry 6: 243–245.A. FrischN. LauferY. DanzigerE. MichaelovskyS. Leor2001Association of anorexia nervosa with the high activity allele of the COMT gene: a family-based study in Israeli patients.Mol Psychiatry6243245
  15. 15. Michaelovsky E, Gothelf D, Korostishevsky M, Frisch A, Burg M, et al. (2008) Association between a common haplotype in the COMT gene region and psychiatric disorders in individuals with 22q11.2DS. Int J Neuropsychopharmacol 11: 351–363.E. MichaelovskyD. GothelfM. KorostishevskyA. FrischM. Burg2008Association between a common haplotype in the COMT gene region and psychiatric disorders in individuals with 22q11.2DS.Int J Neuropsychopharmacol11351363
  16. 16. Kunugi H, Nanko S, Ueki A, Otsuka E, Hattori M, et al. (1997) High and low activity alleles of catechol-O-methyltransferase gene: ethnic difference and possible association with Parkinson's disease. Neurosci Lett 221: 202–204.H. KunugiS. NankoA. UekiE. OtsukaM. Hattori1997High and low activity alleles of catechol-O-methyltransferase gene: ethnic difference and possible association with Parkinson's disease.Neurosci Lett221202204
  17. 17. Yoritaka A, Hattori N, Yoshino H, Mizuno Y (1997) Catechol-O-methyltransferase genotype and susceptibility to Parkinson's disease in Japan. Short communication. J Neural Transm 104: 1313–1317.A. YoritakaN. HattoriH. YoshinoY. Mizuno1997Catechol-O-methyltransferase genotype and susceptibility to Parkinson's disease in Japan. Short communication.J Neural Transm10413131317
  18. 18. Hintsanen M, Elovainio M, Puttonen S, Kivimaki M, Lehtimaki T, et al. (2008) Val/Met Polymorphism of the COMT Gene Moderates the Association Between Job Strain and Early Atherosclerosis in Young Men. J Occup Environ Med 50: 649–657.M. HintsanenM. ElovainioS. PuttonenM. KivimakiT. Lehtimaki2008Val/Met Polymorphism of the COMT Gene Moderates the Association Between Job Strain and Early Atherosclerosis in Young Men.J Occup Environ Med50649657
  19. 19. Kamide K, Kokubo Y, Yang J, Matayoshi T, Inamoto N, et al. (2007) Association of genetic polymorphisms of ACADSB and COMT with human hypertension. J Hypertens 25: 103–110.K. KamideY. KokuboJ. YangT. MatayoshiN. Inamoto2007Association of genetic polymorphisms of ACADSB and COMT with human hypertension.J Hypertens25103110
  20. 20. Lavigne JA, Helzlsouer KJ, Huang HY, Strickland PT, Bell DA, et al. (1997) An association between the allele coding for a low activity variant of catechol-O-methyltransferase and the risk for breast cancer. Cancer Res 57: 5493–5497.JA LavigneKJ HelzlsouerHY HuangPT StricklandDA Bell1997An association between the allele coding for a low activity variant of catechol-O-methyltransferase and the risk for breast cancer.Cancer Res5754935497
  21. 21. Thompson PA, Shields PG, Freudenheim JL, Stone A, Vena JE, et al. (1998) Genetic polymorphisms in catechol-O-methyltransferase, menopausal status, and breast cancer risk. Cancer Res 58: 2107–2110.PA ThompsonPG ShieldsJL FreudenheimA. StoneJE Vena1998Genetic polymorphisms in catechol-O-methyltransferase, menopausal status, and breast cancer risk.Cancer Res5821072110
  22. 22. Nackley AG, Tan KS, Fecho K, Flood P, Diatchenko L, et al. (2007) Catechol-O-methyltransferase inhibition increases pain sensitivity through activation of both beta2- and beta3-adrenergic receptors. Pain 128: 199–208.AG NackleyKS TanK. FechoP. FloodL. Diatchenko2007Catechol-O-methyltransferase inhibition increases pain sensitivity through activation of both beta2- and beta3-adrenergic receptors.Pain128199208
  23. 23. Nackley AG, Tan KS, Fecho K, Flood P, Maixner W, et al. AG NackleyKS TanK. FechoP. FloodW. MaixnerCOMT modulates pain sensitivity and cytokine production through both ß2 and ß3 adrenergic receptors; 2005; Washington, DC. COMT modulates pain sensitivity and cytokine production through both ß2 and ß3 adrenergic receptors; 2005; Washington, DC.
  24. 24. Marbach JJ, Levitt M (1976) Erythrocyte catechol-O-methyltransferase activity in facial pain patients. J Dent Res 55: 711.JJ MarbachM. Levitt1976Erythrocyte catechol-O-methyltransferase activity in facial pain patients.J Dent Res55711
  25. 25. Gursoy S, Erdal E, Herken H, Madenci E, Alasehirli B, et al. (2003) Significance of catechol-O-methyltransferase gene polymorphism in fibromyalgia syndrome. Rheumatol Int 23: 104–107.S. GursoyE. ErdalH. HerkenE. MadenciB. Alasehirli2003Significance of catechol-O-methyltransferase gene polymorphism in fibromyalgia syndrome.Rheumatol Int23104107
  26. 26. Vargas-Alarcon G, Fragoso JM, Cruz-Robles D, Vargas A, Vargas A, et al. (2007) Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia. Arthritis Res Ther 9: R110.G. Vargas-AlarconJM FragosoD. Cruz-RoblesA. VargasA. Vargas2007Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia.Arthritis Res Ther9R110
  27. 27. Diatchenko L, Slade GD, Nackley AG, Bhalang K, Sigurdsson A, et al. (2005) Genetic basis for individual variations in pain perception and the development of a chronic pain condition. Hum Mol Genet 14: 135–143.L. DiatchenkoGD SladeAG NackleyK. BhalangA. Sigurdsson2005Genetic basis for individual variations in pain perception and the development of a chronic pain condition.Hum Mol Genet14135143
  28. 28. Zubieta JK, Heitzeg MM, Smith YR, Bueller JA, Xu K, et al. (2003) COMT val158met genotype affects mu-opioid neurotransmitter responses to a pain stressor. Science 299: 1240–1243.JK ZubietaMM HeitzegYR SmithJA BuellerK. Xu2003COMT val158met genotype affects mu-opioid neurotransmitter responses to a pain stressor.Science29912401243
  29. 29. Rakvag TT, Klepstad P, Baar C, Kvam TM, Dale O, et al. (2005) The Val158Met polymorphism of the human catechol-O-methyltransferase (COMT) gene may influence morphine requirements in cancer pain patients. Pain 116: 73–78.TT RakvagP. KlepstadC. BaarTM KvamO. Dale2005The Val158Met polymorphism of the human catechol-O-methyltransferase (COMT) gene may influence morphine requirements in cancer pain patients.Pain1167378
  30. 30. Lotta T, Vidgren J, Tilgmann C, Ulmanen I, Melen K, et al. (1995) Kinetics of human soluble and membrane-bound catechol O-methyltransferase: a revised mechanism and description of the thermolabile variant of the enzyme. Biochemistry 34: 4202–4210.T. LottaJ. VidgrenC. TilgmannI. UlmanenK. Melen1995Kinetics of human soluble and membrane-bound catechol O-methyltransferase: a revised mechanism and description of the thermolabile variant of the enzyme.Biochemistry3442024210
  31. 31. Chen R, Grobler JA, Hurley JH, Dean AM (1996) Second-site suppression of regulatory phosphorylation in Escherichia coli isocitrate dehydrogenase. Protein Sci 5: 287–295.R. ChenJA GroblerJH HurleyAM Dean1996Second-site suppression of regulatory phosphorylation in Escherichia coli isocitrate dehydrogenase.Protein Sci5287295
  32. 32. Hong JP, Lee JS, Chung S, Jung J, Yoo HK, et al. (2008) New functional single nucleotide polymorphism (Ala72Ser) in the COMT gene is associated with aggressive behavior in male schizophrenia. Am J Med Genet B Neuropsychiatr Genet 147B: 658–660.JP HongJS LeeS. ChungJ. JungHK Yoo2008New functional single nucleotide polymorphism (Ala72Ser) in the COMT gene is associated with aggressive behavior in male schizophrenia.Am J Med Genet B Neuropsychiatr Genet147B658660
  33. 33. Lee SG, Joo Y, Kim B, Chung S, Kim HL, et al. (2005) Association of Ala72Ser polymorphism with COMT enzyme activity and the risk of schizophrenia in Koreans. Hum Genet 116: 319–328.SG LeeY. JooB. KimS. ChungHL Kim2005Association of Ala72Ser polymorphism with COMT enzyme activity and the risk of schizophrenia in Koreans.Hum Genet116319328
  34. 34. Palmatier MA, Pakstis AJ, Speed W, Paschou P, Goldman D, et al. (2004) COMT haplotypes suggest P2 promoter region relevance for schizophrenia. Mol Psychiatry 9: 859–870.MA PalmatierAJ PakstisW. SpeedP. PaschouD. Goldman2004COMT haplotypes suggest P2 promoter region relevance for schizophrenia.Mol Psychiatry9859870
  35. 35. Shifman S, Bronstein M, Sternfeld M, Pisante-Shalom A, Lev-Lehman E, et al. (2002) A highly significant association between a COMT haplotype and schizophrenia. Am J Hum Genet 71: 1296–1302.S. ShifmanM. BronsteinM. SternfeldA. Pisante-ShalomE. Lev-Lehman2002A highly significant association between a COMT haplotype and schizophrenia.Am J Hum Genet7112961302
  36. 36. Diatchenko L, Nackley AG, Slade GD, Bhalang K, Belfer I, et al. (2006) Catechol-O-methyltransferase gene polymorphisms are associated with multiple pain-evoking stimuli. Pain 125: 216–224.L. DiatchenkoAG NackleyGD SladeK. BhalangI. Belfer2006Catechol-O-methyltransferase gene polymorphisms are associated with multiple pain-evoking stimuli.Pain125216224
  37. 37. Nackley AG, Shabalina SA, Tchivileva IE, Satterfield K, Korchynskyi O, et al. (2006) Human catechol-O-methyltransferase haplotypes modulate protein expression by altering mRNA secondary structure. Science 314: 1930–1933.AG NackleySA ShabalinaIE TchivilevaK. SatterfieldO. Korchynskyi2006Human catechol-O-methyltransferase haplotypes modulate protein expression by altering mRNA secondary structure.Science31419301933
  38. 38. Kimura M (1985) The role of compensatory neutral mutations in molecular evolution. J Genet 64: 7–19.M. Kimura1985The role of compensatory neutral mutations in molecular evolution.J Genet64719
  39. 39. Kreitman M, Hudson RR (1991) Inferring the evolutionary histories of the Adh and Adh-dup loci in Drosophila melanogaster from patterns of polymorphism and divergence. Genetics 127: 565–582.M. KreitmanRR Hudson1991Inferring the evolutionary histories of the Adh and Adh-dup loci in Drosophila melanogaster from patterns of polymorphism and divergence.Genetics127565582
  40. 40. Shibata K, Diatchenko L, Zaykin DV (2008) Haplotype associations with quantitative traits in the presence of complex multilocus and heterogeneous effects. Genet Epidemiol. K. ShibataL. DiatchenkoDV Zaykin2008Haplotype associations with quantitative traits in the presence of complex multilocus and heterogeneous effects.Genet Epidemiol
  41. 41. Cargill M, Altshuler D, Ireland J, Sklar P, Ardlie K, et al. (1999) Characterization of single-nucleotide polymorphisms in coding regions of human genes. Nat Genet 22: 231–238.M. CargillD. AltshulerJ. IrelandP. SklarK. Ardlie1999Characterization of single-nucleotide polymorphisms in coding regions of human genes.Nat Genet22231238
  42. 42. Kaplan N, Morris R (2001) Issues concerning association studies for fine mapping a susceptibility gene for a complex disease. Genet Epidemiol 20: 432–457.N. KaplanR. Morris2001Issues concerning association studies for fine mapping a susceptibility gene for a complex disease.Genet Epidemiol20432457
  43. 43. Kondrashov AS, Sunyaev S, Kondrashov FA (2002) Dobzhansky-Muller incompatibilities in protein evolution. Proc Natl Acad Sci U S A 99: 14878–14883.AS KondrashovS. SunyaevFA Kondrashov2002Dobzhansky-Muller incompatibilities in protein evolution.Proc Natl Acad Sci U S A991487814883
  44. 44. Simmons GM, Kwok W, Matulonis P, Venkatesh T (1994) Polymorphism and divergence at the prune locus in Drosophila melanogaster and D. simulans. Mol Biol Evol 11: 666–671.GM SimmonsW. KwokP. MatulonisT. Venkatesh1994Polymorphism and divergence at the prune locus in Drosophila melanogaster and D. simulans.Mol Biol Evol11666671
  45. 45. Kirby DA, Muse SV, Stephan W (1995) Maintenance of pre-mRNA secondary structure by epistatic selection. Proc Natl Acad Sci U S A 92: 9047–9051.DA KirbySV MuseW. Stephan1995Maintenance of pre-mRNA secondary structure by epistatic selection.Proc Natl Acad Sci U S A9290479051
  46. 46. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31: 3406–3415.M. Zuker2003Mfold web server for nucleic acid folding and hybridization prediction.Nucleic Acids Res3134063415
  47. 47. Ogurtsov AY, Shabalina SA, Kondrashov AS, Roytberg MA (2006) Analysis of internal loops within the RNA secondary structure in almost quadratic time. Bioinformatics. AY OgurtsovSA ShabalinaAS KondrashovMA Roytberg2006Analysis of internal loops within the RNA secondary structure in almost quadratic time.Bioinformatics
  48. 48. Izumi T, Malecki J, Chaudhry MA, Weinfeld M, Hill JH, et al. (1999) Intragenic suppression of an active site mutation in the human apurinic/apyrimidinic endonuclease. J Mol Biol 287: 47–57.T. IzumiJ. MaleckiMA ChaudhryM. WeinfeldJH Hill1999Intragenic suppression of an active site mutation in the human apurinic/apyrimidinic endonuclease.J Mol Biol2874757
  49. 49. Schulein R, Zuhlke K, Krause G, Rosenthal W (2001) Functional rescue of the nephrogenic diabetes insipidus-causing vasopressin V2 receptor mutants G185C and R202C by a second site suppressor mutation. J Biol Chem 276: 8384–8392.R. SchuleinK. ZuhlkeG. KrauseW. Rosenthal2001Functional rescue of the nephrogenic diabetes insipidus-causing vasopressin V2 receptor mutants G185C and R202C by a second site suppressor mutation.J Biol Chem27683848392
  50. 50. Duan J, Wainwright MS, Comeron JM, Saitou N, Sanders AR, et al. (2003) Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum Mol Genet 12: 205–216.J. DuanMS WainwrightJM ComeronN. SaitouAR Sanders2003Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor.Hum Mol Genet12205216
  51. 51. Kern AD, Kondrashov FA (2004) Mechanisms and convergence of compensatory evolution in mammalian mitochondrial tRNAs. Nat Genet 36: 1207–1212.AD KernFA Kondrashov2004Mechanisms and convergence of compensatory evolution in mammalian mitochondrial tRNAs.Nat Genet3612071212
  52. 52. Nielsen R, Hellmann I, Hubisz M, Bustamante C, Clark AG (2007) Recent and ongoing selection in the human genome. Nat Rev Genet 8: 857–868.R. NielsenI. HellmannM. HubiszC. BustamanteAG Clark2007Recent and ongoing selection in the human genome.Nat Rev Genet8857868
  53. 53. Zhu G, Lipsky RH, Xu K, Ali S, Hyde T, et al. (2004) Differential expression of human COMT alleles in brain and lymphoblasts detected by RT-coupled 5′ nuclease assay. Psychopharmacology (Berl) 177: 178–184.G. ZhuRH LipskyK. XuS. AliT. Hyde2004Differential expression of human COMT alleles in brain and lymphoblasts detected by RT-coupled 5′ nuclease assay.Psychopharmacology (Berl)177178184
  54. 54. Bubb KL, Bovee D, Buckley D, Haugen E, Kibukawa M, et al. (2006) Scan of human genome reveals no new Loci under ancient balancing selection. Genetics 173: 2165–2177.KL BubbD. BoveeD. BuckleyE. HaugenM. Kibukawa2006Scan of human genome reveals no new Loci under ancient balancing selection.Genetics17321652177
  55. 55. Tishkoff SA, Varkonyi R, Cahinhinan N, Abbes S, Argyropoulos G, et al. (2001) Haplotype diversity and linkage disequilibrium at human G6PD: recent origin of alleles that confer malarial resistance. Science 293: 455–462.SA TishkoffR. VarkonyiN. CahinhinanS. AbbesG. Argyropoulos2001Haplotype diversity and linkage disequilibrium at human G6PD: recent origin of alleles that confer malarial resistance.Science293455462
  56. 56. Chen J, Lipska BK, Halim N, Ma QD, Matsumoto M, et al. (2004) Functional analysis of genetic variation in catechol-O-methyltransferase (COMT): effects on mRNA, protein, and enzyme activity in postmortem human brain. Am J Hum Genet 75: 807–821.J. ChenBK LipskaN. HalimQD MaM. Matsumoto2004Functional analysis of genetic variation in catechol-O-methyltransferase (COMT): effects on mRNA, protein, and enzyme activity in postmortem human brain.Am J Hum Genet75807821
  57. 57. Bray NJ, Buckland PR, Williams NM, Williams HJ, Norton N, et al. (2003) A haplotype implicated in schizophrenia susceptibility is associated with reduced COMT expression in human brain. Am J Hum Genet 73: 152–161.NJ BrayPR BucklandNM WilliamsHJ WilliamsN. Norton2003A haplotype implicated in schizophrenia susceptibility is associated with reduced COMT expression in human brain.Am J Hum Genet73152161
  58. 58. Zhu BT (2002) On the mechanism of homocysteine pathophysiology and pathogenesis: a unifying hypothesis. Histol Histopathol 17: 1283–1291.BT Zhu2002On the mechanism of homocysteine pathophysiology and pathogenesis: a unifying hypothesis.Histol Histopathol1712831291
  59. 59. Devlin AM, Ling EH, Peerson JM, Fernando S, Clarke R, et al. (2000) Glutamate carboxypeptidase II: a polymorphism associated with lower levels of serum folate and hyperhomocysteinemia. Hum Mol Genet 9: 2837–2844.AM DevlinEH LingJM PeersonS. FernandoR. Clarke2000Glutamate carboxypeptidase II: a polymorphism associated with lower levels of serum folate and hyperhomocysteinemia.Hum Mol Genet928372844
  60. 60. Engbersen AM, Franken DG, Boers GH, Stevens EM, Trijbels FJ, et al. (1995) Thermolabile 5,10-methylenetetrahydrofolate reductase as a cause of mild hyperhomocysteinemia. Am J Hum Genet 56: 142–150.AM EngbersenDG FrankenGH BoersEM StevensFJ Trijbels1995Thermolabile 5,10-methylenetetrahydrofolate reductase as a cause of mild hyperhomocysteinemia.Am J Hum Genet56142150
  61. 61. Lievers KJ, Kluijtmans LA, Boers GH, Verhoef P, den Heijer M, et al. (2002) Influence of a glutamate carboxypeptidase II (GCPII) polymorphism (1561C→T) on plasma homocysteine, folate and vitamin B(12) levels and its relationship to cardiovascular disease risk. Atherosclerosis 164: 269–273.KJ LieversLA KluijtmansGH BoersP. VerhoefM. den Heijer2002Influence of a glutamate carboxypeptidase II (GCPII) polymorphism (1561C→T) on plasma homocysteine, folate and vitamin B(12) levels and its relationship to cardiovascular disease risk.Atherosclerosis164269273
  62. 62. Muntjewerff JW, Gellekink H, den Heijer M, Hoogendoorn ML, Kahn RS, et al. (2008) Polymorphisms in catechol-O-methyltransferase and methylenetetrahydrofolate reductase in relation to the risk of schizophrenia. Eur Neuropsychopharmacol 18: 99–106.JW MuntjewerffH. GellekinkM. den HeijerML HoogendoornRS Kahn2008Polymorphisms in catechol-O-methyltransferase and methylenetetrahydrofolate reductase in relation to the risk of schizophrenia.Eur Neuropsychopharmacol1899106
  63. 63. Goldstein DS (2003) Catecholamines and stress. Endocr Regul 37: 69–80.DS Goldstein2003Catecholamines and stress.Endocr Regul376980
  64. 64. Harden RN, Rudin NJ, Bruehl S, Kee W, Parikh DK, et al. (2004) Increased systemic catecholamines in complex regional pain syndrome and relationship to psychological factors: a pilot study. Anesth Analg 99: 1478–1485.RN HardenNJ RudinS. BruehlW. KeeDK Parikh2004Increased systemic catecholamines in complex regional pain syndrome and relationship to psychological factors: a pilot study.Anesth Analg9914781485table of contents. table of contents.
  65. 65. Raja SN (1995) Role of the sympathetic nervous system in acute pain and inflammation. Ann Med 27: 241–246.SN Raja1995Role of the sympathetic nervous system in acute pain and inflammation.Ann Med27241246
  66. 66. Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, et al. (1995) A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet 10: 111–113.P. FrosstHJ BlomR. MilosP. GoyetteCA Sheppard1995A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase.Nat Genet10111113
  67. 67. Nygard O, Refsum H, Ueland PM, Vollset SE (1998) Major lifestyle determinants of plasma total homocysteine distribution: the Hordaland Homocysteine Study. Am J Clin Nutr 67: 263–270.O. NygardH. RefsumPM UelandSE Vollset1998Major lifestyle determinants of plasma total homocysteine distribution: the Hordaland Homocysteine Study.Am J Clin Nutr67263270
  68. 68. Slade GD, Diatchenko L, Ohrbach R, Maixner W (2008) Orthodontic Treatment, Genetic Factors and Risk of Temporomandibular Disorder. Semin Orthod 14: 146–156.GD SladeL. DiatchenkoR. OhrbachW. Maixner2008Orthodontic Treatment, Genetic Factors and Risk of Temporomandibular Disorder.Semin Orthod14146156
  69. 69. Diatchenko L, Anderson AD, Slade GD, Fillingim RB, Shabalina SA, et al. (2006) Three major haplotypes of the beta2 adrenergic receptor define psychological profile, blood pressure, and the risk for development of a common musculoskeletal pain disorder. Am J Med Genet B Neuropsychiatr Genet 141B: 449–462.L. DiatchenkoAD AndersonGD SladeRB FillingimSA Shabalina2006Three major haplotypes of the beta2 adrenergic receptor define psychological profile, blood pressure, and the risk for development of a common musculoskeletal pain disorder.Am J Med Genet B Neuropsychiatr Genet141B449462
  70. 70. Shabalina SA, Ogurtsov AY, Spiridonov NA (2006) A periodic pattern of mRNA secondary structure created by the genetic code. Nucleic Acids Res 34: 2428–2437.SA ShabalinaAY OgurtsovNA Spiridonov2006A periodic pattern of mRNA secondary structure created by the genetic code.Nucleic Acids Res3424282437
  71. 71. Mathews DH, Sabina J, Zuker M, Turner DH (1999) Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 288: 911–940.DH MathewsJ. SabinaM. ZukerDH Turner1999Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure.J Mol Biol288911940
  72. 72. Nazipova NN, Shabalina SA, Ogurtsov A, Kondrashov AS, Roytberg MA, et al. (1995) SAMSON: a software package for the biopolymer primary structure analysis. Comput Appl Biosci 11: 423–426.NN NazipovaSA ShabalinaA. OgurtsovAS KondrashovMA Roytberg1995SAMSON: a software package for the biopolymer primary structure analysis.Comput Appl Biosci11423426
  73. 73. Matveeva OV, Shabalina SA (1993) Intermolecular mRNA-rRNA hybridization and the distribution of potential interaction regions in murine 18S rRNA. Nucleic Acids Res 21: 1007–1011.OV MatveevaSA Shabalina1993Intermolecular mRNA-rRNA hybridization and the distribution of potential interaction regions in murine 18S rRNA.Nucleic Acids Res2110071011
  74. 74. Masuda M, Tsunoda M, Yusa Y, Yamada S, Imai K (2002) Assay of catechol-O-methyltransferase activity in human erythrocytes using norepinephrine as a natural substrate. Ann Clin Biochem 39: 589–594.M. MasudaM. TsunodaY. YusaS. YamadaK. Imai2002Assay of catechol-O-methyltransferase activity in human erythrocytes using norepinephrine as a natural substrate.Ann Clin Biochem39589594