Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Lack of Galectin-3 Drives Response to Paracoccidioides brasiliensis toward a Th2-Biased Immunity

  • Luciana Pereira Ruas,

    Affiliation Departamento de Biologia Celular e Molecular e Bioagentes Patogênicos, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, Brasil

  • Emerson Soares Bernardes,

    Affiliation Departamento de Biologia Celular e Molecular e Bioagentes Patogênicos, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, Brasil

  • Marise Lopes Fermino,

    Affiliation Departamento de Biologia Celular e Molecular e Bioagentes Patogênicos, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, Brasil

  • Leandro Licursi de Oliveira,

    Affiliation Departamento de Biologia Geral, Universidade Federal de Viçosa, Viçosa, Brasil

  • Daniel K. Hsu,

    Affiliation Department of Dermatology, School of Medicine, University of California Davis, Sacramento, California, United States of America

  • Fu-Tong Liu,

    Affiliation Department of Dermatology, School of Medicine, University of California Davis, Sacramento, California, United States of America

  • Roger Chammas,

    Affiliation Laboratório de Oncologia Experimental, Faculdade de Medicina, Universidade de São Paulo, São Paulo, Brasil

  • Maria-Cristina Roque-Barreira

    mcrbarre@fmrp.usp.br

    Affiliation Departamento de Biologia Celular e Molecular e Bioagentes Patogênicos, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, Brasil

Lack of Galectin-3 Drives Response to Paracoccidioides brasiliensis toward a Th2-Biased Immunity

  • Luciana Pereira Ruas, 
  • Emerson Soares Bernardes, 
  • Marise Lopes Fermino, 
  • Leandro Licursi de Oliveira, 
  • Daniel K. Hsu, 
  • Fu-Tong Liu, 
  • Roger Chammas, 
  • Maria-Cristina Roque-Barreira
PLOS
x

Abstract

There is recent evidence that galectin-3 participates in immunity to infections, mostly by tuning cytokine production. We studied the balance of Th1/Th2 responses to P. brasiliensis experimental infection in the absence of galectin-3. The intermediate resistance to the fungal infection presented by C57BL/6 mice, associated with the development of a mixed type of immunity, was replaced with susceptibility to infection and a Th2-polarized immune response, in galectin-3-deficient (gal3−/−) mice. Such a response was associated with defective inflammatory and delayed type hypersensitivity (DTH) reactions, high IL-4 and GATA-3 expression and low nitric oxide production in the organs of infected animals. Gal3−/− macrophages exhibited higher TLR2 transcript levels and IL-10 production compared to wild-type macrophages after stimulation with P. brasiliensis antigens. We hypothesize that, during an in vivo P. brasiliensis infection, galectin-3 exerts its tuning role on immunity by interfering with the generation of regulatory macrophages, thus hindering the consequent Th2-polarized type of response.

Introduction

Paracoccidioides brasiliensis, a thermally dimorphic fungus, is the etiological agent of human paracoccidioidomycosis, one of the most frequent systemic mycosis in Central and South America [1], [2]. The main host defense against P. brasiliensis is the cell-mediated immune response [3][5]. Macrophage activation and granuloma formation characterize the inflammatory response induced by the fungus, and protect the host against parasite dissemination [6]. Macrophages and lymphocytes are generally considered the major effector cells controlling the disease in vivo [7], [8] through TNF-α and IFN-γ production [9], [10].

In the past few years, the immunity to several infections has been demonstrated to be influenced by galectin-3, the most studied member of the galectin family. These investigations were performed by comparing the course of experimental infections in mice that were genetically deficient, or not, in galectin-3 [11][13]. The studies of infection with the intracellular bacteria Rhodococcus equi have demonstrated that galectin-3 may regulate the innate immune response by diminishing IL-1β production by macrophages [13]. On the other hand, during Toxoplasma gondii and Schistosoma mansonii infection, the absence of galectin-3 drives the development of a heightened Th1-type immune response, suggesting that the lectin exerts a profound effect on the development of the adaptive immune response against pathogens [11], [12]. Together with results obtained from a murine model of asthma [14], the studies provide consistent evidences that gal3−/− mice develop a lower Th2 response but a higher Th1 response compared with gal3+/+ mice. In consequence, galectin-3 emerges as a fine regulator of Th1/Th2 balance.

Since protection against P. brasiliensis infection depends on adequate inflammation, cellular immune response and cytokine production, and because galectin-3 is important in the regulation of the Th1/Th2 balance, the aim of this study was to analyze the immunological aspects of P. brasiliensis infection in galectin-3-deficient (gal3−/−) mice. We demonstrate that gal3−/− mice present increased susceptibility to P. brasiliensis infection, associated with the inability to mount an adequate inflammatory response, the impairment of DTH response, high serum levels of specific antibodies, and the development of a Th2-polarized immune response. Such a picture is possibly due to the fact that, following contact with P. brasiliensis antigens, macrophages from gal3−/− mice have higher TLR2 transcript levels and produce higher levels of the deactivating cytokine IL-10. Our results indicate that galectin-3 exerts a protective and immunoregulatory role in the host response to P. brasiliensis infection.

Materials and Methods

Experimental Animals

Galectin-3-deficient mice (gal3−/−) were generated as previously described and backcrossed to C57BL/6 mice for nine generations [15]. Age-matched wild-type mice C57BL/6 (gal3+/+) were used as controls in all the experiments. Mice were housed under approved conditions in the Animal Research Facilities of Faculdade de Medicina de Ribeirão Preto - USP. All of the animals used in the experiments were male, at 6 to 8 week-old. The Ethics Committee on Animal Research of the University of São Paulo approved all the procedures performed in the studies described here.

Parasite, Mice Infection, and Mortality

The P. brasiliensis isolate 18 (Pb18), which is highly virulent, was used throughout this study. Yeasts cells were maintained by weekly subcultivation in a semisolid culture medium [16] at 36°C and were used on day 7 of culturing. They were harvested and washed three times with phosphate-buffered saline (PBS), pH 7.2. Cell viability was determined as previously described [17]. Mice were infected intraperitoneally (i.p.) with 5×106 viable yeast cells in 500 µL PBS and control animals received PBS only. Animal death was registered daily until 120 days after infection. For the intratracheal (i.t.) infection assay, mice were anesthetized by intraperitoneal injection with 2.5% of tribromoethanol and infected with 5×106 yeast cells suspended in PBS.

Antigen Preparation

P. brasiliensis-antigen (PbAg) was obtained as previously described [16]. Briefly, Pb18 yeast cells were harvested, washed with PBS, disrupted by ultrasonic treatment (5 cycles of 30 seconds), and centrifuged for 10 min at 2000×g. The supernatants were collected and the protein concentration was determined by the Bicinchoninic acid assay (BCA) (Pierce, Rockford, IL, USA), according to the manufacturer's protocol.

Tissue Processing

Groups of gal3+/+ and gal3−/− mice were euthanized 4 weeks postinfection. The lungs obtained from different groups of mice were fixed in 10% buffered formalin for 24 hours and processed routinely for paraffin embedding and sectioning. Five-micrometer sections were stained with hematoxylin and eosin (H&E) for analysis of granulomatous lesions and intensity of inflammatory infiltrates.

Immunohistochemistry for Detection of Galectin-3 in Tissues of Mice

To detect galectin-3 expression by immunohistochemistry, deparaffinized sections were incubated in 2% unlabeled goat serum diluted in 1% Bovine Serum Albumin (BSA) for 1 hour to reduce nonspecific binding. The slides were then incubated with rat anti-mouse galectin-3 mAb (M3/38) [18] diluted in PBS containing 1% BSA for one hour. The secondary antibodies labeled with peroxidase were goat anti-rat IgG antibodies (Sigma Chemical Co., St. Louis, MO, USA). The reaction was visualized by incubating the section with 3,3′-diaminobenzidine tetrahydrochloride (Pierce, Rockford, IL, USA) in PBS+H2O2 for 30 min. In the control slides, normal rat IgG replaced the primary antibody. The slides were viewed by light microscopy using an Olympus BX50 microscope (Olympus Instruments, Melville, NY, USA) equipped with a digital camera Nikon DMX 1200 (Nikon, Melville, NY, USA). All steps were performed at room temperature.

Assay for Organ Colony-Forming Units

To assay the dissemination of the fungus to the lung and liver, the animals were euthanized after 30 days of both i.p and i.t. infection and the organs were removed, weighed, homogeneized in sterile PBS (pH 7.2) and serially diluted. Aliquots of 100 µL were dispensed into Petri dishes, in duplicates, containing brain-heart infusion agar (Difco Laboratories, Detroit, MI, USA) supplemented with 4% (v/v) of fetal bovine serum. Plates were incubated at 37°C, and colonies were counted 7 and 14 days later. Results are expressed as the number of colony-forming units (CFU)±SD per gram of tissue.

Quantification of P. brasiliensis by real time PCR

Molecular quantification of P. brasiliensis was performed as previously described [19]. Lung samples were frozen in liquid nitrogen for 30 s and pulverized. The total DNA was extracted and precipitated using the DNeasy Tissue Kit (Qiagen, Valencia, CA, USA), according to the manufacturer's protocol. PCR amplification and analysis were achieved using an ABI Prism 7500 sequence detector (Applied Biosystems, Foster City, CA, USA). Reactions were performed with TaqMan Universal PCR Master Mix (Applied Biosystems) in 20 µL solutions containing 50 ng of template DNA, 5 pmol of each primer, and probe and 10 µL of TaqMan Master Mix. Each sample was tested in duplicate and all quantifications were normalized to an endogenous control (β-actin). The primers and probes used for PCR amplification targeting the Gp43 gene [20] for P. brasiliensis and β-actin gene for mouse were designed using the Primer Express® software v2.0 (Applied Biosystems). The sequences for primers and probe for β-actin gene are: forward - 5′- AGCTGCGTTTTACACCCTTT -3′; reverse - 5′- AAGCCATGCCAATGTTGTCT -3′ and probe: -5-FAM-TGACAAAACCTAACTTGCGCAGAAAAA-Tamra-3′. The primers and probe for Gp43 gene are: forward - 5′- FAM-GATTGATGAAGCTGCGGTTGA-Tamra-3′ and reverse 5′- CATACAGATCTCCGACGCTGC -3′.

Delayed-Type Hypersensitivity (DTH) Assay

DTH responses against P. brasiliensis antigens were evaluated 90 days after infection by the footpad test, as previously described [21]. The left hind footpad was injected subcutaneously with 25 µL PbAg. Swelling was evaluated by measuring the footpad thickness just before and 24 h after injection of the antigen, using a dial caliper (Mitutoyo, Tokyo, Japan). The increase in thickness was calculated. The same procedure was performed in non-infected control mice.

Quantification of P. brasiliensis-specific IgG1 and IgG2b

Specific anti-P. brasiliensis IgG1 and IgG2b antibodies in the serum samples were detected by enzyme-linked immunosorbent assay (ELISA). Microtiter plates (Nunc, Naperville, IL, USA) were coated with PbAg (50 µL per well) at a concentration of 20 µg/mL in 50 mM sodium carbonate buffer, pH 9.6, overnight, at 4°C. The plates were then washed three times with PBS containing 0.05% Tween 20 (PBS-T) (pH 7.4). Non-specific binding sites were blocked with PBS-T containing 1% BSA (blocking buffer) for 1 h, at 37°C. Serum samples were added to duplicate wells at a 1/90 dilution in blocking buffer. Plates were then incubated at 37°C for 1 h, washed four times, and incubated with peroxidase-conjugated goat anti-mouse IgG1 or IgG2b antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) in a 1/5000 dilution in blocking buffer for 1 h, at 37°C. After washing with PBS-T, reactions were developed with the TMB (3,3′,5,5′-tetramethylbenzidine) Substrate Kit according to the manufacturer's instructions (Pierce Chemical Co., Rockford, IL, USA). The reaction was stopped 15 min later by addition of 25 µL of 1 M sulfuric acid to each well. The absorbance at 450 nm was read in a Microplate Scanning Spectrophotometer (PowerWave X, Bio-Tek Instruments, Inc., Winooski, VT, USA). As a reaction control, antigen coated plates were incubated with serum of non-infected mice. An additional control was provided by BSA coated wells incubated with serum of infected mice.

Cytokine Detection in Organ and Peritoneal Macrophage Supernatants

Cytokine concentrations in the tissues were quantified with a commercially available kit, according to the manufacturer's instructions (OptEIA set; Pharmingen, San Diego, CA, USA). To evaluate secretion of the IFN-γ and IL-4 cytokines in the lungs, the organs were weighed and homogenized in 1 mL of complete inhibitor cocktail buffer (Boehringer, Mannheim, Germany) using a tissue homogenizer. The samples were centrifuged at 5000×g for 10 minutes and assayed for cytokine production. For cytokine quantification in the macrophage supernatants, cells were stimulated in vitro for 48 hours and IL-10 content was then determined. The concentrations were determined by comparison with standard curves constructed with known amounts of the respective mouse recombinant cytokines. The assay sensitivity limits were 7 pg/mL for IL-4, and 30 pg/mL for IFN-γ and IL-10.

Real Time quantitative PCR analysis

Total RNA was isolated from 2×106 cells using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), following the manufacturer's intructions. cDNA synthesis was performed in a final volume of 20 µL, using ImProm-II Reverse Transcriptase (Promega Corporation, Madison, WI, USA). The reaction mixture contained 4 µg of total RNA, 20 pmol of oligo dT primer (Invitrogen Life Technologies, Carlsbad, CA, USA), 40 U of RNAsin, 1 M of dNTP mix, and 1 U of reverse transcriptase buffer. cDNA was treated with 10 µg of RNase (Gibco, Carlsbad, CA, USA). It was then immediately used or stored at −20°C. PCR amplification and analysis were achieved using an ABI Prism 7500 sequence detector (Applied Biosystems). All the reactions were performed with SYBR Green Master Mix (Applied Biosystems) using a 25 µL volume in each reaction, which contained 2 µL of template cDNA, 5 pmol of each primer, and 12.5 µL of SYBR Green. The primers used for PCR amplification were as follows: for IL-4, 5′- GTCTCTCGTCACTGACGGCA- 3′ (forward) and 5′- CGTGGATATGGCTCCTGGTAC -3′ (reverse); for GATA-3, 5′- AAGAAAGGCATGAAGGACGC -3′ (forward) and 5′- GTGTGCCCATTTGGACATCA -3′ (reverse); for arginase I, 5′- CAAAAGGACAGCCTCGAGGAG- 3′ (forward) and 5′- CCCGTGGTCTCTCACGTCAT -3′ (reverse); for TLR2, 5′- CTCTGACCCGCCCTTTAAGC - 3′ (forward) and 5′- TTTTGTGGCTCTTTTCGATGG - 3′ (reverse); for β-actin, 5′- AGCTGCGTTTTACACCCTTT -3′ (forward) and 5′- AAGCCATGCCAATGTTGTCT -3′ (reverse).

Mouse Peritoneal Macrophages

Groups of gal3+/+ and gal3−/− mice were i.p. injected with 1 mL of sterile 3% sodium thioglycollate (Sigma Chemical Co). After 4 days, mice were euthanized and their cells were recovered by peritoneal lavage using 5 mL of ice-cold Hank's balanced salt solution (HBSS). Cells were immediately stored on ice, washed in HBSS, suspended in RPMI-5% medium, and dispensed in 24-well cell culture plates (2×106 cells/well). After a 4 h incubation at 37°C, nonadherent cells were gently removed, and the adherent cells were incubated in RPMI-5% either in the presence or absence of cells from Pb18 culture (8×106 cells/well) or PbAg (20 µg/mL). They were then cultured at 37°C in a humidified 5% CO2 atmosphere. The culture supernatants were collected after 24 and 48 hours for NO determination and IL-10 quantification, as described below.

Nitrite Content in Organ and in the Supernatant of Mouse Macrophage Culture

NO production was quantified by accumulation of nitrite, using the standard Griess reaction. Briefly, 50 µL of the supernatants were incubated with an equal volume of the Griess reagent (1% sulfanilamide, 0.1% naphthyl ethylenediamine dihydrochloride, 2.5% H3PO4) for 10 min, at room temperature. The absorbance was measured at 550 nm in the Microplate scanning spectrophotometer. The conversion of absorbance into micromolar concentrations of NO was deduced from a standard curve using a known concentration of NaNO2 diluted in RPMI medium.

Statistical Analysis

The results are expressed as the mean±SD of the indicated number of animals or experiments. Statistical analysis was performed using analysis of variance followed by the parametric Tukey-Kramer test (INSTAT software, GraphPad, San Diego, CA, USA). A P value<0.05 was considered statistically significant. The log rank test was used to compare the survival rates between the study groups, and differences were considered statistically significant when P<0.05.

Results

Galectin-3 is Involved in the Resistance to Infection with Paracoccidioides brasiliensis

The effect of galectin-3 in host survival to P. brasiliensis infection was studied in mice deficient in the galectin-3 gene. At 80 days post-infection, 20% of the gal3−/− mice died, whereas all wild-type (gal3+/+) mice survived until 100 days after infection (Figure 1). By day 110, gal3−/− mice reached 100% mortality while 80% of gal3+/+ mice survived in the same period of infection. Because galectin-3 deficiency was associated with higher vulnerability of mice to the infection, we hypothesize that galectin-3 contributes to the host resistance against the fungus.

thumbnail
Figure 1. Absence of galectin-3 leads to lower survival in mice infected by P. brasiliensis.

The survival rate of gal3+/+ (black squares) and gal3−/− (open squares) mice after intraperitoneal infection with 5×106 yeasts cells (P<0.0001, compared with infected gal3+/+ mice.). Data are representative of two experiments, each performed with eight to ten mice per group.

https://doi.org/10.1371/journal.pone.0004519.g001

Galectin-3 Controls the Pulmonary Inflammatory Reaction and Fungal Burden in the P. brasiliensis Infected Mice

Because the formation of a compact granuloma is crucial during P. brasiliensis infection [22], we compared the inflammatory response in the lungs of infected gal3−/− and gal3+/+ mice. At 30 days post-infection, the lung tissue of gal3+/+ mice exhibited compact and individualized granulomatous lesions (Figure 2A and 2C), while the lungs of gal3−/− mice showed a diffuse inflammatory reaction, with incomplete organization of the granuloma. The lesions were confluent and poorly structured, causing a disruption of the pulmonary parenchyma (Figures 2B and 2D). Immunohistochemistry staining revealed an increased amount of galectin-3 in the lungs of gal3+/+ infected mice compared with non-infected controls (Figures 2E and 2F). As expected, no staining was observed in the lungs of infected or non-infected gal3−/− mice (not shown).

thumbnail
Figure 2. Histopathology and immunohistochemistry staining for galectin-3 in lung sections from P. brasiliensis-infected gal3+/+ and gal3−/− mice.

Mice were intraperitoneally infected with 5×106 yeasts cells and their lungs were analyzed after 30 days. Lungs of gal3+/+ mice show well-organized granulomas (A and C). Gal3−/− mice present a diffuse pattern of inflammatory cells, with incipient granuloma formation (B and D). Galectin-3 staining increases after infection with the fungus, mostly detected in the inflammatory cells of the granulomas and surrounding yeast cells (F). Galectin-3 is barely noted in the lungs of non-infected control mice (E). Sections were stained with H&E (A–D) or immunostained for galectin-3 with a hematoxilin counterstain (E–F). Scale bars on panels A and B indicates 1 mm; on C and D 400 µm, and on E and F 100 µm.

https://doi.org/10.1371/journal.pone.0004519.g002

The fungal CFU recovered from the lungs and liver were dramatically higher in gal3−/− mice compared with gal3+/+ mice (Figure 3A), an observation that was also confirmed after infection by the intratracheal route and by quantitative real-time PCR specific for P. brasiliensis DNA (Figure 3B and C). These results indicate that galectin-3 is involved in the development of an effective inflammatory reaction and in the control of fungal burden.

thumbnail
Figure 3. Absence of galectin-3 leads to increased P. brasiliensis burden.

Colony-forming units (CFU) recovered from lungs and liver (A) of gal3+/+ (black bars) and gal3−/− (open bars) mice 30 days after intraperitoneal (A) and intratracheal (B) infection with yeast cells. Relative quantification of P. brasiliensis in the lungs of infected mice 30 days after i.p. infection was carried out through real-time PCR (C). The bars represent the mean±SD of CFU obtained from duplicate samples in groups of five animals. * P<0.05, compared with infected gal3+/+ mice.

https://doi.org/10.1371/journal.pone.0004519.g003

Cellular and Humoral Response against P. brasiliensis is influenced by Galectin-3

Next, we evaluated whether the immune response against the fungus is affected by galectin-3. The DTH response was evaluated 90 days post-infection, by measuring the footpad thickness developed after the local injection of the fungal antigens. The thickness was significantly lower (P<0.05) in gal3−/− mice compared with gal3+/+ mice, whereas no difference was observed between the groups of non-infected mice (Figure 4A). The determination of the serum levels of antibodies reacting with the fungal antigens showed that by day 30 post-infection, gal3−/− mice had significantly (P<0.05) higher levels of specific IgG1 compared to gal3+/+ mice (Figure 4B). The former also developed a higher antigen-specific IgG2b response, compared to the latter, but the difference was not statistically significant. No reaction with fungal antigens occurred with the serum of the non-infected mice or following incubation of serum samples of infected mice with BSA coated plates (not shown). Because lower cellular immunity and higher levels of IgG1 antibodies were observed in gal3−/− mice, suggesting that a Th2 response could be mounted, we hypothesize that galectin-3 is required to sustain the immunity responsible for the intermediate susceptibility of C57BL/6 mice to P. brasiliensis infection.

thumbnail
Figure 4. Cellular and humoral responses to P. brasiliensis in the absence of galectin-3.

DTH reaction (A) and serum level of specific antibodies (B) of gal3+/+ (black bars) and gal3−/− (open bars) mice intraperitoneally infected with 5×106 yeasts cells. DTH reaction was assayed in groups of 8–13 mice, 90 days after infection. Each bar represents the mean±SD from a representative experiment of two assays. IgG1 and IgG2b levels were detected by ELISA in the sera of mice 30 days after infection. The bars represent the mean±SD of the O.D. obtained for sera, diluted 30 times, of five animals and are representative of two independent experiments. * P<0.05, compared with infected gal3+/+ mice.

https://doi.org/10.1371/journal.pone.0004519.g004

A Th2-polarized Immune Response during P. brasiliensis infection is associated with the absence of Galectin-3

To better characterize the type of immune response mounted by gal3−/− C57BL/6 mice during P. brasiliensis infection, we determined the levels of cytokines in the spleen and lung homogenates of gal3+/+ and gal3−/− mice, obtained 30 days after fungal inoculation. We found higher levels of IL-4 and IFN-γ in both groups of infected mice compared with the non-infected ones (data not shown). Higher amounts of IL-4 were detected in the lungs of P. brasiliensis-infected gal3−/− mice compared with infected gal3+/+ mice (P<0.05) (Figure 5A), a result that was supported by the higher relative expression of IL-4 mRNA found in the lungs of infected gal3−/− mice (Figure 5C). IFN-γ levels detected in the spleen and lungs of gal3+/+ and gal3−/− mice were not statistically different (Figure 5B). However, we found a higher relative expression of the T cell transcriptional factor GATA-3 in the spleen and lung of infected gal3−/− mice in comparison to gal3+/+ mice (Figure 5D). These results suggest that gal3−/− mice develop a Th2-polarized immune response when infected with P. brasiliensis, a fact that is consistent with the increased susceptibility of these mice to the fungal disease.

thumbnail
Figure 5. Levels of IL-4 (A and C), IFN-γ (B) and GATA-3 (D) in the organs of P. brasiliensis-infected gal3+/+ and gal3−/− mice.

Mice were intraperitoneally infected with 5×106 yeasts cells and samples of their organs weighed and homogenized. Protein levels of IL-4 and IFN-γ in the lungs and spleen of 30 day-infected mice were assayed by ELISA (A and B). The levels of mRNA relative expression for the IL-4 and GATA-3 in the lungs (30 days after infection) and GATA-3 in the spleen (7 days after infection) of infected mice were determined by real-time PCR, using the β-actin gene as control. The results represent the mean±SD of three to five mice per group, from a representative experiment of three assays. * P<0.05, compared with infected gal3+/+ mice.

https://doi.org/10.1371/journal.pone.0004519.g005

Galectin-3 is Required for NO Production Induced by Fungal Antigens

To better evaluate the effect of galectin-3 in the mechanisms of resistance to P. brasiliensis infection, we measured the pulmonary NO levels in the infected mice 30 days after infection. NO levels produced by gal3−/− mice were significantly lower than those produced by gal3+/+ mice (Figure 6A). No significant difference was found regarding the arginase I mRNA expression in the lungs of mice from both groups (Figure 6B). To determine whether galectin-3 could directly interfere with this effector mechanism of resistance, we measured the in vitro NO production by peritoneal macrophages co-cultured with P. brasiliensis or stimulated with fungal antigens. In both conditions, peritoneal macrophages obtained from gal3+/+ mice produced higher NO levels (Figure 6C), a response that was reproduced by cells stimulated with LPS (positive control). These results give evidence for an additional mechanism by which galectin-3 contributes to resistance to the fungal infection.

thumbnail
Figure 6. NO production (A) and arginase I levels (B) detected in the lungs of P. brasiliensis-infected mice and production of NO in vitro by peritoneal macrophages (C).

In panel A, nitrite levels were detected by the Griess method in the lungs of mice, after 30 days of infection. The results represent the mean±SD of eight mice per group, from a representative experiment of three separate assays. Panel B shows transcript levels of arginase I mRNA in the lungs of mice, after 30 days of infection, determined by real-time PCR, using the β-actin gene as control. In panel C, nitrite levels were detected in the supernatant of adherent cells harvested from the peritoneal cavity of gal3+/+ (black bars) and gal3−/− (open bars) mice treated with thioglycollate. Cell cultures were incubated for 48 hours with medium alone or stimulated with bacterial LPS (1 µg/mL) or P. brasiliensis antigens (PbAg, 20 µg/mL) or P. brasiliensis yeast (Pb, 8×107 cells/mL). Each bar represents the mean±SD from a representative experiment of two assays. * P<0.05, compared with infected gal3+/+ mice.

https://doi.org/10.1371/journal.pone.0004519.g006

P. brasiliensis Antigens Induce Higher TLR2 Transcript Expression in Gal3−/− Macrophages, Associated with Higher Levels of IL-10

Because P. brasiliensis antigens induced the down regulation of NO production in gal3−/− mice, we investigated whether they were able to interfere with TLR2 expression in macrophages. Previous results from our group had shown that TLR2 expression is altered in galectin-3-deficient macrophages infected with intracellular bacteria Rhodococcus equi [13]. Here we found, in non-stimulated macrophages, higher TLR2 mRNA expression in gal3−/− compared to gal3+/+ cells (Figure 7A). P. brasiliensis antigen increased the expression of TLR2 in both genotypes of macrophages. Remarkably, gal3−/− macrophages stimulated with PbAg contained the transcript level at 2.5 times higher than that detected in gal3+/+ macrophages (Figure 7A). These results indicate that galectin-3 regulates TLR2 expression in macrophages, mainly when they are stimulated with fungal antigen. IL-10 measurement in the supernatants of macrophages show that the level produced by gal3+/+ macrophages was almost 2.6 times lower compared with gal3−/− cells (Figure 7B). The results determined by PbAg were reproduced by the stimulation with P. brasiliensis yeast (not shown). These results suggest that galectin-3, in addition to controlling the TLR2 expression on macrophages stimulated with fungal antigen, regulates the IL-10 production by these cells.

thumbnail
Figure 7. P. brasiliensis antigens induce higher TLR2 transcript levels in gal3−/− thioglycollate-elicited macrophages.

(A) Real Time quantitative RT PCR for TLR2 using mRNA from unstimulated or PbAg (20 µg/mL)-treated macrophages, 4 hours after stimulation. cDNA contents were normalized on the basis of predetermined levels of β-actin. TLR2 transcript level was higher in PbAg-stimulated gal3−/− macrophages (open bars) compared with gal3+/+ macrophages (black bars). (B) Thioglycollate-elicited macrophages from gal3+/+ (black bars) and gal3−/− (open bars) mice were incubated with the indicated stimuli for 48 hours; IL-10 was quantified in the cell supernatants by ELISA. Results represent the mean±SD obtained from duplicate wells. Results are representative of two independent experiments that provide similar results. * P<0.05, compared with infected gal3+/+ mice.

https://doi.org/10.1371/journal.pone.0004519.g007

Discussion

In this work, we describe how P. brasiliensis infection can be influenced by the role exerted by galectin-3 on the host immunity. In the absence of galectin-3, the pattern of immune response of C57BL/6 mice to P. brasiliensis infection changes. The known intermediate resistance of C57BL/6 mice to P. brasiliensis infection [23], associated with a mixed type of immune response, is substituted by clear susceptibility to the fungal infection in gal3−/− C57BL/6 mice, associated with a Th2-polarized immune response.

The greater susceptibility to P. brasiliensis infection in the absence of galectin-3 may be attributed to a combination of factors, including impairment of both inflammatory reaction and cellular specific immune response, whose integrity is critical for protection against the fungus [5], [22]. After P. brasiliensis infection, the diffuse inflammatory reaction found in the lungs of gal3−/− mice contrasts with the well delineated granulomas observed in wild-type mice, which restrains fungal dissemination, as indicated by a lower fungal burden. A depressed DTH response to fungal antigens observed in gal3−/− infected mice is consistent with the cellular immune response defect repetitively found in paracoccidioidomycosis models developed in susceptible mice [21], [24], [25]. Such models mimic the polar forms of the human disease and are correlated with an elevated production of IgG1 and IgG2b antibodies [24]. Compared with gal3+/+ mice, gal3−/− mice have lower DTH responses and produce higher titers of IgG1. This state is compatible with the occurrence of a Th2 immune response [26], which accounts for decreased resistance to the infection found in these mice.

The resistance to P. brasiliensis infection is usually attributed to high IFN-γ, which activates macrophages and enables them to kill the fungus [5], [27], [28]. We did not detect a significant difference between the IFN-γ levels in the organs of infected gal3+/+ and gal3−/− mice. Despite the similar IFN-γ levels, less NO was detected in the lungs of gal3−/− infected mice, and produced by peritoneal macrophages obtained from them, when stimulated with P. brasiliensis yeast, antigens, or LPS. No difference was seen in the arginase I levels in the lungs of infected mice from both groups. Therefore, the lower NO production by gal3−/− mice is probably attributed to the higher levels of IL-4 exhibited by these mice, which is known to suppress NO production by repressing IFN-γ-induced gene transcription [29], besides acting as an inducer of naive T cell differentiation into Th2 lymphocytes [30].

These two mentioned processes resulting from IL-4 overproduction can render mice more susceptible to intracellular pathogens. Indeed, IL-4 neutralization leads to protection against several fungi [31][33], including P. brasiliensis [23], [34], [35]. In P. brasiliensis-infected C57BL/6 mice, IL-4 neutralization leads to less severe pulmonary disease, low production of Th2 cytokines, high TNF-α and IL-12 synthesis, and low IgG1 antibodies levels [23]. The conclusion that the higher IL-4 production in gal3−/− mice accounts for deviation to a Th2 immune response is strengthened by the detection in the spleen and lung of these mice of higher levels of GATA-3 mRNA, a transcriptional factor selectively expressed in Th2 lymphocytes that inhibits Th1 differentiation [36]. While Th2 lymphocytes alone may account for IL-4 overproducion; other cells, like eosinophils, may be also implicated in such a response of gal3−/− mice. The involvement of mast cells is less probable because, when derived from gal3−/− mice, they respond to stimuli with lower IL-4 secretion [37].

The distinct behavior of gal3−/− mice toward P. brasiliensis infection discloses a novel way through which galectin-3 may regulate host immunity. The R. equi model of infection has revealed galectin-3's ability to exert a regulatory role in innate immunity by diminishing macrophage IL-1β production. Macrophages from gal3−/− R. equi-infected mice upregulate proinflammatory and TLR2 genes, which results in enhanced cell activation and in increased resistance to the bacteria [13]. Consistent with this report, we have observed that gal3−/− peritoneal macrophages develop higher TLR2 mRNA expression, in comparison with the wild type macrophages, when merely elicited with thioglycollate broth. Following stimulation with P. brasiliensis antigens, the TLR2 expression was remarkably greater in gal3−/− macrophages, compared to that observed in other experimental conditions. Under stimulation with fungal antigen or the intact yeast, higher levels of the deactivating cytokine IL-10 were produced by gal3−/− macrophages. In many aspects our results are supported by the recent work of Ferreira et al. [38] that shows that susceptible mice infected with P. brasiliensis develop regulatory DCs, which display increased TLR2 gene expression and IL-10 production in the presence of the yeast. Our gal3−/− macrophages behave similarly in the presence of the fungal antigens, and we hypothesize that the increased TLR2 expression is implicated in the higher IL-10 production and the generation of an ineffective immune response against P. brasiliensis. Studies with Candida albicans have shown that TLR2−/− mice are more resistant to this infection, a fact associated with the decreased release of anti-inflammatory cytokines, such as IL-10 [39]. Therefore, the low inflammatory response observed in gal3−/− mice may be derived from the enhanced TLR2 expression and elevated IL-10 production in macrophages stimulated by the fungal antigens.

The present study is the first demonstration that galectin-3 deficiency may polarize the immune response toward a Th2 pattern. A critical role of galectin-3 on Th1/Th2 balance has been previously suggested by us [11], [13] and others [12], [14]. The T. gondii model has shown that galectin-3 leads to reduced organ inflammation and Th1-polarized immune response, which does not alter mice survival to the infection [11]. During schistosomiasis, gal3−/− mice present a biased Th1 cellular and humoral immune response [12]. By using a murine model of asthma, the occurrence of a lower Th2 response in gal3−/− mice, compared with gal3+/+ mice, has been reported [14]. Our work adds new data; corroborating the idea that galectin-3 is a regulator of Th1/Th2 immunity. Because gal3−/− mice, during P. brasiliensis infection, develop a Th2-polarized immune response and succumbed to infection, we conclude that galectin-3 is central to maintaining the intermediate resistance of C57BL/6 mice to P. brasiliensis, and the deletion of the galectin-3 gene renders mice susceptible to the fungal infection. Such susceptibility is associated with an unequivocal deviation toward a Th2-immune response, possibly triggered by macrophages over-expressing TLR2 and producing high IL-10 levels. Because the LPS stimulus (TLR4 agonist) induces IL-10 production that is not controlled by galectin-3, we suppose that our observations may be peculiar to fungal infections. A global idea of how susceptibility to P. brasiliensis infection can be influenced by galectin-3 actions on the host cellular and humoral response is given in figure 8. The results presented here, together with previous observations on the role exerted by galectin-3 in several infections, allow us to postulate that regulation of the Th1/Th2 balance by galectin-3 changes with the diversity of the initial responses triggered by different pathogens.

thumbnail
Figure 8. Possible role of galectin-3 during a fungal infection, as suggested by the immune response of gal3−/− mice to the inoculation of P. brasiliensis yeasts.

Mice deficient for the galectin-3 gene were infected, and several aspects of the immune response mounted by these mice are summarized in the figure.

https://doi.org/10.1371/journal.pone.0004519.g008

Acknowledgments

We thank Vani M.A. Correa, Sandra M.O. Thomaz, Patricia E. Vendruscolo, and Vania S. Mariano for excellent technical assistance; and Julio A. Siqueira, Savio H.F. Miranda and Ednelson A. Mazzotto for expert animal care. The primers and probe for P. brasiliensis Gp43 gene were kindly donated by Dr. Gustavo H. Goldman.

Author Contributions

Conceived and designed the experiments: LPR ESB. Performed the experiments: LPR MLF LLdO. Analyzed the data: LPR ESB MLF LLdO. Contributed reagents/materials/analysis tools: DKH FTL RC MCRB. Wrote the paper: LPR ESB MCRB.

References

  1. 1. Brummer E, Castaneda E, Restrepo A (1993) Paracoccidioidomycosis: an update. Clin Microbiol Rev 6: 89–117.E. BrummerE. CastanedaA. Restrepo1993Paracoccidioidomycosis: an update.Clin Microbiol Rev689117
  2. 2. Franco M, Lacaz CS, Restrepo-Moreno A, Del Negro G (1994) Paracoccidioidomycosis. Boca Raton, FL: CRC Press. M. FrancoCS LacazA. Restrepo-MorenoG. Del Negro1994ParacoccidioidomycosisBoca Raton, FLCRC Press410
  3. 3. Franco M (1987) Host parasite-relationship in paracoccidioidomycosis. J Med Vet Mycol 25: 5–18.M. Franco1987Host parasite-relationship in paracoccidioidomycosis.J Med Vet Mycol25518
  4. 4. Calich VLG, Kashino SS (1998) Cytokines produced by susceptible and resistant mice in the course of Paracoccidioides brasiliensis infection. Braz J Med Biol Res 31: 615–623.VLG CalichSS Kashino1998Cytokines produced by susceptible and resistant mice in the course of Paracoccidioides brasiliensis infection.Braz J Med Biol Res31615623
  5. 5. Borges-Walmsley MI, Chen D, Shu X, Walmsley AR (2002) The pathobiology of Paracoccidioides brasiliensis. TRENDS Microbiol 10: 80–87.MI Borges-WalmsleyD. ChenX. ShuAR Walmsley2002The pathobiology of Paracoccidioides brasiliensis.TRENDS Microbiol108087
  6. 6. de Brito T, Franco M (1994) Granulomatous inflammation. Rev Inst Med Trop Sao Paulo 36: 185–192.T. de BritoM. Franco1994Granulomatous inflammation.Rev Inst Med Trop Sao Paulo36185192
  7. 7. Kashino SS, Fazioli RA, Moscardi-Bacchi M, Franco M, Singer-Vermes LM, et al. (1995) Effect of macrophage blockade on resistance of inbred mice to Paracoccidioides brasiliensis infection. Mycopathologia 130: 131–141.SS KashinoRA FazioliM. Moscardi-BacchiM. FrancoLM Singer-Vermes1995Effect of macrophage blockade on resistance of inbred mice to Paracoccidioides brasiliensis infection.Mycopathologia130131141
  8. 8. Burger E, Miyaji M, Sano A, Calich VLG, Nishimura K, et al. (1996) Histopathology of paracoccidioidomycotic infection in athymic and euthymic mice: a sequential study. Am J Trop Med Hyg 55: 235–242.E. BurgerM. MiyajiA. SanoVLG CalichK. Nishimura1996Histopathology of paracoccidioidomycotic infection in athymic and euthymic mice: a sequential study.Am J Trop Med Hyg55235242
  9. 9. Kashino SS, Fazioli RA, Cafalli-Favati C, Meloni-Bruneri LH, Vaz CAC, et al. (2000) Resistance to Paracoccidioides brasiliensis infection is linked to a preferential Th1 immune response, whereas susceptibility is associated with absence of IFN-gamma production. J Interferon Cytokine Res 20: 89–97.SS KashinoRA FazioliC. Cafalli-FavatiLH Meloni-BruneriCAC Vaz2000Resistance to Paracoccidioides brasiliensis infection is linked to a preferential Th1 immune response, whereas susceptibility is associated with absence of IFN-gamma production.J Interferon Cytokine Res208997
  10. 10. Souto JT, Figueiredo F, Furlanetto AB, Pfeffer K, Rossi MA, et al. (2000) Interferon-γ and Tumor Necrosis Factor-α determine resistance to Paracoccidioides brasiliensis infection in mice. Am J Pathol 156: 1811–1820.JT SoutoF. FigueiredoAB FurlanettoK. PfefferMA Rossi2000Interferon-γ and Tumor Necrosis Factor-α determine resistance to Paracoccidioides brasiliensis infection in mice.Am J Pathol15618111820
  11. 11. Bernardes ES, Silva NM, Ruas LP, Loyola AM, Hsu DK, et al. (2006) Toxoplasma gondii infection reveals a dual role for galectin-3 on innate and adaptive immune response. Am J Pathol 168: 1910–1920.ES BernardesNM SilvaLP RuasAM LoyolaDK Hsu2006Toxoplasma gondii infection reveals a dual role for galectin-3 on innate and adaptive immune response.Am J Pathol16819101920
  12. 12. Breuilh L, Vanhoutte F, Fontaine J, Van Stijn CM, Tillie-Leblond I, et al. (2007) Galectin-3 modulates immune and inflammatory responses during helminthic infection: impact of galectin-3 deficiency on the functions of dendritic cells. Infect Immun 75: 5148–5157.L. BreuilhF. VanhoutteJ. FontaineCM Van StijnI. Tillie-Leblond2007Galectin-3 modulates immune and inflammatory responses during helminthic infection: impact of galectin-3 deficiency on the functions of dendritic cells.Infect Immun7551485157
  13. 13. Ferraz LC, Bernardes ES, Oliveira AF, Ruas LP, Soares SG, et al. (2008) Lack of galectin-3 alters the balance of innate immune cytokines and confers resistance to Rhodococcus equi. Eur J Immunol 38: 2762–2775.LC FerrazES BernardesAF OliveiraLP RuasSG Soares2008Lack of galectin-3 alters the balance of innate immune cytokines and confers resistance to Rhodococcus equi.Eur J Immunol3827622775
  14. 14. Zuberi RI, Hsu DK, Kalayci O, Chen HY, Sheldon HK, et al. (2004) Critical role of galectin-3 in airway inflammation and bronchial hyperresponsiveness in a murine model of asthma. Am J Pathol 165: 2045–2053.RI ZuberiDK HsuO. KalayciHY ChenHK Sheldon2004Critical role of galectin-3 in airway inflammation and bronchial hyperresponsiveness in a murine model of asthma.Am J Pathol16520452053
  15. 15. Hsu DK, Yang RY, Pan Z, Yu L, Salomon DR, et al. (2000) Targeted disruption of the galectin-3 gene results in attenuated peritoneal inflammatory responses. Am J Pathol 156: 1073–1083.DK HsuRY YangZ. PanL. YuDR Salomon2000Targeted disruption of the galectin-3 gene results in attenuated peritoneal inflammatory responses.Am J Pathol15610731083
  16. 16. Fava Netto C, Vegas VS, Sciannaméa IM, Guarnieri EDB (1969) Antígeno polissacarídeo do Paracoccidioides brasiliensis. Estudo do tempo de cultivo do P. brasiliensis necessário ao preparo do antígeno. Rev Inst Med Trop Sao Paulo 11: 177–181.C. Fava NettoVS VegasIM SciannaméaEDB Guarnieri1969Antígeno polissacarídeo do Paracoccidioides brasiliensis. Estudo do tempo de cultivo do P. brasiliensis necessário ao preparo do antígeno.Rev Inst Med Trop Sao Paulo11177181
  17. 17. Calich VLG, Purchio A, Paula CR (1979) A new fluorescent viability test for fungi cells. Mycopathologia 66: 175–177.VLG CalichA. PurchioCR Paula1979A new fluorescent viability test for fungi cells.Mycopathologia66175177
  18. 18. Ho MK, Springer TA (1982) Mac-2, a novel 32,000 Mr mouse macrophage subpopulation-specific antigen defined by monoclonal antibodies. J Immunol 128: 1221–1228.MK HoTA Springer1982Mac-2, a novel 32,000 Mr mouse macrophage subpopulation-specific antigen defined by monoclonal antibodies.J Immunol12812211228
  19. 19. San-blas G, Niño-Vega G, Barreto L, Hebeler-Barbosa F, Bagagli E, et al. (2005) Primers for clinical detection of Paracoccidioides brasiliensis. J Clin Microbiol 43: 4255–4257.G. San-blasG. Niño-VegaL. BarretoF. Hebeler-BarbosaE. Bagagli2005Primers for clinical detection of Paracoccidioides brasiliensis.J Clin Microbiol4342554257
  20. 20. Burg JL, Grover CM, Pouletty P, Boothroyd JC (1989) Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction. J Clin Microbiol 27: 1787–1792.JL BurgCM GroverP. PoulettyJC Boothroyd1989Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction.J Clin Microbiol2717871792
  21. 21. Fazioli RA, Singer-Vermes LM, Kashino SS, Burger E, Franco M, et al. (1994) Delayed-type hypersensitivity response in an isogenic murine model of paracoccidioidomycosis. Mycopathologia 126: 137–146.RA FazioliLM Singer-VermesSS KashinoE. BurgerM. Franco1994Delayed-type hypersensitivity response in an isogenic murine model of paracoccidioidomycosis.Mycopathologia126137146
  22. 22. Miyaji M, Nishimura K (1983) Granuloma formation and killing functions of granuloma in congenitally athymic mice infected with Blastomyces dermatitidis and Paracoccidioides brasiliensis. Mycopathologia 82: 129–141.M. MiyajiK. Nishimura1983Granuloma formation and killing functions of granuloma in congenitally athymic mice infected with Blastomyces dermatitidis and Paracoccidioides brasiliensis.Mycopathologia82129141
  23. 23. Arruda C, Valente-ferreira RC, Prieto A, Kashino SS, Fazioli RA, et al. (2004) Dual role of Interleukin-4 (IL-4) in pulmonary paracoccidioidomycosis: endogenous IL-4 can induce protection or exacerbation of disease depending on host genetic pattern. Infect Immun 72: 3932–3940.C. ArrudaRC Valente-ferreiraA. PrietoSS KashinoRA Fazioli2004Dual role of Interleukin-4 (IL-4) in pulmonary paracoccidioidomycosis: endogenous IL-4 can induce protection or exacerbation of disease depending on host genetic pattern.Infect Immun7239323940
  24. 24. Calich VLG, Singer-Vermes LM, Siqueira AM, Burger E (1985) Susceptibility and resistance of inbred mice to Paracoccidioides brasiliensis. Br J Exp Pathol 66: 585–594.VLG CalichLM Singer-VermesAM SiqueiraE. Burger1985Susceptibility and resistance of inbred mice to Paracoccidioides brasiliensis.Br J Exp Pathol66585594
  25. 25. Singer-Vermes LM, Caldeira CB, Burger E, Calich VLG (1993) Experimental murine paracoccidioidomycosis: relationship among the dissemination of the infection, humoral and cellular immune responses. Clin Exp Immunol 94: 75–79.LM Singer-VermesCB CaldeiraE. BurgerVLG Calich1993Experimental murine paracoccidioidomycosis: relationship among the dissemination of the infection, humoral and cellular immune responses.Clin Exp Immunol947579
  26. 26. Khan AQ, Chen Q, Wu ZQ, Paton JC, Snapper CM, et al. (2005) Both innate immunity and type-1 humoral immunity to Streptococcus pneumonie are mediated by MyD88 but differ in their relative levels of dependence on toll-like receptor 2. Infect Immun 73: 298–307.AQ KhanQ. ChenZQ WuJC PatonCM Snapper2005Both innate immunity and type-1 humoral immunity to Streptococcus pneumonie are mediated by MyD88 but differ in their relative levels of dependence on toll-like receptor 2.Infect Immun73298307
  27. 27. Moscardi-Bacchi M, Brummer E, Stevens DA (1994) Support of Paracoccidioides brasiliensis multiplication by human monocyte or macrophages: inhibition by activated phagocytes. J Med Microbiol 40: 159–164.M. Moscardi-BacchiE. BrummerDA Stevens1994Support of Paracoccidioides brasiliensis multiplication by human monocyte or macrophages: inhibition by activated phagocytes.J Med Microbiol40159164
  28. 28. Gonzales A, Gregori W, Velez D, Restrepo A, Cano LE (2000) Nitric oxide participation in the fungicidal mechanism of gamma interferon-activated murine macrophages against Paracoccidioides brasiliensis conidia. Infect Immun 68: 2546–2552.A. GonzalesW. GregoriD. VelezA. RestrepoLE Cano2000Nitric oxide participation in the fungicidal mechanism of gamma interferon-activated murine macrophages against Paracoccidioides brasiliensis conidia.Infect Immun6825462552
  29. 29. Ohmori Y, Hamilton TA (2000) Interleukin-4/STAT6 represses STAT1 and NF-kB-dependent transcription through distinct mechanisms. J Biol Chem 275: 38095–38103.Y. OhmoriTA Hamilton2000Interleukin-4/STAT6 represses STAT1 and NF-kB-dependent transcription through distinct mechanisms.J Biol Chem2753809538103
  30. 30. Kopf M, Gross GL, Bachmann M, Lamers MC, Bluethmann H, et al. (1993) Disruption of murine IL-4 gene blocks Th2 cytokine response. Nature 362: 245–248.M. KopfGL GrossM. BachmannMC LamersH. Bluethmann1993Disruption of murine IL-4 gene blocks Th2 cytokine response.Nature362245248
  31. 31. Magee DM, Cox RA (1995) Roles of interferon and interleukin-4 in genetically determined resistance to Coccidioides immitis. Infect Immun 63: 3514–3519.DM MageeRA Cox1995Roles of interferon and interleukin-4 in genetically determined resistance to Coccidioides immitis.Infect Immun6335143519
  32. 32. Romani L, Mencacci A, Grohmann U, Mocci S, Mosci P, et al. (1992) Neutralizing antibody to Interleukin 4 induces systemic protection and T helper type 1-associated immunity in murine candidiasis. J Exp Med 176: 19–25.L. RomaniA. MencacciU. GrohmannS. MocciP. Mosci1992Neutralizing antibody to Interleukin 4 induces systemic protection and T helper type 1-associated immunity in murine candidiasis.J Exp Med1761925
  33. 33. Mencacci A, Del Sero G, Cenci E, Fè d'Ostiani C, Bacci A, et al. (1998) Endogenous Interleukin 4 is required for development of protective CD4+ T helper type 1 cell response to Candida albicans. The Journal of Experimental Medicine 187: 307–317.A. MencacciG. Del SeroE. CenciC. Fè d'OstianiA. Bacci1998Endogenous Interleukin 4 is required for development of protective CD4+ T helper type 1 cell response to Candida albicans.The Journal of Experimental Medicine187307317
  34. 34. Hostetler JS, Brummer E, Coffman RL, Stevens DA (1993) Effect of anti IL-4, interferon-gamma and antifungal triazole (SCH42427) in paracoccidioidomycosis: correlation of IgE levels with outcome. Clin Exp Immunol 94: 11–16.JS HostetlerE. BrummerRL CoffmanDA Stevens1993Effect of anti IL-4, interferon-gamma and antifungal triazole (SCH42427) in paracoccidioidomycosis: correlation of IgE levels with outcome.Clin Exp Immunol941116
  35. 35. Pina A, Valente-ferreira RC, Molinari-Madlum EEW, Vaz CAC, Keller AC, et al. (2004) Absence of Interleukin-4 determines less severe pulmonary paracoccidioidomycosis associated with impaired Th2 response. Infect Immun 72: 2369–2378.A. PinaRC Valente-ferreiraEEW Molinari-MadlumCAC VazAC Keller2004Absence of Interleukin-4 determines less severe pulmonary paracoccidioidomycosis associated with impaired Th2 response.Infect Immun7223692378
  36. 36. Zhu J, Yamane H, Cote-Sierra J, Guo L, Paul WE (2006) GATA-3 promotes Th2 responses through three different mechanisms: induction of Th2 cytokine production, selective growth of Th2 cells and inhibition of Th1 cell-specific factors. Cell Research 16: 3–10.J. ZhuH. YamaneJ. Cote-SierraL. GuoWE Paul2006GATA-3 promotes Th2 responses through three different mechanisms: induction of Th2 cytokine production, selective growth of Th2 cells and inhibition of Th1 cell-specific factors.Cell Research16310
  37. 37. Chen HY, Sharma BB, Yu L, Zuberi RI, Weng IC, et al. (2006) Role of galectin-3 in mast cell function: galectin-3-deficient mast cells exhibit impaired mediator release and defective JNK expression. J Immunol 177: 4991–4997.HY ChenBB SharmaL. YuRI ZuberiIC Weng2006Role of galectin-3 in mast cell function: galectin-3-deficient mast cells exhibit impaired mediator release and defective JNK expression.J Immunol17749914997
  38. 38. Ferreira KS, Bastos KRB, Russo M, Almeida SR (2007) Interaction between Paracoccidioides brasiliensis and pulmonary dendritic cells induces interleukin-10 production and toll-like receptor 2 expression: possible mechanism of susceptibility. J Infect Dis 196: 1108–1115.KS FerreiraKRB BastosM. RussoSR Almeida2007Interaction between Paracoccidioides brasiliensis and pulmonary dendritic cells induces interleukin-10 production and toll-like receptor 2 expression: possible mechanism of susceptibility.J Infect Dis19611081115
  39. 39. Netea MG, Sutmuller R, Hermann C, Van der Graaf CA, Van der Meer JW, et al. (2004) Toll-like receptor 2 suppresses immunity against Candida albicans through induction of IL-10 and regulatory T cells. J Immunol 172: 3712–3718.MG NeteaR. SutmullerC. HermannCA Van der GraafJW Van der Meer2004Toll-like receptor 2 suppresses immunity against Candida albicans through induction of IL-10 and regulatory T cells.J Immunol17237123718