Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Analysis of the Pseudoalteromonas tunicata Genome Reveals Properties of a Surface-Associated Life Style in the Marine Environment

  • Torsten Thomas ,

    t.thomas@unsw.edu.au

    Affiliation Centre of Marine Bio-Innovation and School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, Australia

  • Flavia F. Evans,

    Affiliation Centre of Marine Bio-Innovation and School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, Australia

  • David Schleheck,

    Affiliations Centre of Marine Bio-Innovation and School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, Australia, Department of Biology, The University of Konstanz, Konstanz, Germany

  • Anne Mai-Prochnow,

    Affiliations Centre of Marine Bio-Innovation and School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, Australia, Institute of Infection, Immunity and Inflammation, Centre for Biomolecular Sciences, University Park, University of Nottingham, Nottingham, United Kingdom

  • Catherine Burke,

    Affiliation Centre of Marine Bio-Innovation and School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, Australia

  • Anahit Penesyan,

    Affiliation Centre of Marine Bio-Innovation and School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, Australia

  • Doralyn S. Dalisay,

    Affiliation Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, California, United States of America

  • Sacha Stelzer-Braid,

    Affiliations Centre of Marine Bio-Innovation and School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, Australia, Virology Research, Department of Microbiology, South Eastern Area Laboratory Service, Prince of Wales Hospital, Randwick, New South Wales, Australia

  • Neil Saunders,

    Affiliation School of Molecular and Microbial Sciences, University of Queensland, Brisbane, Australia

  • Justin Johnson,

    Affiliation J. Craig Venter Institute, Rockville, Maryland, United States of America

  • Steve Ferriera,

    Affiliation J. Craig Venter Institute, Rockville, Maryland, United States of America

  • Staffan Kjelleberg,

    Affiliation Centre of Marine Bio-Innovation and School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, Australia

  • Suhelen Egan

    Affiliation Centre of Marine Bio-Innovation and School of Biotechnology and Biomolecular Sciences, The University of New South Wales, Sydney, New South Wales, Australia

Analysis of the Pseudoalteromonas tunicata Genome Reveals Properties of a Surface-Associated Life Style in the Marine Environment

  • Torsten Thomas, 
  • Flavia F. Evans, 
  • David Schleheck, 
  • Anne Mai-Prochnow, 
  • Catherine Burke, 
  • Anahit Penesyan, 
  • Doralyn S. Dalisay, 
  • Sacha Stelzer-Braid, 
  • Neil Saunders, 
  • Justin Johnson
PLOS
x

Abstract

Background

Colonisation of sessile eukaryotic host surfaces (e.g. invertebrates and seaweeds) by bacteria is common in the marine environment and is expected to create significant inter-species competition and other interactions. The bacterium Pseudoalteromonas tunicata is a successful competitor on marine surfaces owing primarily to its ability to produce a number of inhibitory molecules. As such P. tunicata has become a model organism for the studies into processes of surface colonisation and eukaryotic host-bacteria interactions.

Methodology/Principal Findings

To gain a broader understanding into the adaptation to a surface-associated life-style, we have sequenced and analysed the genome of P. tunicata and compared it to the genomes of closely related strains. We found that the P. tunicata genome contains several genes and gene clusters that are involved in the production of inhibitory compounds against surface competitors and secondary colonisers. Features of P. tunicata's oxidative stress response, iron scavenging and nutrient acquisition show that the organism is well adapted to high-density communities on surfaces. Variation of the P. tunicata genome is suggested by several landmarks of genetic rearrangements and mobile genetic elements (e.g. transposons, CRISPRs, phage). Surface attachment is likely to be mediated by curli, novel pili, a number of extracellular polymers and potentially other unexpected cell surface proteins. The P. tunicata genome also shows a utilisation pattern of extracellular polymers that would avoid a degradation of its recognised hosts, while potentially causing detrimental effects on other host types. In addition, the prevalence of recognised virulence genes suggests that P. tunicata has the potential for pathogenic interactions.

Conclusions/Significance

The genome analysis has revealed several physiological features that would provide P. tunciata with competitive advantage against other members of the surface-associated community. We have also identified properties that could mediate interactions with surfaces other than its currently recognised hosts. This together with the detection of known virulence genes leads to the hypothesis that P. tunicata maintains a carefully regulated balance between beneficial and detrimental interactions with a range of host surfaces.

Introduction

Bacterial surface colonisation is a process of critical ecological and economical importance in the marine environment. Initial attachment of the cells and subsequent biofilm formation are the first, important steps in a cascade of recruitment or inhibition events of secondary settling organisms, including algal spores or invertebrate larvae. On artificial surfaces like ship hulls or aquaculture infrastructure the final surface community of bacteria as well as lower and higher eukaryotes (“the fouling community”) is clearly undesirable and often causes significant cost in clean-up or replacement [1], [2]. On living surfaces like algae or invertebrates without physical or chemical defence substantial colonisation can impair host function and ultimately lead to death. However, some marine living surfaces remain unfouled in the field and the surface-associated bacterial community has been strongly implied in providing an inhibitory effect on secondary settlers. Indeed, surface-associated bacteria have proven to be a rich source of bioactive molecules that mediate the behaviour of higher eukaryotes or possess killing activities [3], [4]. Here a mutualistic relationship can be postulated where the bacterial community protects the host from fouling, while the host surface might provide nutrients and physical protection to the bacteria. However, ecological theory would also predict gradients between mutualism, commensalism and parasitism to emerge and indeed bacterial surface communities and their members can have a pathogenic effect on the host [5], [6].

Host-associated diversity is often very distinct from the planktonic diversity of the surrounding waters [4], which may be reflective of differing roles for these communities. Pseudoalteromonas tunicata is a model organism for microbial-host interactions on marine living surface and the production of antifouling metabolites [7]. This green-pigmented bacterium has been isolated from the surface of the marine alga Ulva lactuca and the tunicate Ciona intestinalis, and related strains from the heterotrophic, gammaproteobacterial genera Pseudoalteromonas are often found in association with eukaryotic hosts such as sponges, mussels, pufferfish and a range of algae [7]. P. tunicata produces a range of target-specific inhibitors including a large antibacterial protein [8], a small polar heat-stable anti-larval molecule [9], a putative antialgal peptide [10], a yellow-pigmented, antifungal tambjamine molecule [11], [12] and a purple pigment (violacein) that inhibits protozoan grazing [13]. This chemical arsenal has been shown to be important for the survival of P. tunicata in the highly competitive marine surface environment [14], [15].

To obtain a better understanding of the properties of surface-associated bacteria we present here an in-depth analysis of the genome sequence of P. tunicata. Comparative genomics with related strains revealed novel insight into the mode of generating genetic variations, surface attachment and biofilm formation, stress response, nutrient acquisition and ability to degrade polymers of various eukaryotic surfaces. Our analysis also suggests mechanisms for host specificity for P. tunicata and the potential for pathogenic interactions.

Materials and Methods

Genome sequencing, annotation and analysis

The genome of P. tunicata strain D2 was sequenced and assembled using a hybrid sequencing strategy and further details are given in Goldberg et al. [16] . Annotation was performed with the pipeline implemented by the Institute of Genome Research (TIGR), which included gene identification with GLIMMER [17], searches against PFAM [18], TIGRFAM [19], COG [20] and PROSITE [21]. All open reading frames (ORF) were manually checked, and annotations were curated using Manatee software package (http://manatee.sourceforge.net) following the curation guidelines outlined by Haas et al. [22]. Comparative analysis was performed with the Integrated Microbial Genome (IMG) system [23]. Instances of horizontal gene transfer were analysed by interpolated variable order motifs (IVOM) as described by Vernikos and Parkhill [24]. Clustered regularly interspaced short palindromic repeats (CRISPRs) were identified with CRISPR-finder [25]. The prediction of signal peptides (SP) was performed using SignalP v 3.0 [26] . The protein sequences were considered SP-positive where all the NN-scores were above the default cut-off using both softwares. The P. tunicata proteome was also tested for the presence of membrane spanning domains using TMHMM v 2.0 [27]. Proteins having a signal peptide were scanned for protein families against the Pfam database through global alignments (Pfam_ls) at a significance cut-off level (E-value) of 10−5. Phylogenetic analysis was performed by alignment of protein sequences using Clustal W [28] and neighbor-joining trees were generated with 1000 bootstraps.

Physiological studies

To assess the ability of P. tunicata to grow on specific substrates, overnight cultures of P. tunicata were inoculated in either marine broth (Difco 2216) or marine minimal medium (3 M) supplemented with either trehalose, chitin, chitobiose or cellulose as the sole carbon source according to Stelzer et al. [29]. Cultures were incubated aerobically at room temperature (22°C) and growth was monitored by optical density (600 nm) for a period of 48 hours.

To detect phage-particles, P. tunicata cell-free supernatant was examined under transmission electron microscopy (TEM). The sample was placed on a carbon-coated formvar copper grid and negatively stained with 2% phosphotungstic acid for 30 sec. The grid was then examined using a Hitachi H700 TEM at an accelerating voltage of 75 kV.

Pigment production was measured spectrophotometrically using a Beckman DU 640 spectrophotometer at an absorbance of 575 nm and 425 nm for purple violacein and the yellow tambjamine pigment, respectively, as described in Egan et al. [30].

Results and Discussion

Overall comparison of Pseudoalteromonas or Alteromononas genomes

Hierarchical clustering and principle component analysis of cluster of orthologous groups (COG) with other sequenced members of the Alteromonadales available in the IMG database indicate that P. tunicata is functionally most closely related to P. haloplanktis, P. atlantica, Alteromonas macleodii and Alteromonadales sp. TW7. General features of these genomes are given in Table 1 and their phylogenetic relationship based on the 16S rRNA gene is illustrated in Figure 1. The COG profiles between these organisms revealed however a number of COG categories that were over-represented in P. tunicata (Figure 2) including signal transduction mechanisms, defence mechanisms and cell motility. P. tunicata shows the highest proportion of genes assigned to signal transduction (10.05%) of any Alteromondales genome (second highest: Shewanella amazonensis with 8.62%; lowest: Psychromonas sp. CMPT3 with 5.10%). This trend is mainly caused by an over-representation of COG5000 (signal transduction histidine kinase involved in nitrogen fixation and metabolism regulation) and COG0664 (cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases). P. tunicata also has the highest value (2.4%) for the COG category defence of any Alteromondales genome and this is specifically due to more genes related to ABC transporter functions, including those predicted to be involved in transport of drugs and/ or antimicrobial peptides (COG0577, COG1131, COG1136, COG1566) and those related to the synthesis of potential bioactive compounds such as non-ribosomal peptide synthetase (NRPS) modules (COG1020). The abundance of genes involved in transport and expression of potential defence compounds are consistent with P. tunicata's successful competition on living surfaces. The major difference in the COG category cell motility is in COG0840 (methyl-accepting chemotaxis protein), where P. tunicata has 35 hits, which is at least twice as many as any other Pseudoalteromonas or Alteromononas species.

thumbnail
Figure 1. Phylogenetic tree based on 16S rRNA gene sequence of Pseudoalteromonas and Alteromonas species compared in the study.

Tree was generated by maximum likelihood analysis of 1276 nucleotide positions. The sequence alignment and phylogenetic calculations were performed and manually checked with the ARB software package [97]. The 16S rRNA gene sequence of Silicibacter pomeroyi DSS-3 was used as an outgroup.

https://doi.org/10.1371/journal.pone.0003252.g001

thumbnail
Figure 2. Functional comparison of Pseudoalteromonas and Alteromonas genomes.

Relative abundance compared to all COGs (panel A) and absolute number of categories (panel B) for selected Pseudoalteromonas and Alteromonas species. COGs were extracted from IMG using greater than 30% identity and expectancy values of less than 10−5 cut-offs and assigned to functional categories.

https://doi.org/10.1371/journal.pone.0003252.g002

thumbnail
Table 1. General feature of Pseudoalteromonas and Alteromonas genomes compared in this study.

https://doi.org/10.1371/journal.pone.0003252.t001

We also compared the genomes of Pseudoalteromonas and Alteromononas species to the predominantly planktonic dataset of the Global Ocean Survey (GOS) [31]. Using recruitment plots [31] and a 95% nucleotide identity cut-off, which is indicative for species level similarity, [32] we found 31, 59, 6, 2327 and 1269 matching reads in the GOS dataset for P. tunicata, P. haloplanktis, P. atlantica, Alteromonadales sp. TW7 and A. macleodii, respectively. The matches against the Pseudoalteromonas species are mostly in conserved regions of the chromosome (e.g. ribosomal genes) and hence reflect low gene divergence rather than true phylogenetic relatedness. The hits for Alteromonadales sp. TW7 and A. macleodii are distributed over the whole chromosome and are therefore likely due to true representation of these organisms (or close relatives) in the dataset. Over 95% of the hits in the GOS dataset come from the deeply sampled Sargasso Sea and for the same sample the abundant, free-living, phototrophic species Prochlorococcus marinus MED4 [33] recruits 2801 reads with the same cut-offs as above. Together this would indicate that Alteromonadales sp. TW7 and A. macleodii (or closely related organisms) constitute a significant portion of the heterotrophic population in these planktonic communities, while the three Pseudoalteromonas species are less prevalent.

Mobile genetic elements

The presence of mobile genetic elements is common in bacteria, however in comparison to closely related marine bacteria they are more abundant in P. tunicata, where they comprise 2% of the entire genome. The P. tunicata genome contains one 33 kb-sized P2-like prophage, which is similar to the one found in the genome of P. atlantica, Hahella chejuensis, Moritella sp PE36, P. aeruginosa PA7, Desulfovibrio vulgaris, Haemophilus influenza, Aeromonas salmonicida and Vibrio cholerae 0395. P2-like phage is a member of the myxoviridae and is one of the 5 major prophage groups commonly detected in Gammaproteobacteria [34]. A microscopic inspection of the P. tunicata media supernatant in late growth phase revealed phage-like particles (Figure S1 online support material) suggesting that the P. tunicata P2-like phage is able to enter a lytic cycle. This observation together with the evident distribution of this prophage among marine and other bacteria could imply this phage in horizontal gene transfer that provide an adaptive advantage for the bacterial host in the marine environment or mediate acquisition of virulence genes.

There are 33 genes encoding for transposases, of which approximately half are full-length genes. Of interest is the detection of multiple copies of the insertion sequence (IS) related to the IS492 element previously characterised in P. atlantica [35], [36]. Control of phase variation, related to expression of extracellular polymeric substances (EPS) in P. atlantica has been attributed to the mobilisation of IS492. The ability of P. atlantica to control EPS production in this manner may have profound effects on its lifestyle, which involves the movement of cells from the seaweed surface to the water column [36], [37]. Adjacent to the IS492-related elements in P. tunicata are genes encoding for sensor/response regulatory proteins, a catalase enzyme and various hypothetical proteins. Other putative transposon elements (such as the IS91 and ISCps7 families) are adjacent to a relEB-like toxin/ antitoxin system, a collagenase gene and the antifungal tambjamine cluster. These transposable elements may play a role in the genetic regulation of environmentally relevant phenotypes such as environmental sensing, competition or oxidative stress resistance and their mobilisation might enable P. tunicata to switch between a surface-associated and a free-living form.

Integrons play a major role in genetic transfer (and spread) of antibiotic resistant gene cassettes and toxins. The genome of P. tunicata encodes for four putative site-specific recombinases of the IntI4 type (COG0582), which are involved in the recombination and integration of class 4 integron sequences [38]. In contrast, Alteromonadales sp. TW7 contains two copies of this integrase, while P. haloplanktis, P. atlantica, and A. macleodii possess only one copy each. Interestingly, one of these putative integrase genes in P. tunicata is located down-stream of the tambjamine biosynthesis cluster, which has so far not been identified in closely related strains. In addition the 30 kb sequence flanked by the gene cluster and the integrase show three regions in the IVOM analysis with signature for foreign DNA, which suggests the possibility that the antifungal characteristic of P. tunicata was originally derived via horizontal gene transfer. In fact the most similar cluster was identified in Streptomyces coelicolor A3(2), where it is involved in the production of a structural relative of the tambjamine, the compound undecylprodigiosin [39].

A clustered regularly interspaced short palindromic repeat (CRISPR) region of 5428 bp length consisting of 91 times 28 bp repeat regions with the consensus sequence (GTTCACTGCCGCACAGGCAGCTCAGAAA) and 32 bp spacer was also identified in the P. tunicata genome. CRISPR elements are found in approximately half of the currently sequenced bacterial and archaeal genomes and are flanked by conserved CRISPR-associated (CAS) proteins [40]. Based on the homology of the CAS proteins to DNA replicating and processing enzymes and the likely origin of the spacer regions from mobile elements it has been speculated that CRISPRs provide ‘immunity’ to foreign DNA [41]. This hypothesis was recently supported by studies in Streptococcus thermophilus demonstrating that the removal or addition of spacers modifies the phage-resistance phenotype of the cell [41]. Upstream of the CRISPR element of P. tunicata is a group of five CAS proteins with three of them having homology to known CAS classes (CAS1, 3 and 4). Perfect matches to the P. tunicata repeat consensus were also found in the CRISPRs of Yersinia pestis (strains Pestoides F Nepal516, KIM, CO92, biovar Orientalis str. IP275 and Antiqua) Shewanella putrefaciens 200, Shewanella sp. W3-18-1, Psychromonas ingrahamii 37, Yersinia pseudotuberculosis IP 31758, Vibrio cholerae (strains V52 and RC385), Zymomonas mobilis subsp. mobilis ZM4, Photobacterium profundum SS9, Legionella pneumophila str. Lens and Erwinia carotovora subsp. atroseptica SCRI1043. In contrast, CRISPR elements could not be detected in the other two Pseudoalteromonas genomes and in Alteromonadales strain TW-7. One CRISPR was detected in A. macleodii (55 repeats), but its repeat sequence (GTGTTCCCCGTGCCCACGGGGATGAACCA) showed no similarity to the one from P. tunicata.

In summary, P. tunicata appears to have acquired the ability to protect itself from phage infection (e.g. via CRISPRs), yet shows other evidence and mechanisms of horizontal gene transfer (e.g. integrases) and genomic variation. This would suggest the requirement for a strict preference for and regulation of the movement of mobile genetic elements for the generation of phenotypic variation and niche adaptation. The abundance of signal transduction proteins and transcriptional regulator-like proteins (COG5000; see above), many of which have currently no known function, might play an additional role in this process.

Surface attachment and biofilm formation

Successful establishment on a host surface requires the bacterial cell to first adhere to host tissue, often followed by colonisation in the form of a biofilm. These processes have been well studied across several bacterial pathogens, however the molecular interactions occurring between marine bacteria and their hosts are not as well defined.

The genome of P. tunicata encodes for several cell-surface structures and extracellular polymer components known in other organisms to be important for attachment. These include genes encoding for curli, Type IV pili, MSHA- pili and capsular polysaccharide (O-antigen). Curli are proteinaceous fibres belonging to the amyloid class and can make up a major component of the extracellular matrix of bacterial cells [42]. Although curli homologs can be found in several bacterial classes, the majority of studies to date have focused on their role in cell adhesion, biofilm formation, invasion and host inflammatory response in the Enterobacteriaceae (namely E. coli and Salmonella) [42]. P. tunicata possesses all the genes required for curli production and assembly, however the gene organization differs from that described for the Enterobacteriaceae. Rather than the two divergently transcribed operons consisting of the major structural subunits (CsgAB) and the accessory proteins (CsgDEFG) required for transcription and assembly, the csgABEFG genes in P. tunicata appear as one continuous operon with the regulator protein CsgD located downstream and in the opposite orientation. This gene arrangement is also found in Alteromonas macleodii, which may indicate a relatively recent gene rearrangement event. There was no evidence for curli genes in the other two Pseudoalteromonas species and in Alteromonas sp. TW7. Studies have shown that curli play a role in the interaction between E. coli and Salmonella with plant surfaces [43], [44], raising the possibility that P. tunicata produces curli to attach to algal host surfaces such as Ulva lactuca. Thus curli may be complementary to the previously described MSHA- pili mediated attachment of P. tunicata cells to marine host surfaces [45].

The P. tunicata genome has nine separate gene clusters related to pili biogenesis (including the MSHA-pili). Five of the clusters contain a putative pre-pilin protein belonging to the type IVa pili characteristic of PilA or PilE proteins of Pseudomonas sp [46], [47]. Some of the putative structural pilin genes are quite divergent from the characterised pili and may represent new pilus-like structures (Figure 3). One of the pili gene clusters and its flanking region is highly conserved in P. tunicata, P. haloplanktis and Alteromondales sp. TW7 and contains homologs to the two-component response regulator system algZ/algR, which are involved in the regulation of alginate synthesis and pili-mediated, twitching motility in Pseudomonas aeruginosa [48]. Given that no alginate biosynthesis cluster is present in P. tunicata, we speculate that this regulatory system may only play a role in the expression of the pili cluster. Further downstream of the algZ is a homolog to mviN, a gene encoding for a membrane protein shown to be involved in the virulence in a variety of pathogens [49], [50], [51]. Upstream is a gene encoding for a homolog of ComL, a characterised lipoprotein involved in DNA uptake in Neisseria sp. (COG4105). Together the genes in this conserved cluster are potentially involved in colonisation and virulence and could reflect a role for P. tunicata as a potential pathogen.

thumbnail
Figure 3. Phylogeny of pili proteins.

Phylogenetic tree of pili proteins found in the P. tunicata genome. The pili proteins of P. tunicata are highlighted in bold and a specific name is given, if characterised. Other characterised pili proteins are shown in bold. The ten best blast-hits in NCBI's non-redundant database of the putative pili protein of P. tunicata and characterised pili proteins were used to construct the tree. Accession number and taxonomic source are shown. Bootstraps values over 750 are not shown.

https://doi.org/10.1371/journal.pone.0003252.g003

Another interesting protein identified in the P. tunicata genome is LipL32, a lipoprotein so far only found in Leptospira species and P. tunicata. LipL32 is involved in adhesion to common extracellular matrix (ECM) fibres, such as collagen and laminin in Leptospira sp. [52]. The same study demonstrated that the P. tunicata homolog of LipL32 is functionally similar to that of the Leptospira protein, suggesting that this protein may have an important function in mediating interactions between P. tunicata and its sessile marine hosts. The fact that the tunicate Ciona intestinalis, a known host of P. tunicata, has many of the genes for the production of the ECM components mentioned above gives further support for this hypothesis [53].

The overall representation of different adhesive structures in P. tunicata, suggest that the bacterium can probably adhere to surfaces composed of different fibres and textures and that it possibly possesses a wider range of hosts, in addition to the previously recognised tunicates and algae.

The P. tunicata genome contains several enzymes for the production of a complex extracellular biofilm matrix. A capsular polysaccharide genes cluster (cspA-D) is present as well as a gene cluster encoding for a protein with a biosynthesis/ export domain (Pfam 02563) and similarity to the exopolysaccharide production protein ExoF from Sinorhizobium meliloti [54]. Downstream of the ExoF homolog lies a protein with a Wzz-like chain length determinant domain of surface polysaccharides (Pfam 02706). Upstream of the same gene is a conserved hypothetical protein that is found in the same genomic context in a range of Vibrio and Alteromondales genomes. An additional cluster of two genes with Pfam 02563 and 2706 domains is located just upstream of a Type II secretion system gene cluster and downstream of a mechano-sensitive channel protein of the MscS family. A third gene cluster contains an ExoF homolog with a Pfam 02563 domain in addition to other genes putatively involved in polysaccharide synthesis (putative ExoQ homolog, glycosyl transferase) in an arrangement unique to P. tunicata amongst all sequenced genomes. Together this data suggest that P. tunicata can produce and export a range of polysaccharides with potential role in biofilm matrix formation.

Production of bioactive compounds and toxins

P. tunicata has been recognised as a bacterium rich in bioactive secondary metabolites. Analysis of the genome has revealed the genes involved in the biosynthetic pathway of previously characterised activities including the antifungal tambjamine [11], [55], and the purple pigment violacein. Genome sequencing revealed that the violacein cluster of P. tunicata resembled that of other violacein-producing bacteria such as Chromobacterium violaceum, consisting of five consecutive genes vioA-D and the recently described vioE [56]. However there is no indication for a recent horizontal gene transfer of the cluster in P. tunicata. Violacein has been demonstrated to have antibacterial activity and more recently to be used by biofilm-forming bacteria as a predator grazing defence strategy [13]. In P. tunicata it has been suggested that violacein localises to the outer membrane of the cell [13] and directly upstream from vioA is a gene encoding for a Multi-Antimicrobial and Toxic compound Extrusion (MATE) family efflux pump. These pumps are often used to protect the cell from damage by toxins and antimicrobial agents [57] and might provide a mechanism by which P. tunicata exports the otherwise toxic violacein compound.

In addition to the previously described compounds the genome analysis revealed the potential for the production of other toxins, including a putative RTX-like toxin and a toxin/antitoxin system, which is homologous to the YoeB/YefM system in E. coli that is believed to act as a stress regulator [58] (see below). Noteworthy is also a 61 Kb large cluster of nine predicted non-ribosomal peptide synthetase (NRPS) genes. NRPS have been identified in many microorganisms and are responsible for the production of peptides with broad structural and biological activities [59]. NRPS are modular and are often composed of an adenylation (A) domain for substrate recognition, a peptidyl carrier protein (PCP) domain that holds the activated substrate, a condensation (C) domain for peptide bond formation and a thioesterase (T) domain for termination of peptide synthesis [59]. All nine NRPS within this cluster in the P. tunicata genome have putative AT, C and PCP domains with one having a T domain. A second T domain containing protein is located down stream (in opposite orientation to the nine NRPS) and lies in a putative operon with a two-component regulatory system, which might be involved in the expression of this terminase in response to environmental factors. The exact nature and regulation of the compound produced by this NRPS is currently under investigation.

Stress response

A common feature of all bacteria is their ability to sense and respond to adverse environmental conditions. Besides having all of the features for carbon and nutrient starvation as described for typical copiotrophic organism (RpoS, RelA, universal stress protein E, starvation stringent proteins and phage shock proteins) the genome of P. tunicata also encodes for a large number of proteins involved in oxidative stress and iron homeostasis. P. tunicata has four antioxidant proteins of the AhpC/Tsa family, including catalase and superoxide dismutase, in addition to an organic hydroperoxide detoxification protein and an alkyl hydroperoxide reductase, which protect against killing and DNA peroxide derived damage, respectively. Key regulators of the oxidative stress response are also present (such as SoxR). In contrast to these protection mechanisms there is an apparent absence of functions that result in the production of reactive oxygen species (ROS), except for the antibacterial protein AlpP (see below). P. tunicata is lacking the otherwise ubiquitous molybdopterin metabolism and several of the genes encoding for proteins that utilise this co-factor for the generation of ROS species (eg. xanthine oxidase). This feature has also been identified in the psychrophilic bacterium P. haloplanktis as an important strategy for reducing the effect of oxidative stress, which is increased at low temperature [60]. A high number of proteins involved in oxidative stress protection may be typical for bacteria associated with a eukaryotic host, as a common defence strategy used by a range of plants and animals is the production of oxidative bursts [61]. The oxidative stress proteins may also play an important role in protecting P. tunicata against its own antibacterial protein AlpP. AlpP functions as a lysine-oxidase resulting in the production of hydrogen peroxide that kills other bacteria, but also P. tunicata cells themselves in the centre of biofilm microcolonies [62]. A fine-tuned and differential response to hydrogen peroxide is clearly required to prevent or facilitate cell death of kin in these situations.

We also identified several genes involved in heavy metal detoxification, including cutA and czcA/czcB, which encode for a heavy metal efflux pump and are important for resistance to cobalt, zinc and cadmium [63], [64]. Heavy metal resistance has been described to occur in some marine costal isolates [65] as well as in marine Alteromondales species [66], [67] and might provide protection against sporadic or permanent influx of contaminations from land run-off.

Polymer metabolism and its implication for host-bacteria interactions

The P. tunicata genome analysis indicated a niche adaptation for the acquisition of substrates for growth from the extracellular digestion of surface-associated polymeric substances and uptake and utilization of their respective monomers. Degradation of organic matter in the oceans is fundamental for the cycling of elements and normally undertaken in the pelagic zone by bacteria attached to organic aggregates [68]. Members of the Cytophaga-Flavobacterium group are amongst the most commonly found aggregate-associated organisms involved in organic matter degradation [69], [70]. According to Pfam categories the largest group of characterised proteins in the P. tunicata secretome are hydrolytic enzymes (Figure 4), suggesting that the bacterium is an efficient degrader of complex organic matter in the marine environment and thus may play a similar role as the CFB group on surfaces. In detail, the P. tunicata secretome consists of 371 predicted signal P containing proteins, and is approximately three-fold larger than that of P. atlantica and P. haloplanktis with 118 and 110 proteins, respectively. Overall the proportion of Sec-secreted proteins encoded by P. tunicata (8.5%) was similar to bacteria known to transport a large number of proteins to the extracellular environment. For example, B. subtilis is able to secrete nearly 170 proteins (∼4% of proteome) across the plasma membrane via the Sec translocation alone [71],while common plant pathogens encode about 4% to 11% of signal peptide containing proteins in their genome [72].

thumbnail
Figure 4. Functional properties of predicted P. tunicata secretome.

Major protein families identified in the secretome of P. tunicata according to the Pfam database. Hypothetical proteins (141 entries) did not match to any HMM in the Pfam database; 20 proteins have the TonB-dependent receptor domain (TonB_dep_Rec); the glycolytic hydrolases (‘glyco_hydro’) group contains 11 proteins in total; 36 proteins have HMM domains that are found in different peptidases; ‘a/amido-hydrolases’ refers to alpha- and amido-hydrolases with 6 proteins in total; ‘MipA’ refers to Mlt-interacting protein like sequences with 5 sequences; ‘SBP_bac’ for extracellular solute binding protein includes SBP_bac_1 (1) and SBP_bac_3 (5); ‘Porin-like’ refers to the HMMs for OmpA (2), OmpH (1), OmpW (1), Porin_O_P (1) and Porin_1 (1); ‘MCP_signal’ refers to methyl-accepting chemotaxis protein (5); and ‘Others’ refers to all the other sequences that matched to different protein families in the Pfam database (135 entries).

https://doi.org/10.1371/journal.pone.0003252.g004

The proteolytic potential of the P. tunicata secretome was high in comparison to P. haloplanktis and P. atlantica, with the identification of at least 36 peptidases (Figure 5). Two peptidases encoded in the P. tunicata genome match to collagenases in Vibrio sp. and Clostridium sp., and are not found in P. atlantica or P. haloplanktis. Collagen types I and II are the most abundant in cartilages of vertebrates, while marine invertebrates (including chordates) have a type of collagen similar to collagen type II [73]. Another secreted, proteolytic enzyme is a putative cyanophycinase, which degrades the amino-acid polymer cyanophycin, an important intracellular nitrogen-storage polymer predominantly found in cyanobacteria [74].

thumbnail
Figure 5. Peptidases in predicted secretome of P. tunicata.

Comparison of the peptidase profiles in the secretome of the three sequenced Pseudoalteromonas species. The total number of proteins that belong to the peptidase group is 36 in P. tunicata, 12 in P. atlantica and 15 in P. haloplanktis. The colour bars represent the percentage of each subgroup of peptidases. Details of each peptidase family type can be found at http://merops.sanger.ac.uk.

https://doi.org/10.1371/journal.pone.0003252.g005

With respect to the saccharolytic potential of the P. tunicata secretome, extracellular digestion of the widespread carbon-storage polymer glycogen and starch was represented by sets of alpha-1,4 and 1,6-glucosidase and maltodextrinase genes, for which representative sets were also found in the other sequenced Alteromonadales genomes, but in lower abundance and degree of clustering with related gene functions, e.g. transport, intracellular metabolism, and regulation.

The P. tunicata genome possesses furthermore an array of genes for the digestion of chitin (poly beta-1,4 acetylglucosamine), an important structural element of fungal cell wall and arthropod exoskeletons frequently found in the marine environment. Growth experiments confirmed the ability to utilise chitin and chitobiose (data not shown). For binding of chitin and digestion into oligosaccharides and chitobiose, a chiABC gene cluster similar to the one of Pseudoalteromonas sp. strain S91 [75] was found, in addition to five other candidate genes for chitinase and chitin-binding function. Chitinolytic activity is common in surface-associated bacteria, such as Vibrio species [76], however no chitinases were found in the genomes of Alteromonas meacleodii and P. haloplanktis, P. atlantica and Alteromonadales sp. TW7. One predicted P. tunicata chitinase contained the unusual catalytic motif for glycoside-hydrolase family 19 chitinases, which are primarily found in plants for defence against fungal and insect pathogens [77]. This chitinase also is more similar to eukaryotic sequences (46% identical to Zea diploperennis) than to other prokaryotic sequences (highest identity of 39% to S. coelicolor A3).

For extracellular digestion of chitooligosaccharides and of chitobiose into acetylglucosamine, at least six predicted beta-hexosaminidase (EC 3.2.1.52; chitobiase) genes were identified, which were not present in any other sequenced Alteromonadales genome. Additionally, at least three extracellular polysaccharide deacetylases (COG0726) allow P. tunicata to release acetyl units from polysaccharides such as chitin, and two of these deacetylases had no homologs in any other Alteromonadales genome. Furthermore, chitin degradation might be controlled by homologs of the CdsS/CdsR two-component regulator system, which in Pseudoalteromonas piscicida strain O-7 was characterized to modulate the expression of chitin degradation [78], [79].

These results indicate a unique niche adaptation of P. tunicata for chitin degradation, and imply that chitin degradation is possibly a highly regulated and surface-associated trait. To further investigate this, we grew P. tunicata in liquid cultures with insoluble chitin and observed growth predominantly associated with the chitin particles. P. tunicata also demonstrated a reduction in the expression of the anti-protozoal compound violacein when chitin was available as sole carbon source (data not shown) hinting towards a complex regulatory network involving biopolymer degradation and inhibitor expression. In fact, P. tunicata's regulated capacity of binding and degrading chitin might be regarded as a virulence trait, as chitinolytic bacteria have been associated with pathogenicity towards marine crustaceans [80], [81]. In addition, chitin degradation might accelerate the damage caused by the antifungal activity of P. tunicata, or a homolog to cyanophycinase and glycogen/ starch degradation might facilitate nutrient scavenging from bacterial cells lysed by AlpP. Together these findings imply, that P. tunicata does not only use its antimicrobial traits to out-compete other organisms for surface space, but might also effectively utilize the polymeric biomass of the carcass of competitor organisms for its own growth.

Cell wall components of plant cells, in particular the beta-linked polysaccharides cellulose and xylan, are also potential substrates for an organism that preferentially lives on plant surfaces, including marine algae. Based on physiological and genetic analysis P. tunicata is not able to degrade cellulose. In particular, the putative extracellular endo-cellulases (EC 3.2.1.4; beta-1,4-endoglucan hydrolase) and endo-xylanases (EC 3.2.1.8; beta-1,4-endoxylanase) identified in P. haloplanktis TAC125 and P. atlantica T6c were absent in the P. tunicata genome. However, P. tunicata possesses an homolog to the Pseudomonas fluorescens subsp. cellulosa exo-cellohexanase (EC 3.2.1.74, beta-1,4-exoglucosidase), which catalyses the degradation of oligosaccharides up to the length of cellohexose, but not cellulose and xylan. Also absent were enzymes for the hydrolysis of agaropectin, agarose, inulin, levan and pectin. Oxygenase genes predicted for the degradation of poly-aromatic compounds, such as in plant-derived lignin or humic substances, were also underrepresented, or absent, in the P. tunicata genome. In contrast, P. tunicata has complete sets of genes for central metabolic pathways that confer interconversion of the monomers derived from extracellular polymer degradation and for supporting the anabolic pathways, including the intracellular conversion of chitin-monomer N-acetylglucosamine via fructose-6-phosphate.

An obvious lack for the extracellular degradation of plant or algal associated polysaccharides is consistent with our understanding that P. tunicata has no observable, negative effect on algal host surfaces (such as U. lactuca). Also noteworthy is that the other recognised and unaffected eukaryotic host for P. tunicata, the tunicate C. intestinalis, is the only known animal that performs cellulose biosynthesis and incorporates cellulose into a protective coat [82]. Clearly, in the environment these hosts tissue can be damaged e.g. by other bacteria through polymer-degrading enzymes, and in this situation P. tunicata is likely to benefit from the decay of its host through some of its oligo-saccharide or mono-saccharide utilising pathways.

P. tunicata is well equipped to convert the acquired carbon substrates into intracellular storage polymers, through intracellular starch synthesis, a trait which seems widespread in Alteromonadales and Vibrio genomes. Glycogen and starch production is conferred through a glycogen synthase gene as part of a predicted six-gene operon including glycogen-branching enzyme. This gene organization is conserved in Alteromonadales sp. TW7, and in Shewanella and Saccharophagus genomes (Alteromonadales), but not in the other Pseudoalteromonas genomes Glycogen and starch synthesis is likely to be expressed in P. tunicata during imbalanced supply of essential nutrients, which in the marine habitat is most likely caused by phosphorous-limitations (see below). Mechanisms of polyphosphate-storage are absent in the P. tunicata genome supporting the notion that stored carbon is crucial to make opportunistic use of short-term available phosphorous pools. This picture fits the general opportunistic life style of the genus Pseudoalteromonas and might explain the comparative ease with which they can be cultured [83].

Competition and acquisition of nutrients

Low phosphorous levels have been shown to be one of the main growth-limiting factors in the marine environment. Indeed in the open ocean phospholipids and nucleic acids appear to be the primary reservoirs of low- and high-molecular weight dissolved organic phosphorus (DOP). Additional phosphorous can be available in the form of surface-associated, particulate organic phosphorus (POP), bound for example to plant or biofilm surfaces [84], [85], [86]. The P. tunicata genome encodes high affinity phosphate transport systems (PstABC and PstS) and is well equipped to release phosphates from extracellular phosphoesters, as it encodes for at least five extracellular alkaline phosphatases as well as a number of extracellular nucleases and phospholipases. Interestingly, no gene for organophosphonate C-P lyases was identified (e.g. no Phn complex). This indicates that phospho(di)esters, rather than phosphonates (e.g. ciliatine), represent relevant sources of additional phosphorous in the habitat of P. tunicata.

Despite this array of enzymes for phosphate acquisition, phosphate starvation might be still of ecological relevance for P. tunicata and appear to be under complex regulation. During growth experiments we observed a link between phosphate starvation and pigment/ bioactive production in P. tunicata i.e. phosphate starvation during logarithmic growth of P. tunicata results in the early expression of pigments and bioactive compounds. Under the same conditions a non-pigmented mutant of the ToxR-like regulator WmpR demonstrated that pigment production could be induced upon phosphate, but not carbon or nitrogen starvation [87]. These results indicate the presence of a secondary regulator of the synthesis of bioactive compounds and pigments, which is activated by phosphate starvation. We identified in the P. tunicata genome homologs to the two-component regulatory system PhoR/PhoB, which has been shown in a number of bacteria to modulate gene expression in response to phosphate starvation [88]. The presence of the PhoR/PhoB proteins is likely responsible for the observed increase in pigment expression under phosphate starvation and recent reports have shown that antibiotic biosynthesis is negatively regulated by phosphate via the PhoR/PhoB system [89]. On marine surfaces, P. tunicata may be experiencing phosphate limitation, particularly in high-density consortia biofilms, and up-regulation of both bioactive compounds and phosphate acquisition could be an effective strategy to dominate competing organisms.

Iron is another limiting nutrient in the marine environment and the P. tunicata genome shows adaptation to this situation by a range of siderophore-dependent mobilisation and uptake systems. A large range of TonB-dependent siderophore receptors (TBDR) were predicted in the P. tunicata genome, such as homologs to the well-characterised TonB-dependent ferric vibriobactin/enterobactin siderophore receptors ViuA and VuuA of V. cholerae and Vibrio vulnificus, the TonB-dependent catecholate siderophore receptor Fiu of E. coli, and the TonB-dependent ferric enterochelin siderophore receptors like IrgA of V. cholerae and CirA of E. coli. Surprisingly, no genes for the synthesis of these types of siderophores were found in the genome. P. tunicata might only utilise these TBDR to scavenge siderophores released from other organisms. Alternatively, the TBDRs might be involved in carbohydrate scavenging as recently suggested for some phytopathogenic and aquatic bacteria [90]. However, P. tunicata appears to produce at least one siderophore itself as indicated by the presence of a biosynthetic gene cluster for an aerobactin-like siderophore. Aerobactin synthesis proceeds from lysine and citric acid via L-lysine 6-monooxygenase (EC 1.14.13.59), N6-hydroxylysine O-acetyltransferase (EC 2.3.1.102), and aerobactin synthase (C-N ligase, EC 6.3.2.27), and these functions were located in P. tunicata in a predicted four-gene operon, which is also found in Alteromonadales TW7, but not in other available Alteromonadales genome sequences. More specifically, a bifunctional enzyme in P. tunicata is predicted to account for both the N6-hydroxylysine O-acetyltransferase (N-terminal half) and aerobactin synthetase (C-terminal half) activities. A homolog of this bifunctional enzyme is also present in Alteromonadales sp. TW7 (ATW7_00745), Photorhabdus luminescens (CAE17002) and Chromohalobacter salexigens (YP_573109). The gene cluster also encodes a multidrug resistance efflux pump (COG0477), which might play a role in siderophore export.

Urea is ubiquitous in nature and many microorganisms utilise urea as nitrogen source. The P. tunicata genome encodes for a putative urea transporter permease of the Yut protein class, which has been characterised in Yersinia species, however does not possess a urease. Instead, urea is converted to ammonium and carbonate through a urea carboxylase and an allophanate hydrolase [91]. This is similar to recently described Roseobacter genomes that are also often found in association with host surfaces [92].

Conclusion

The P. tunicata genome reflects an adaptation to successful persistence and competition on marine surfaces. The potential for P. tunicata to benefit from the decay of host tissue without causing direct harm, together with the production of inhibitory compounds against other colonisers, can give P. tunicata a selective advantage within the highly competitive surface environment. In addition, the capacity of P. tunicata to bind and degrade chitin-based oligosaccharides may suggest an expansion of its host range beyond that of the currently recognised algal and tunicate hosts. Interaction with a variety of hosts might also be facilitated by the range of surface structures (e.g. pili, curli) available to P. tunicata.

In contrast to mutualistic host associations, the presence of genes homologous to virulence traits of characterised pathogens raised the interesting speculation that P. tunicata could act as an opportunistic pathogen. Microbial diseases of marine organisms are increasingly being identified and there is now strong evidence that many of these disease progressions are induced by environmental factors [93]. Characteristic traits of pathogens such as the production of toxins, pili, capsule polysaccharides and siderophores have been suggested to also improve bacterial fitness toward typical environmental stress conditions [94], [95]. Therefore the study of such “dual function” traits in model non-pathogenic host associated microbes such as P. tunicata will play an important role in our overall understanding of the emergence of new microbial diseases.

Supporting Information

Figure S1.

Phage particle of P. tunicata. Transmission electron micrograph of phage-like structures observed in the spent medium of Pseudoalteromonas tunicata. Bar = 200 nm

https://doi.org/10.1371/journal.pone.0003252.s001

(4.80 MB TIF)

Acknowledgments

We thank Granger Sutton and his team for the ongoing development and maintenance of the Celera Assembler. We thank Robert Friedman and acknowledge the J. Craig Venter Institute (JCVI) Joint Technology Center, under the leadership of Yu-Hui Rogers, for producing the genomic libraries and the sequence data.

Author Contributions

Conceived and designed the experiments: TT FFE SE. Performed the experiments: TT FFE DSD SE. Analyzed the data: TT FFE DS AMP CB AP SSB SE. Contributed reagents/materials/analysis tools: NFS JJ SF. Wrote the paper: TT FFE DS SK SE.

References

  1. 1. Braithwaite RA, McEvoy LA (2005) Marine biofouling on fish farms and its remediation. Adv Mar Biol 47: 215–252.RA BraithwaiteLA McEvoy2005Marine biofouling on fish farms and its remediation.Adv Mar Biol47215252
  2. 2. Berk SG, Mitchell R, Bobbie RJ, Nickels JS, White DC (2001) Microfouling on metal surfaces exposed to seawater. International Biodeteriation and Biodegradation 34: 387–399.SG BerkR. MitchellRJ BobbieJS NickelsDC White2001Microfouling on metal surfaces exposed to seawater.International Biodeteriation and Biodegradation34387399
  3. 3. Qian PY, Lau S, Dahms HU, Dobretsov S, Harder T (2007) Marine Biofilms as Mediators of Colonization by Marine Macroorganisms: Implications for Antifouling and Aquaculture. Mar Biotechnol 9: 399–410.PY QianS. LauHU DahmsS. DobretsovT. Harder2007Marine Biofilms as Mediators of Colonization by Marine Macroorganisms: Implications for Antifouling and Aquaculture.Mar Biotechnol9399410
  4. 4. Egan S, Thomas T, Kjelleberg S (2008) Unlocking the diversity and biotechnological potential of marine surface associated microbial communities. Curr Opinion Microbiol 11: 219–225.S. EganT. ThomasS. Kjelleberg2008Unlocking the diversity and biotechnological potential of marine surface associated microbial communities.Curr Opinion Microbiol11219225
  5. 5. Wang Y, Tang XX, Yang Z, Yu ZM (2006) Effect of alginic acid decomposing bacterium on the growth of Laminaria japonica (Phaeophyceae). J Environ Sci 18: 543–551.Y. WangXX TangZ. YangZM Yu2006Effect of alginic acid decomposing bacterium on the growth of Laminaria japonica (Phaeophyceae).J Environ Sci18543551
  6. 6. Webster NS (2007) Sponge disease: a global threat? Environ Microbiol 9: 1363–1375.NS Webster2007Sponge disease: a global threat?Environ Microbiol913631375
  7. 7. Bowman JP (2007) Bioactive compound synthetic capacity and ecological significance of marine bacterial genus Pseudoalteromonas. Mar Drugs 5: 220–241.JP Bowman2007Bioactive compound synthetic capacity and ecological significance of marine bacterial genus Pseudoalteromonas.Mar Drugs5220241
  8. 8. James S, Holmström C, Kjelleberg S (1996) Purification and characterization of a novel anti-bacterial protein from the marine bacterium D2. Appl Environ Microbiol 62: 2783–2788.S. JamesC. HolmströmS. Kjelleberg1996Purification and characterization of a novel anti-bacterial protein from the marine bacterium D2.Appl Environ Microbiol6227832788
  9. 9. Holmström C, Rittschof D, Kjelleberg S (1992) Inhibition of attachment of larval barnacles, Balanus amphitrite and Ciona intestinalis a surface colonizing marine bacterium. Appl Environ Microbiol 58: 2111–2115.C. HolmströmD. RittschofS. Kjelleberg1992Inhibition of attachment of larval barnacles, Balanus amphitrite and Ciona intestinalis a surface colonizing marine bacterium.Appl Environ Microbiol5821112115
  10. 10. Egan S, James S, Holmström C, Kjelleberg S (2001) Inhibition of algal spore germination by the marine bacterium Pseudoalteromonas tunicata. FEMS Microbiol Ecol 35: 67–73.S. EganS. JamesC. HolmströmS. Kjelleberg2001Inhibition of algal spore germination by the marine bacterium Pseudoalteromonas tunicata.FEMS Microbiol Ecol356773
  11. 11. Franks A, Haywood P, Holmström C, Egan S, Kjelleberg S, et al. (2005) Isolation and structure elucidation of a novel yellow pigment from the marine bacterium Pseudoalteromonas tunicata. Molecules 10: 1286–1291.A. FranksP. HaywoodC. HolmströmS. EganS. Kjelleberg2005Isolation and structure elucidation of a novel yellow pigment from the marine bacterium Pseudoalteromonas tunicata.Molecules1012861291
  12. 12. Franks A, Egan S, Holmström C, James S, Lappin-Scott H, et al. (2006) Inhibition of fungal colonization by Pseudoalteromonas tunicata provides a competitive advantage during surface colonization. Appl Environ Microbiol 72: 6079–6087.A. FranksS. EganC. HolmströmS. JamesH. Lappin-Scott2006Inhibition of fungal colonization by Pseudoalteromonas tunicata provides a competitive advantage during surface colonization.Appl Environ Microbiol7260796087
  13. 13. Matz C, Webb J, Schupp P, Phang S, Penesyan A, et al. (2008) Marine biofilm bacteria evade eukaryotic predation by targeted chemical defence. C. MatzJ. WebbP. SchuppS. PhangA. Penesyan2008Marine biofilm bacteria evade eukaryotic predation by targeted chemical defence.PLOS one Accepted for publication. PLOS one Accepted for publication.
  14. 14. Rao D, Webb JS, Holmström C, Case R, Low A, et al. (2007) Low densities of epiphytic bacteria from the marine alga Ulva australis inhibit settlement of fouling organisms. Appl Environ Microbiol 73: 7844–7852.D. RaoJS WebbC. HolmströmR. CaseA. Low2007Low densities of epiphytic bacteria from the marine alga Ulva australis inhibit settlement of fouling organisms.Appl Environ Microbiol7378447852
  15. 15. Rao D, Webb JS, Kjelleberg S (2005) Competitive Interactions in mixed-species biofilms containing the marine bacterium Pseudoalteromonas tunicata. Appl Environ Microbiol 71: 1729–1736.D. RaoJS WebbS. Kjelleberg2005Competitive Interactions in mixed-species biofilms containing the marine bacterium Pseudoalteromonas tunicata.Appl Environ Microbiol7117291736
  16. 16. Goldberg SM, Johnson J, Busam D, Feldblyum T, Ferriera S, et al. (2006) A Sanger/pyrosequencing hybrid approach for the generation of high-quality draft assemblies of marine microbial genomes. Proc Natl Acad Sci USA 103: 11240–11245.SM GoldbergJ. JohnsonD. BusamT. FeldblyumS. Ferriera2006A Sanger/pyrosequencing hybrid approach for the generation of high-quality draft assemblies of marine microbial genomes.Proc Natl Acad Sci USA1031124011245
  17. 17. Delcher AL, Harmon D, Kasif S, White O, Salzberg SL (1999) Improved microbial gene identification with glimmer. Nucleic Acids Res 27: 4636–4641.AL DelcherD. HarmonS. KasifO. WhiteSL Salzberg1999Improved microbial gene identification with glimmer.Nucleic Acids Res2746364641
  18. 18. Bateman A, Birney E, Durbin R, Eddy SR, Howe KL, et al. (2000) The Pfam protein families database. Nucleic Acids Res 28: 263–266.A. BatemanE. BirneyR. DurbinSR EddyKL Howe2000The Pfam protein families database.Nucleic Acids Res28263266
  19. 19. Haft DH, Loftus BJ, Richardson DL, Yang F, Eisen JA, et al. (2001) TIGRFAMs: A protein family resource for the functional identification of proteins. Nucleic Acids Res 29: 41–43.DH HaftBJ LoftusDL RichardsonF. YangJA Eisen2001TIGRFAMs: A protein family resource for the functional identification of proteins.Nucleic Acids Res294143
  20. 20. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, et al. (2003) The COG database: an updated version includes eukaryotes. BMC Bioinformatics 11: 4–41.RL TatusovND FedorovaJD JacksonAR JacobsB. Kiryutin2003The COG database: an updated version includes eukaryotes.BMC Bioinformatics11441
  21. 21. Falquet L, Pagni M, Bucher P, Hulo N, Sigrist CJ, et al. (2002) The PROSITE database, its status in 2002. Nucleic Acids Res 30: 235–238.L. FalquetM. PagniP. BucherN. HuloCJ Sigrist2002The PROSITE database, its status in 2002.Nucleic Acids Res30235238
  22. 22. Haas BJ, Wortman JR, Ronning CM, Hannick LI, Smith RK Jr, et al. (2005) Complete reannotation of the Arabidopsis genome: methods, tools, protocols and the final release. BMC Biol 3: 7.BJ HaasJR WortmanCM RonningLI HannickRK Smith Jr2005Complete reannotation of the Arabidopsis genome: methods, tools, protocols and the final release.BMC Biol37
  23. 23. Markowitz VM, Kyrpides NC (2007) Comparative genome analysis in the integrated microbial genomes (IMG) system. Methods Mol Biol 395: 35–56.VM MarkowitzNC Kyrpides2007Comparative genome analysis in the integrated microbial genomes (IMG) system.Methods Mol Biol3953556
  24. 24. Vernikos GS, Parkhill J (2006) Interpolated variable order motifs for identification of horizontally acquired DNA: revisiting the Salmonella pathogenicity islands. Bioinformatics 2196–2203.GS VernikosJ. Parkhill2006Interpolated variable order motifs for identification of horizontally acquired DNA: revisiting the Salmonella pathogenicity islands.Bioinformatics21962203
  25. 25. Grissa I, Vergnaud G, P C (2007) CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res 35: w52–57.I. GrissaG. VergnaudC. P2007CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats.Nucleic Acids Res35w5257
  26. 26. Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340: 783–795.JD BendtsenH. NielsenG. von HeijneS. Brunak2004Improved prediction of signal peptides: SignalP 3.0.J Mol Biol340783795
  27. 27. Krogh A, Larsson B, von Heijne G, Sonnhammer ELL (2001) Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J Mol Biol 305: 567–580.A. KroghB. LarssonG. von HeijneELL Sonnhammer2001Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes.J Mol Biol305567580
  28. 28. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680.JD ThompsonDG HigginsTJ Gibson1994CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice.Nucleic Acids Res2246734680
  29. 29. Stelzer S, Egan S, Larsen MR, Bartlett DH, Kjelleberg S (2006) Unravelling the role of the ToxR-like transcriptional regulator WmpR in the marine antifouling bacterium Pseudoalteromonas tunicata. Microbiol 152: 1385–1394.S. StelzerS. EganMR LarsenDH BartlettS. Kjelleberg2006Unravelling the role of the ToxR-like transcriptional regulator WmpR in the marine antifouling bacterium Pseudoalteromonas tunicata.Microbiol15213851394
  30. 30. Egan S, James S, Holmström C, Kjelleberg S (2002) Correlation between pigmentation and antifouling compounds produced by Pseudoalteromonas tunicata. Environ Microbiol 4: 433–442.S. EganS. JamesC. HolmströmS. Kjelleberg2002Correlation between pigmentation and antifouling compounds produced by Pseudoalteromonas tunicata.Environ Microbiol4433442
  31. 31. Rusch DB, Halpern AL, Sutton G, Heidelberg KB, Williamson S, et al. (2007) The Sorcerer II global ocean sampling expedition: Northwest Atlantic through Eastern Tropical Pacific. PLoS Biology 5: e77.DB RuschAL HalpernG. SuttonKB HeidelbergS. Williamson2007The Sorcerer II global ocean sampling expedition: Northwest Atlantic through Eastern Tropical Pacific.PLoS Biology5e77
  32. 32. Goris J, Konstantinidis KT, Klappenbach JA, Coenye T, Vandamme P, et al. (2007) DNA-DNA hybridization values and their relationship to whole-genome sequence similarities. Int J Syst Evol Microbiol 57: 81–91.J. GorisKT KonstantinidisJA KlappenbachT. CoenyeP. Vandamme2007DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.Int J Syst Evol Microbiol578191
  33. 33. Venter JC, Remington K, Heidelberg JF, Halpern AL, Rusch D, et al. (2004) Environmental genome shotgun sequencing of the Sargasso Sea. Science 304: 66–74.JC VenterK. RemingtonJF HeidelbergAL HalpernD. Rusch2004Environmental genome shotgun sequencing of the Sargasso Sea.Science3046674
  34. 34. Canchaya C, Proux C, Fournous G, Bruttin A, Brussow H (2003) Prophage Genomics. Microbiol Mol Biol Rev 67: 238–276.C. CanchayaC. ProuxG. FournousA. BruttinH. Brussow2003Prophage Genomics.Microbiol Mol Biol Rev67238276
  35. 35. Higgins BP, Carpenter CD, Karls AC (2007) Chromosomal context directs high-frequency precise excision of IS492 in Pseudoalteromonas atlantica. Proc Natl Acad Sci USA 104: 1901–1906.BP HigginsCD CarpenterAC Karls2007Chromosomal context directs high-frequency precise excision of IS492 in Pseudoalteromonas atlantica.Proc Natl Acad Sci USA10419011906
  36. 36. Bartlett DH, Silverman M (1989) Nucleotide sequence of IS492, a novel insertion sequence causing variation in extracellular polysaccharide production in the marine bacterium Pseudomonas atlantica. J Bacteriol 171: 1763–1766.DH BartlettM. Silverman1989Nucleotide sequence of IS492, a novel insertion sequence causing variation in extracellular polysaccharide production in the marine bacterium Pseudomonas atlantica.J Bacteriol17117631766
  37. 37. Vera J, Alvarez R, Murano E, Slebe JC, Leon O (1998) Identification of a marine agarolytic Pseudoalteromonas isolate and characterization of its extracellular agarase. Appl Environ Microbiol 64: 4378–4383.J. VeraR. AlvarezE. MuranoJC SlebeO. Leon1998Identification of a marine agarolytic Pseudoalteromonas isolate and characterization of its extracellular agarase.Appl Environ Microbiol6443784383
  38. 38. Mazel D, Dychinco B, Webb VA, Davies J (1998) A distinctive class of integron in the Vibrio cholerae genome. Science 280: 605–608.D. MazelB. DychincoVA WebbJ. Davies1998A distinctive class of integron in the Vibrio cholerae genome.Science280605608
  39. 39. Williamson NR, Fineran PC, Leeper FJ, Salmond GP (2006) The biosynthesis and regulation of bacterial prodiginines. Nat Rev Microbiol 4: 887–899.NR WilliamsonPC FineranFJ LeeperGP Salmond2006The biosynthesis and regulation of bacterial prodiginines.Nat Rev Microbiol4887899
  40. 40. Haft DH, Selengut J, Mongodin EF, Nelson KE (2005) A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes. PLoS Comput Biol 1: e60.DH HaftJ. SelengutEF MongodinKE Nelson2005A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes.PLoS Comput Biol1e60
  41. 41. Makarova KS, Grishin NV, Shabalina SA, Wolf YI, Koonin EV (2006) A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol Direct 16: 1–7.KS MakarovaNV GrishinSA ShabalinaYI WolfEV Koonin2006A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action.Biol Direct1617
  42. 42. Barnhart MM, Chapman MR (2006) Curli Biogenesis and Function. Ann Rev Microbiol 60: 131–147.MM BarnhartMR Chapman2006Curli Biogenesis and Function.Ann Rev Microbiol60131147
  43. 43. Barak J, Gorski L, Naraghi-Arani P, Charkowski A (2005) Salmonella enterica virulence genes are required for bacterial attachment to plant tissue. Appl Environ Microbiol 71: 5685–5691.J. BarakL. GorskiP. Naraghi-AraniA. Charkowski2005Salmonella enterica virulence genes are required for bacterial attachment to plant tissue.Appl Environ Microbiol7156855691
  44. 44. Jeter C, Matthysse A (2005) Characterization of the binding of diarrheagenic strains of E. coli to plant surfaces and the role of curli in the interaction of the bacteria with alfalfa sprouts. Mol Plant Microbe Interact 18: 1235–1242.C. JeterA. Matthysse2005Characterization of the binding of diarrheagenic strains of E. coli to plant surfaces and the role of curli in the interaction of the bacteria with alfalfa sprouts.Mol Plant Microbe Interact1812351242
  45. 45. Dalisay DS, Webb JS, Scheffel A, Svenson C, James S, et al. (2006) A mannose-sensitive haemagglutinin (MSHA)-like pilus promotes attachment of Pseudoalteromonas tunicata cells to the surface of the green alga Ulva australis. Microbiol 152: 2875–2883.DS DalisayJS WebbA. ScheffelC. SvensonS. James2006A mannose-sensitive haemagglutinin (MSHA)-like pilus promotes attachment of Pseudoalteromonas tunicata cells to the surface of the green alga Ulva australis.Microbiol15228752883
  46. 46. Russell MA, Darzins A (1994) The pilE gene product of Pseudomonas aeruginosa, required for pilus biogenesis, shares amino acid sequence identity with the N-termini of type 4 prepilin proteins. Mol Microbiol 13: 973.MA RussellA. Darzins1994The pilE gene product of Pseudomonas aeruginosa, required for pilus biogenesis, shares amino acid sequence identity with the N-termini of type 4 prepilin proteins.Mol Microbiol13973
  47. 47. Spangenberg C, Fislage R, Sierralta W, Tummler B, Romling U (1995) Comparison of type IV-pilin genes of Pseudomonas aeruginosa of various habitats has uncovered a novel unusual sequence. FEMS Microbiol Lett 125: 265–273.C. SpangenbergR. FislageW. SierraltaB. TummlerU. Romling1995Comparison of type IV-pilin genes of Pseudomonas aeruginosa of various habitats has uncovered a novel unusual sequence.FEMS Microbiol Lett125265273
  48. 48. Baynham PJ, Ramsey DM, Gvozdyev BV, Cordonnier EM, Wozniak DJ (2006) The Pseudomonas aeruginosa ribbon-helix-helix DNA-binding protein AlgZ (AmrZ) controls twitching motility and biogenesis of type IV pili. J Bacteriol 188: 132–140.PJ BaynhamDM RamseyBV GvozdyevEM CordonnierDJ Wozniak2006The Pseudomonas aeruginosa ribbon-helix-helix DNA-binding protein AlgZ (AmrZ) controls twitching motility and biogenesis of type IV pili.J Bacteriol188132140
  49. 49. Ling JM, Moore RA, Surette MG, Woods DE (2006) The mviN homolog in Burkholderia pseudomallei is essential for viability and virulence. Can J Microbiol 52: 831–842.JM LingRA MooreMG SuretteDE Woods2006The mviN homolog in Burkholderia pseudomallei is essential for viability and virulence.Can J Microbiol52831842
  50. 50. Carsiotis M, Stocker BAD, Weinstein DL, O'Brien AD (1989) A Salmonella typhimurium virulence gene linked to flg. Infect Immun 57: 3276–3280.M. CarsiotisBAD StockerDL WeinsteinAD O'Brien1989A Salmonella typhimurium virulence gene linked to flg.Infect Immun5732763280
  51. 51. Morelle S, Carbonnelle E, Nassif X (2003) The REP2 Repeats of the Genome of Neisseria meningitidis are associated with genes coordinately regulated during bacterial cell interaction. J Bacteriol 185: 2618–2627.S. MorelleE. CarbonnelleX. Nassif2003The REP2 Repeats of the Genome of Neisseria meningitidis are associated with genes coordinately regulated during bacterial cell interaction.J Bacteriol18526182627
  52. 52. Hoke D, Egan S, Cullen PA, Adler B (2008) LipL32 is an extracellular matrix-interacting protein of Leptospira and Pseudoalteromonas tunicata. Infection and Immunity 76: 2063–2069.D. HokeS. EganPA CullenB. Adler2008LipL32 is an extracellular matrix-interacting protein of Leptospira and Pseudoalteromonas tunicata.Infection and Immunity7620632069
  53. 53. Huxley-Jones J, Roberston DL, Boot-Handford RP (1998) On the origins of the extracellular matrix in vertebrates. Matrix Biol 26: 2–11.J. Huxley-JonesDL RoberstonRP Boot-Handford1998On the origins of the extracellular matrix in vertebrates.Matrix Biol26211
  54. 54. Franco AV, Liu D, Reeves PR (1998) The wzz (cld) protein in Escherichia coli: amino acid sequence variation determines O-antigen chain length specificity. J Bacteriol 180: 2670–2675.AV FrancoD. LiuPR Reeves1998The wzz (cld) protein in Escherichia coli: amino acid sequence variation determines O-antigen chain length specificity.J Bacteriol18026702675
  55. 55. Burke C, Thomas T, Egan S, Kjelleberg S (2007) The use of functional genomics for the identification of a gene cluster encoding for the biosynthesis of an antifungal tambjamine in the marine bacterium Pseudoalteromonas tunicata. Environ Microbiol 9: 814–818.C. BurkeT. ThomasS. EganS. Kjelleberg2007The use of functional genomics for the identification of a gene cluster encoding for the biosynthesis of an antifungal tambjamine in the marine bacterium Pseudoalteromonas tunicata.Environ Microbiol9814818
  56. 56. Balibar CJ, Walsh CT (2006) In vitro biosynthesis of violacein from L-Tryptophan by the enzymes VioA-E from Chromobacterium violaceum. Biochem 45: 15444–15457.CJ BalibarCT Walsh2006In vitro biosynthesis of violacein from L-Tryptophan by the enzymes VioA-E from Chromobacterium violaceum.Biochem451544415457
  57. 57. Putman M, van Veen HW, Konings WN (2000) Molecular properties of bacterial multidrug transporters. Microbiol Mol Biol Rev 64: 672–693.M. PutmanHW van VeenWN Konings2000Molecular properties of bacterial multidrug transporters.Microbiol Mol Biol Rev64672693
  58. 58. Christensen SK, Mikkelsen M, Pedersen K, Gerdes K (2001) RelE, a global inhibitor of translation, is activated during nutritional stress. Proc Nat Acad Sci USA 98: 14328–14333.SK ChristensenM. MikkelsenK. PedersenK. Gerdes2001RelE, a global inhibitor of translation, is activated during nutritional stress.Proc Nat Acad Sci USA981432814333
  59. 59. Finking R, Marahiel MA (2004) Biosynthesis of nonribosomal peptides. Ann Rev Microbiol 58: 453–488.R. FinkingMA Marahiel2004Biosynthesis of nonribosomal peptides.Ann Rev Microbiol58453488
  60. 60. Medigue C, Krin E, Pascal G, Barbe V, Bernsel A, et al. (2005) Coping with cold: The genome of the versatile marine Antarctica bacterium Pseudoalteromonas haloplanktis TAC125. Genome Res 15: 1325–1335.C. MedigueE. KrinG. PascalV. BarbeA. Bernsel2005Coping with cold: The genome of the versatile marine Antarctica bacterium Pseudoalteromonas haloplanktis TAC125.Genome Res1513251335
  61. 61. Potin P, Bouarab K, Sala¸n J-P, Pohnert G, Kloareg B (2002) Biotic interactions of marine algae. Curr Opin Plant Biol 5: 308–317.P. PotinK. BouarabJ-P Sala¸nG. PohnertB. Kloareg2002Biotic interactions of marine algae.Curr Opin Plant Biol5308317
  62. 62. Mai-Prochnow A, Lucas-Elio P, Egan S, Thomas T, Webb JS, et al. (2008) Hydrogen peroxide linked to lysine oxidase activity facilitates biofilm differentiation and dispersal in several Gram negative bacteria. J Bacteriol JB.00549–00508.A. Mai-ProchnowP. Lucas-ElioS. EganT. ThomasJS Webb2008Hydrogen peroxide linked to lysine oxidase activity facilitates biofilm differentiation and dispersal in several Gram negative bacteria.J BacteriolJB.0054900508
  63. 63. Fong ST, Camakaris J, Lee BT (1995) Molecular genetics of a chromosomal locus involved in copper tolerance in Escherichia coli K-12. Mol Microbiol 15: 1127–1137.ST FongJ. CamakarisBT Lee1995Molecular genetics of a chromosomal locus involved in copper tolerance in Escherichia coli K-12.Mol Microbiol1511271137
  64. 64. Silver S (1996) Bacterial resistances to toxic metal ions-a review. Gene 179: 9–19.S. Silver1996Bacterial resistances to toxic metal ions-a review.Gene179919
  65. 65. Ramaiah N, De J (2003) Unusual rise in mercury-resistant bacteria in coastal environs. Microb Ecol 45: 444–454.N. RamaiahJ. De2003Unusual rise in mercury-resistant bacteria in coastal environs.Microb Ecol45444454
  66. 66. Ivanova EP, Kurilenko VV, Kurilenko AV, Gorshkova NM, Shubin FN, et al. (2002) Tolerance to cadmium of free-living and associated with marine animals and eelgrass marine gamma-proteobacteria. Curr Microbiol 44: 357–362.EP IvanovaVV KurilenkoAV KurilenkoNM GorshkovaFN Shubin2002Tolerance to cadmium of free-living and associated with marine animals and eelgrass marine gamma-proteobacteria.Curr Microbiol44357362
  67. 67. Chiu HH, Shieh WY, Lin SY, Tseng CM, Chiang PW, et al. (2007) Alteromonas tagae sp. nov. and Alteromonas simiduii sp. nov., mercury-resistant bacteria isolated from a Taiwanese estuary. Int J Syst Evol Microbiol 57: 1209–1016.HH ChiuWY ShiehSY LinCM TsengPW Chiang2007Alteromonas tagae sp. nov. and Alteromonas simiduii sp. nov., mercury-resistant bacteria isolated from a Taiwanese estuary.Int J Syst Evol Microbiol5712091016
  68. 68. Smith DC, Simon M, Alldredge AL, Azam F (1992) Intense hydrolytic enzyme-activity on marine aggregates and implications for rapid particle dissolution. Nature 359: 139–142.DC SmithM. SimonAL AlldredgeF. Azam1992Intense hydrolytic enzyme-activity on marine aggregates and implications for rapid particle dissolution.Nature359139142
  69. 69. Bauer M, Kube M, Teeling H, Richter M, Lombardot T, et al. (2006) Whole genome analysis of the marine Bacteroidetes ‘Gramella forsetii’ reveals adaptations to degradation of polymeric organic matter. Environ Microbiol 8: 2201–2213.M. BauerM. KubeH. TeelingM. RichterT. Lombardot2006Whole genome analysis of the marine Bacteroidetes ‘Gramella forsetii’ reveals adaptations to degradation of polymeric organic matter.Environ Microbiol822012213
  70. 70. DeLong EF, Franks DG, Alldredge AL (1993) Phylogenetic diversity of aggregate-attached vs free-living marine bacterial assemblages. Limnol Oceanogr 38: 924–934.EF DeLongDG FranksAL Alldredge1993Phylogenetic diversity of aggregate-attached vs free-living marine bacterial assemblages.Limnol Oceanogr38924934
  71. 71. Tjalsma HA, Bolhuis A, Jongbloed DH, Bron S, Dijl JMV (2000) Signal peptide-dependent protein transport in Bacillus subtilis: a genome-based survey of the secretome. Microbiol Mol Biol Rev 64: 515–547.HA TjalsmaA. BolhuisDH JongbloedS. BronJMV Dijl2000Signal peptide-dependent protein transport in Bacillus subtilis: a genome-based survey of the secretome.Microbiol Mol Biol Rev64515547
  72. 72. Preston GM, Studholme DJ, Caldelari I (2005) Profiling the secretomes of plant pathogenic Proteobacteria. FEMS Microbiol Rev 29: 331–360.GM PrestonDJ StudholmeI. Caldelari2005Profiling the secretomes of plant pathogenic Proteobacteria.FEMS Microbiol Rev29331360
  73. 73. Rychel AL, Smith SE, Shimamoto HT, Swalla BJ (2005) Evolution and development of the chordates: collagen and Phyngeal cartilage. Mol Biol Evol 23: 541–549.AL RychelSE SmithHT ShimamotoBJ Swalla2005Evolution and development of the chordates: collagen and Phyngeal cartilage.Mol Biol Evol23541549
  74. 74. Oppermann-Sanio FB, Steinbüchel A (2002) Occurrence, functions and biosynthesis of polyamides in microorganisms and biotechnological production. Naturwissenschaften 89: 11–22.FB Oppermann-SanioA. Steinbüchel2002Occurrence, functions and biosynthesis of polyamides in microorganisms and biotechnological production.Naturwissenschaften891122
  75. 75. Techkarnjanaruk S, Goodman A (1999) Multiple genes involved in chitin degradation from the marine bacterium Pseudoalteromonas sp. strain S91. Microbiology 145: 925–934.S. TechkarnjanarukA. Goodman1999Multiple genes involved in chitin degradation from the marine bacterium Pseudoalteromonas sp. strain S91.Microbiology145925934
  76. 76. Hunt DE, Gevers D, Vahora NM, Polz MF (2008) Conservation of the chitin utilization pathway in the Vibrionaceae. . Appl Environ Microbiol 74: 44–51.DE HuntD. GeversNM VahoraMF Polz2008Conservation of the chitin utilization pathway in the Vibrionaceae. .Appl Environ Microbiol744451
  77. 77. Robertus JD, Monzingo AF (1999) The structure and action of chitinases. Experientia 87: 125–135.JD RobertusAF Monzingo1999The structure and action of chitinases.Experientia87125135
  78. 78. Miyamoto K, Okunishi M, Nukui E, Tsuchiya T, Kobayashi T, et al. (2007) The regulator CdsS/CdsR two-component system modulates expression of genes involved in chitin degradation of Pseudoalteromonas piscicida strain O-7. Arch Microbiol 188: 619–628.K. MiyamotoM. OkunishiE. NukuiT. TsuchiyaT. Kobayashi2007The regulator CdsS/CdsR two-component system modulates expression of genes involved in chitin degradation of Pseudoalteromonas piscicida strain O-7.Arch Microbiol188619628
  79. 79. Tsujibo H, Kondo N, Tanaka K, Miyamoto K, Baba N, et al. (1999) Molecular analysis of the gene encoding a novel transglycosylative enzyme from Alteromonas sp. Strain O-7 and its physiological role in the chitinolytic system. J Bacteriol 181: 5461–5466.H. TsujiboN. KondoK. TanakaK. MiyamotoN. Baba1999Molecular analysis of the gene encoding a novel transglycosylative enzyme from Alteromonas sp. Strain O-7 and its physiological role in the chitinolytic system.J Bacteriol18154615466
  80. 80. LeCleir GR, Buchan A, Hollibaugh JT (2004) Chitinase gene sequences retrieved from diverse aquatic habitats reveal environment-specific distributions. Appl Environ Microbiol 70: 6977–6983.GR LeCleirA. BuchanJT Hollibaugh2004Chitinase gene sequences retrieved from diverse aquatic habitats reveal environment-specific distributions.Appl Environ Microbiol7069776983
  81. 81. Vogan CL, Costa-Ramos C, Rowley AF (2002) Shell disease syndrome in the edible crab, Cancer pagurus-isolation, characterization and pathogenicity of chitinolytic bacteria. Microbiol 148: 743–754.CL VoganC. Costa-RamosAF Rowley2002Shell disease syndrome in the edible crab, Cancer pagurus-isolation, characterization and pathogenicity of chitinolytic bacteria.Microbiol148743754
  82. 82. Matthysse AG, Deschet K, Williams M, Marry M, White AR, et al. (2004) A functional cellulose synthase from ascidian epidermis. Proc Natl Acad Sci USA 101: 986–989.AG MatthysseK. DeschetM. WilliamsM. MarryAR White2004A functional cellulose synthase from ascidian epidermis.Proc Natl Acad Sci USA101986989
  83. 83. Eilers H, Pernthaler J, Glöckner FO, Amann R (2000) Culturability and in situ abundance of pelagic bacteria from the North Sea. Appl Environ Microbiol 66: 3044–3045.H. EilersJ. PernthalerFO GlöcknerR. Amann2000Culturability and in situ abundance of pelagic bacteria from the North Sea.Appl Environ Microbiol6630443045
  84. 84. Kolowith LC, Ingall ED, Benner R (2001) Composition and cycling of marine organic phosphorus. Limnol Oceanogr 46: 309–320.LC KolowithED IngallR. Benner2001Composition and cycling of marine organic phosphorus.Limnol Oceanogr46309320
  85. 85. Suzumura M, Ishikawa K, Ogawa H (1998) Characterization of dissolved organic phosphorus in coastal seawater using ultrafiltration and phosphohydrolytic enzymes. Limnol Oceanogr 43: 1553–1564.M. SuzumuraK. IshikawaH. Ogawa1998Characterization of dissolved organic phosphorus in coastal seawater using ultrafiltration and phosphohydrolytic enzymes.Limnol Oceanogr4315531564
  86. 86. Benitez-Nelson CR (2000) The biogeochemical cycling of phosphorus in marine systems. Earth-Science Reviews 51: 109–135.CR Benitez-Nelson2000The biogeochemical cycling of phosphorus in marine systems.Earth-Science Reviews51109135
  87. 87. Stelzer S (2006) WmpR regulation of antifoulng compounds and iron uptake in the marine bacterium Pseudoalteromonas tunicata. S. Stelzer2006WmpR regulation of antifoulng compounds and iron uptake in the marine bacterium Pseudoalteromonas tunicata.PhD thesis, University of New South Wales, Australia. PhD thesis, University of New South Wales, Australia.
  88. 88. Stock JB, Ninfa AJ, Stock AM (1989) Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol Rev 53: 450–490.JB StockAJ NinfaAM Stock1989Protein phosphorylation and regulation of adaptive responses in bacteria.Microbiol Rev53450490
  89. 89. Sola-Landa A, Moura RS, Martin JF (2003) The two-component PhoR-PhoP system controls both primary metabolism and secondary metabolite biosynthesis in Streptomyces lividans. Proc Nat Acad Sci USA 100: 6133–6138.A. Sola-LandaRS MouraJF Martin2003The two-component PhoR-PhoP system controls both primary metabolism and secondary metabolite biosynthesis in Streptomyces lividans.Proc Nat Acad Sci USA10061336138
  90. 90. Blanvillain S, Meyer D, Boulanger A, Lautier M, Guynet C, et al. (2007) Plant carbohydrate scavenging through TonB-dependent receptors: a feature shared by phytopathogenic and aquatic bacteria. PLoS ONE 2: e224.S. BlanvillainD. MeyerA. BoulangerM. LautierC. Guynet2007Plant carbohydrate scavenging through TonB-dependent receptors: a feature shared by phytopathogenic and aquatic bacteria.PLoS ONE2e224
  91. 91. Kanamori T, Kanou N, Atomi H, Imanaka T (2004) Enzymatic characterization of a prokaryotic urea carboxylase. J Bacteriol 186: 2532–2539.T. KanamoriN. KanouH. AtomiT. Imanaka2004Enzymatic characterization of a prokaryotic urea carboxylase.J Bacteriol18625322539
  92. 92. Moran MA, Belas R, Schell MA, González JM, Sun F, et al. (2007) Ecological genomics of marine Roseobacters. Appl Environ Microbiol 73: 4559–4569.MA MoranR. BelasMA SchellJM GonzálezF. Sun2007Ecological genomics of marine Roseobacters.Appl Environ Microbiol7345594569
  93. 93. Harvell CD, Mitchell CE, Ward JR, Altizer S, Dobson AP, et al. (2002) Climate warming and disease risks for terrestrial and marine biota. Science 296: 2158–2162.CD HarvellCE MitchellJR WardS. AltizerAP Dobson2002Climate warming and disease risks for terrestrial and marine biota.Science29621582162
  94. 94. Casadevall A, Pirofski L-A (2007) Accidental virulence, cryptic pathogenesis, martians, lost hosts, and the pathogenicity of environmental microbes. Eukaryot Cell 6: 2169–2174.A. CasadevallL-A Pirofski2007Accidental virulence, cryptic pathogenesis, martians, lost hosts, and the pathogenicity of environmental microbes.Eukaryot Cell621692174
  95. 95. Kirn TJ, Jude BA, Taylor RK (2005) A colonization factor links Vibrio cholerae environmental survival and human infection. Nature 438: 863–866.TJ KirnBA JudeRK Taylor2005A colonization factor links Vibrio cholerae environmental survival and human infection.Nature438863866
  96. 96. Ludwig W, Strunk O, Westram R, Richter L, Meier H, et al. (2004) ARB: a software environment for sequence data. Nucleic Acids Res 32(4): 1363–71.W. LudwigO. StrunkR. WestramL. RichterH. Meier2004ARB: a software environment for sequence data.Nucleic Acids Res32(4)136371