Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Insight into Microevolution of Yersinia pestis by Clustered Regularly Interspaced Short Palindromic Repeats

Insight into Microevolution of Yersinia pestis by Clustered Regularly Interspaced Short Palindromic Repeats

  • Yujun Cui, 
  • Yanjun Li, 
  • Olivier Gorgé, 
  • Mikhail E. Platonov, 
  • Yanfeng Yan, 
  • Zhaobiao Guo, 
  • Christine Pourcel, 
  • Svetlana V. Dentovskaya, 
  • Sergey V. Balakhonov, 
  • Xiaoyi Wang
PLOS
x

Abstract

Background

Yersinia pestis, the pathogen of plague, has greatly influenced human history on a global scale. Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR), an element participating in immunity against phages' invasion, is composed of short repeated sequences separated by unique spacers and provides the basis of the spoligotyping technology. In the present research, three CRISPR loci were analyzed in 125 strains of Y. pestis from 26 natural plague foci of China, the former Soviet Union and Mongolia were analyzed, for validating CRISPR-based genotyping method and better understanding adaptive microevolution of Y. pestis.

Methodology/Principal Findings

Using PCR amplification, sequencing and online data processing, a high degree of genetic diversity was revealed in all three CRISPR elements. The distribution of spacers and their arrays in Y. pestis strains is strongly region and focus-specific, allowing the construction of a hypothetic evolutionary model of Y. pestis. This model suggests transmission route of microtus strains that encircled Takla Makan Desert and ZhunGer Basin. Starting from Tadjikistan, one branch passed through the Kunlun Mountains, and moved to the Qinghai-Tibet Plateau. Another branch went north via the Pamirs Plateau, the Tianshan Mountains, the Altai Mountains and the Inner Mongolian Plateau. Other Y. pestis lineages might be originated from certain areas along those routes.

Conclusions/significance

CRISPR can provide important information for genotyping and evolutionary research of bacteria, which will help to trace the source of outbreaks. The resulting data will make possible the development of very low cost and high-resolution assays for the systematic typing of any new isolate.

Introduction

Yersinia pestis, the causative agent of plague, is a Gram-negative bacterium that belongs to Enterobacteriaceae. Four biovars (bv.), including antiqua, orientalis, medievalis and microtus, are defined by biochemical characteristics and the first three are significantly pathogenic for humans. In the recorded history, three waves of human plague pandemics have led to the death of millions of people [1] and resulted in major social changes. The main reservoir for Y. pestis is rodents and vector insects (usually fleas). Until now, Y. pestis has been found in more than 200 species of wild rodents inhabiting in plague foci in all the continents except Australia and Antarctica [2], [3]. Because of its characteristics, Y. pestis is included in the selected list of the bioterrorism-related agents [4][6].

Although natural plague foci are widely dispersed in the world, most of this geographic spread is the result of the third pandemic starting in the mid-19th century from the Yunnan province of China. Accordingly, the diversity of the strains found in the recent foci, including North and South America, is very limited within or across the foci [7], [8]. In contrast, the distinct foci in regions of Central and East Asia, especially China, the former Soviet Union (FSU) and Mongolia, harbor diverse strains, which can be estimated from both biochemical data and host diversities. Human plague has been well controlled in China since the 1950s, but at least 12 types of natural plague foci still exist, covering 241 counties in 15 provinces. Beside the classical bv. typing, Chinese isolates of Y. pestis have been divided into 18 ecotypes, based upon several biochemical features, including glycerol, rhamnose, maltose, melibiose, and arabinose fermentation, nitrate reduction, amino acid utilization, mutation rate from Pgm+ to Pgm, and water soluble protein patterns on SDS-PAGE [9]. Based on results of extensive microarray and PCR analysis, 32 genomovars, including 14 major genomovars and 18 minor genomovars, were identified for Chinese strains according to different region (DFR) profiles [10], [11]. Similarly, different types of foci have been identified in the FSU (including the foci in Russia, Kazakhstan, Georgia, Armenia, Azerbaijan, Turkmenistan, Uzbekistan, Tadjikistan and Kirghizia ) and Mongolia, and Russian scientists have classified isolates from these foci into different subspecies by various biochemical and molecular biological methods [3]. The significant diversity revealed by both genotyping and phenotyping among Y. pestis isolates from above natural plague foci suggests that further insights into genetic diversity of plague bacteria isolated from these regions will help better understand molecular microevolution of Y. pestis.

Several molecular methods have been used for typing Y. pestis, with variable clustering and discriminating ability. Molecular methods like ribotyping and multilocus sequence typing (MLST), as well as restriction fragment length polymorphism (RFLP), pulsed-field gel electrophoresis (PFGE), and randomly amplified polymorphism DNA (RAPD) etc., have no or very low discrimination power [12][15]. Conversely, insertion sequence (IS) typing by Southern blotting reveals a huge diversity, but it does not provide an appropriate phylogenetic or clustering tool. Furthermore, patterns obtained in different laboratories are difficult to compare. Multiple Locus VNTR (Variable Number of Tandem Repeats) analysis (MLVA), which usually provides a good differentiation of isolates [16], has been developed essentially by two groups for typing Y. pestis [8], [17]. Similarly, Single nucleotide polymorphism (SNP) analysis will offer an overview of Y. pestis microevolution, shaping the different evolutionary branches from its ancestor Yersinia pseudotuberculosis [7], [13] as the genomic sequences from a growing number of representative strains for each subspecies and clade will be available.

Previous work [18] suggested that the investigation of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) could provide some clues to the evolution of Y. pestis, and predictions were made concerning the CRISPR organization of ancestral Y. pestis strains [19]. CRISPRs are a family of elements which typically consist of noncontiguous direct repeats (DR, 24 bp–47 bp) separated by stretches of similarly sized unique sequences [20], [21]. One or more CRISPR loci are found in 40% of the bacterial genomes sequenced so far and in most archaea [22]. CRISPR loci, Cas (CRISPR-associated) proteins, and leader sequences (the non-coding sequences flanking the CRISPR loci on one side and acting as a promoter) [21], were suggested to constitute a prokaryotic immune system against bacteriophage attack. This was demonstrated in Streptococcus thermophilus [23][25].

The unique sequences in CRISPR loci, “spacers”, show a general divergence within a given species. A fraction of spacers are observed to be homologous with preexisting sequences such as bacteriophage and conjugative plasmids [18], [26][28]. Diversity within a CRISPR locus was first used for typing Mycobacterium tuberculosis strains. The assay called spoligotyping (spacer oligonucleotide typing) screens 43 spacers by hybridization using a nylon membrane[29]. An international database, comprising more than 2, 000 patterns from almost 40, 000 isolates, is accessible through the internet [30]. More recently, a similar assay was applied for genotyping Corynebacterium diphteriae [31].

Previous investigations were done on Y. pestis strain collections representing only a limited genetic diversity of the species. In particular, strains associated with the third pandemic were largely overrepresented. In the present work, we explore the potential use of the CRISPR loci in genotyping and evolutionary research of Y. pestis. In order to define a representative strain collection, polymorphic tandem repeat analysis was applied to the typing of more than 400 new Y. pestis isolates collected from 12 natural foci of China, 12 natural foci of the FSU, and 2 natural foci of Mongolia, including strains from the three classical biovars and bv. microtus (Pestoides group or non-pestis subspecies). A representative collection of 125 strains (Table S1) could be defined within which the CRISPR loci were characterized by sequencing in order to identify spacers for microevolution analysis and future development of typing assays.

Three hundred and sixty-four CRISPR alleles were sequenced and 86 new spacers were identified. We found that various spacers/spacers arrays had obvious connection with geographic source, and an evolutionary model of Y. pestis was proposed. Additional insights into common characteristics of CRISPR elements were obtained by integrating CRISPR data from previous research [18], [19].

Results and Discussion

CRISPR loci in the seven sequenced Y. pestis genomes

Each of the seven sequenced Y. pestis genomes contains three CRISPR loci (YPa, YPb and YPc, which were referred to YP1, YP2 and YP3, respectively, in a previous report [18]). They are localized on different positions in the sequenced genomes due to DNA rearrangements (Figure 1). The DRs are conserved within these three loci with a sequence of 5′- TTTCTAAGCTGCCTGTGCGGCAGTGAAC-3′, and there is a truncated DRs in the 5′ end of each CRISPR locus with the sequences of 5′- TGCCTGTGCGGCAGTGAAC -3′, 5′- TAAGCTGCCTGTGCGGCAGTGAAC -3′ and 5′- GCTGCCTGTGCGGCAGTGAAC -3′ for YPa, YPb and YPc, respectively. The DR sequences (including the first truncated DR) are identical in all the strains analyzed, suggesting that the conserved repeat sequences are important for Y. pestis. Interestingly, in YPb and YPc of the Angola strain, there is only a truncated DR and a leader sequence. There are 6 cas genes in Y. pestis genomes (YPO2462∼2465, YPO2467 and YPO2468 in the CO92 genome, all of them belong to the Ypest subtype defined by Haft et. al. [32]), localized in the flanking region of YPa. According to the model proposed by Grissa et al. [22], YPb and YPc would represent secondary loci produced from an initial locus (YPa) containing and providing all the necessary machinery. The leader sequences are similar in YPa and YPb, but less conserved in YPc.

thumbnail
Figure 1. The relative position of CRISPR loci in the sequenced genomes of seven Y. pestis and one Y. pseudotuberculosis (IP32953).

https://doi.org/10.1371/journal.pone.0002652.g001

Spacers sequences in Y. pestis

Including the 45 spacers previously identified [18], a total of 131 spacers have been found in Y. pestis until now (Table S2). The average GC content of the spacers is 47.2%, a little bit lower than that of Y. pestis genomes (47.7%). Herein 83, 37 and 11 spacers were found for YPa, YPb and YPc, respectively, with a length ranging from 29–34 bp, mostly 32 bp (79%).

Seventy seven (59%) of the 131 spacers have homologous sequences to the proto-spacers [23], [24] in a prophage (YPO2096∼2135 in CO92 genome), whereas 22 spacers (17%) are homologous to other non-viral regions in the Y. pestis chromosome (Table S3). No significant similarity was found in the public sequence databases for the remaining 32 spacers. It has been demonstrated recently [33] that a prophage (YpfΦ, YPO2271∼YPO2281 in CO92 genome) was stabilized in the orientalis strains, and was present unstably in some isolates of the other three Y. pestis biovars as an episome [11]. The interaction between YpfΦ and Y. pestis could have left some trails in the CRISPR loci, however, none of the identified spacers in Y. pestis have an homologue in YpfΦ. Three genes in the prophage region, YPO2106, YPO2108 and YPO2116, contain 15, 15 and 10 proto-spacers respectively, whereas the other genes in this region have less than five (Figure S1). Those three genes seem to be hot spots for providing spacers, suggesting that they might play important roles during the fighting against phages. Interestingly, the proto-spacer for spacer b29 (subsequently called p-b29) is located in IS285 (21 copies in the CO92 genome), and p-a30 is in 23S rRNA (6 copies in the CO92 genome). The number of proto-spacers originating from the Y. pestis genome itself is remarkably higher than that from other species, including its very close neighbor Y. pseudotuberculosis, suggesting that the CRISPR loci in Y. pestis might play a role in terms of shaping the genome expression, in addition to acting as a defense mechanism against phage infections. As previously observed, proto-spacers were present in both strands of the corresponding genes in the genome (Table S2). This could indicate that the two strands of the spacers are eventually produced as small interfering RNAs in order to be able to repress the corresponding gene expression [34].

Thirteen sets of spacers have highly similar sequences (Table 1). Three sets (set 11, 12 and 13) had minor variations, presumably resulting from random point mutations in some CRISPR alleles rather than independent acquisition events. Interestingly in each case, these mutations were a single nucleotide insertion located at the very end of the spacers. This opens the possibility that the mutated spacer is still able to interfere properly with its target gene. It was previously shown that a phage can escape the CRISPR defense mechanism by as little as 1 bp change in its proto-spacer, but in all examples provided, the mismatch was located at least a few base-pairs inside the spacer [24]. Furthermore, these spacers could be strong evidences for a close link among strains containing them. For example, the a37, a37′ and a37″ spacers are observed adjacent to respectively a6, a5 and a4, respectively. Spacer a37″ is an unusually shorter (29 bp long) spacer, whereas a37′ with an extra GTT at one end has the usual 32 bp in size. The 31 bp spacer a37 lacks one of the final Ts (Table S2). These observations suggest that the above three spacers are the result of a single acquisition event, with a37′ most likely being the ancestor sequence and the two others secondary variants.

thumbnail
Table 1. The position of similar proto-spacers in the Y. pestis CO92 genome and their distribution in different plague foci.

https://doi.org/10.1371/journal.pone.0002652.t001

The other 10 sets in Table 1 derive from four genes in the Y. pestis genome (Table 1). No similar spacers were observed within the same CRISPR allele. The observation of 2 to 3 spacers originating from very closely related genetic fragments indicated that some loci were hot spots for spacers' acquisition. We collected 200 bp flanking region across the homologous sequences of spacers for further analysis, but no conserved sequences or RNA secondary structure could be identified. A more detailed analysis of proto-spacers will be needed to identify target sequences if they exist.

Seven spacers have one nucleotide difference with the corresponding proto-spacer (Table 2), with G (6/7) or T (1/7) at the 3′ terminus. The G might be added during the spacer acquisition process, rather than by replacement mutation after the spacers' insertion into the CRISPR locus, in which case we would expect to observe the two variant spacers in the population, as seen in sets 11, 12, and 13 (Table 1). In only one spacer (a13) among the seven, the G, which is the second nucleotide from the last one, was replaced by C.

Twelve proto-spacers lay between two adjacent genes in the Y. pestis genome (marked in grey shade, Table S2). This observation suggests that spacers were acquired from DNA rather than transcribed RNA, unless these intergenic regions were part of an operon. The DNA origin was also suggested by the observation in S. thermophilus of short consensus sequence in the vicinity of the proto-spacer, reminiscent of a DNA restriction mechanism [23], [24].

The diversity of spacers arrays in three CRISPR loci of Y. pestis

The three CRISPR loci were present in all the tested isolates, and 35 (60%), 16 (28%) and 7 (12%) alleles are observed in YPa, YPb and YPc, respectively (Table S4). For YPa, 17 spacers were observed in only one isolate (called unique spacers), and the number of spacers per locus ranged from 1 to 14 with an average of 12. For YPb, there are five unique spacers, and the allele size range is 2 to 12 with an average number of 8. For YPc, there was only one unique spacer (c3′, with a single nucleotide difference to c3) and a size range of 1 to 5 with an average number of 3. YPa is the most polymorphic CRISPR locus in Y. pestis, in agreement with previous results [18], followed by YPb, and YPc.

By combining spacers arrays of the three loci, 49 genotypes were observed from 131 strains studied in this report (Table S1). By comparing the number of all spacers, types of spacers arrays and proportion of unique spacers between Y. pestis and S. thermophilus [23], [24], a lower diversity of CRISPR loci was observed in the former.

Geographic distribution of spacers/spacers arrays and CRISPR clusters of Y. pestis

In agreement with previous observations, CRISPR loci in Y. pestis have conserved spacers in the first part of arrays: “a-1-2-3-4-5-6” in YPa, “b-1-2-3-4” in YPb and “c-1-2-3” in YPc, and these conserved spacers were named as SSSs (Species-Specific Spacers). Most variations in this part can be attributed to random spacer loss, which might be generated by homologous recombination between adjacent DR elements. In contrast, the spacers closer to the leader region are often associated with a specific plague focus or clade (Table S5). They are subsequently called Region-Specific Spacers (RSSs). These spacers are predicted to be acquired more recently, as initially suggested [18] and confirmed by a number of investigations [24], [28], [35]. The geographic distribution of the isolates analyzed in this study is shown on the map of China (Figure 2) and on a world map (Figure 3). Strains with the same spacers array are usually distributed over a specific region. Given the good correlation between spacers arrays and geographical distribution of isolates, all strains studied can be conveniently grouped into 12 clusters, designated by adding a prefix “C” before the name of a representative spacer (most of them are RSS) (Table 3). Using this classification, most natural plague foci have one main cluster except the east side of the Kunlun Mountains (focus K2) and the Pamirs Plateau (focus A) (Table S6).

thumbnail
Figure 2. Geographic position of isolates and natural foci on the map of China.

Square represents bv. orientalis, triangle bv. mediaevalis, circle bv. antiqua, and cross bv. microtus. If several strains isolated from the same county belonged to the same CRISPR cluster, it was only marked once. Color shadows draw the rough outline of different natural foci, the letters in shadows are focus' names (Table S1).

https://doi.org/10.1371/journal.pone.0002652.g002

thumbnail
Figure 3. Hypothetic transmission route of Y. pestis.

Black line shows the main transmission route of Y. pestis bv. microtus, red line bv. mediaevalis, pink line bv. orientalis, and green line Ca37. Black dot line shows the potential relationship between Ca37 and Ca37′. Various symbols represent different biovars (see legend of Figure 2 for detail, one more symbol, diamond, is used to represent subsp. caucasica in this figure). The spacers array information of isolates from South America and Africa comes from previous research [18]. Red circles represent isolates from Africa, with spacers array “a-1-2-3-4-10/11” in YPa (data from Pourcel et. al, 2005). All the known African isolates contain “a10” spacer. Therefore, a10 is possibly a characteristic spacer of isolates from Africa. Nevertheless, we do not consider these isolates as one cluster due to the limited data available from African strains.

https://doi.org/10.1371/journal.pone.0002652.g003

Within Y. pestis, bv. antiqua strains fall into four clusters (Table 3), Ca37, Ca7, Ca52 and Cb4. The cluster Ca37 possesses the highest number of spacers at YPa (12 spacers per allele on average) and YPb (8 spacers per allele on average) among all the studied strains. Notably, there are 10 proto-spacers in YPO2116 (a gene in a defective bacteriophage) (Figure S1). Their corresponding spacers (a38, a41, a42, a44, a50, a71, b23, b24, b27 and b45) are only observed in Ca37 strains that were mostly isolated from focus B. Based on the hypothetic gene expression regulating function of CRISPR elements, the repression of YPO2116 might have been of importance for Y. pestis adaptation to the environment of focus B.

Strains of Cb4 are distributed in both foci G and H, which are far away from each other, with huge variations in environmental and ecological systems. However, strains from these two foci could not be distinguished by biochemical or molecular methods until now [9], [10], [36]. Most strains of the Cb4 (10 of 11, 91%) have spacers array “a1∼3” in YPa, similarly to bv. mediaevalis strains. The b4 spacer in YPb was not present in bv. mediaevalis, hence it could be used to distinguish this antiqua cluster with the two clusters of mediaevalis strains (Table 3). b4′, the characteristic spacer of mediaevalis cluster Cb4′, has only one nucleotide difference with spacer b4 (Table 1), which might indicate a close relationship between Cb4 and Cb4′ strains.

All the strains in the Ca8 cluster belong to bv. orientalis, and two spacers, a8 in YPa and b5 in YPb, were observed in all of them. Half of Ca8 strains have a conserved YPa spacers array “a1∼8”, the other half have a unique spacer added after a8. YPb and YPc in this cluster were invariant, with spacers arrays “b1∼5” and “c1∼3”, respectively. The CRISPR loci of about 150 bv. orientalis strains isolated from other regions of the world have been reported previously [18], and some unique spacers were identified at the end of the spacer array in both YPa and YPb. Our observation is in agreement with the previous results that the spacers array of most bv. orientalis strains were conserved, except that 4 isolates lost the first 4 spacers (a1, a2, a3 and a4) and 1 isolate lost YPa spacer a5 (these 5 strains were isolated from India, South Africa and Vietnam, respectively).

The atypical strains in central Asia region and China could be assigned to bv. “microtus”

The atypical strains isolated from central Asia region have been named “vole's strains”, which was equivalent to “microtus strains” [2], [3]. Later they were designated as “pestoides” and more recently subdivided into several subspecies, including: altaica, hissarica, ulegeica, caucasica and talassica [3]. Bv. “microtus” was proposed to depict the isolates from foci L and M of China, which were avirulent to humans and could not ferment arabinose [37]. Because both the “non-pestis subspecies” in central Asia region and the microtus strains in China belong to the ancient branches of Y. pestis [7] and share common feature of low virulence (or avirulence) to large mammals [3], [37], [38], we suggest to broaden the term “microtus” to the meaning of the term “pestoides” group. According to above definition, the bv. “microtus” should include Cc1 (original bv. microtus strains), Cc2 (subsp. altaica), Cc3 (original bv. microtus strains and subsp. hissarica), Ca13 (subsp. caucasica), Ca37′ (subsp. ulegeica), Ca37″ (subsp. angola), and subsp. talassica (strains were not available for this project). The ability to ferment rhamnose can be used to distinguish the newly defined microtus strains from the other three classical bv. strains [3].

Foci L and M are two distinct Microtus-related natural plague foci in China, the phenotypic and biochemical features of the Y. pestis isolates from these foci are almost identical, and cannot be distinguished by conventional and genetic methods until now [10], [11]. Here we found that the difference in YPc could be employed as a good marker to distinguish the bv. microtus strains between these two foci. The CRISPR types of strains in foci L and M are Cc1 and Cc3, respectively. Cc3 has two more spacers than Cc1 in YPc. Counting the length of DR sequences, there is a 120 bp difference between the strains from these two loci. It is easy to identify them by PCR-gel electrophoresis method (Figure S2). In order to standardize the nomenclature of bv. microtus, we propose strains from focus L as bv. microtus / xilingolensis (N. L. masc. adj. xilingolensis, belonging to XiLin Gol Grassland, Inner Mongolia, China, where the strain was isolated) and those from focus M bv. microtus / qinghaiensis (N. L. masc. adj. qinghaiensis, pertaining to Qinghai, a province of northwest China, where the strain was isolated).

Subsp. caucasica strains were originated from Trans-Caucasian-highland foci of the FSU, and showed the same glycerol and nitrate metabolism as the Y. pestis bv. antiqua strains [3]. Spacer b9 in YPb of this subsp. is located between two SSSs, b1 and b2. The b9 spacer is also observed in strain C1962002 from the Xinghai County, Qinghai province, China. It seems that C1962002 belongs to the most ancient lineage of Y. pestis among all Chinese isolates by DFR analysis [11]. Considering that the subsp. caucasica strains are also believed to be ancestral [7], b9 is most probably an ancient (SSS) spacer that was lost in isolates of other clusters.

The hypothetic evolutionary scenario of Y. pestis

The addition of new spacers in a CRISPR locus is polarized towards the leader sequence [18], [35], [39] as initially proposed [18], with few exceptions (the acquisition of a new spacer in an interstitial position concomitantly with the loss of multiple spacers [24]). Because no RSSs or unique spacers were observed in SSSs part of spacers array in this research, we supposed that the latter situation did not occur in Y. pestis and assumed that the information preserved in spacers arrays would show the directionally evolutionary record of this species. Here we propose an hypothetic evolutionary model of Y. pestis based upon the spacers array of all three CRISPR loci (Figure 4) and according to the general rules of CRISPR evolution [18], [19].

thumbnail
Figure 4. Evolutionary model of Y. pestis based on CRISPR polymorphisms.

Question marks represent last half part of spacers array. The characteristic spacers are underlined.

https://doi.org/10.1371/journal.pone.0002652.g004

Spacer a6 (SSS) can be predicted to be very ancient, since it had to be acquired before a37, and the very similar spacer a37″ has already been in the ancestral strain “Angola”. Spacer a6 is also present in a number of microtus strains. The most parsimonious hypothesis is that “a6” was lost in the Cb4, Cb4′ and Cb2. The poorly informative “a-1-2-3” allele may descend from multiple ancestors. Nevertheless, in consideration of geographic connection and overlapping of the isolates belonging to the clusters Ca7 and Cb4, Ca7 is a candidate ancestor for Cb4.

A transmission route of bv. microtus in both China and the FSU area

In this research, the isolates from four different microtus-related plague foci (L, M, 34 and 36) were divided into three clusters (Cc1, Cc2 and Cc3). Because most (90%) spacers arrays in YPc are “c1∼3” and the ancient subsp. caucasica isolates had longer array (“c-1-2-3-5-6”), the shorter arrays “c-1-2” and “c-1” in Cc2 and Cc1, respectively, are likely the result of more recent deletion of spacers. Similarly, the spacers array “b-1-2-3-4-10” would generate “b-1-3-4-10” with the loss of b2 spacer. Such process was irreversible because b2 could not insert into the spacers array in its descendants. Therefore, we predict the existence of an ancestor of Cc2 with spacers array “b-1-2-3-4-10” in YPb. Accordingly, evolutionary models among Cc1, Cc3 and ancestor of Cc2 were proposed in Figure 5 for illustrating a tentative evolution scenario. Figure 5-B showed that c2 and b10 as pre-acquired spacers were lost first and then acquired again in the process. However, there are no report of the same two spacers present in one CRISPR locus until now, which seems to say that it is highly unlikely to acquire the same spacer twice. Therefore, this process was unreasonable. Figure 5-C proposes that ancestor of Cc2 and Cc1 had no direct relation. Isolates of Cc2 belong to subsp. altaica. This subtype is distributed along the Altai Mountains in Russia and across Mongolia, next to focus L in China, where the Cc1 is located, and no natural barrier is separating Cc1 and Cc2. Furthermore, it seems coincidental that the same spacer c3 was deleted in two different evolutionary directions. Therefore, the process showed in Figure 5-C is unreasonable too. Altogether, the process shown in Figure 5-A is the most likely evolutionary model of bv. microtus strains in these four plague foci.

thumbnail
Figure 5. Evolutionary models of bv. microtus Cc3, Cc2 and Cc1 isolates.

A: A process from Cc3, through an ancestor of Cc2, to Cc1 with the loss of a series of spacers. B: The model proposes that Cc3 evolved to Cc1 by losing c2, c3 and b10, then to ancestor of Cc2 by acquiring c2 and b10. C: The model proposes that ancestor of Cc2 and Cc1 had no direct relation, but were formed separately by losing different spacers of Cc3.

https://doi.org/10.1371/journal.pone.0002652.g005

According to the model above, we marked the possible connections of bv. microtus strains on the map (Figure 3), which moved around the Takla Makan Desert and Jungger Basin. Starting from Tadjikistan (subsp. hissarica), one branch (b-a) passed through the Kunlun Mountains, and went to the Qinghai-Tibet Plateau. A second branch (b-c-d) went north via the Pamirs Plateau, the Tianshan Mountains, the Altai Mountains and the Inner Mongolian Plateau. Bv. microtus isolates other than representatives of the most ancestral subsp. caucasica may originate from Tadjikistan (mostly between a and c in Figure 3) and expand along this line. According to Achtman et al. [7], bv. microtus was one of the oldest lineage of Y. pestis, therefore it can be hypothesized that Y. pestis emerged along this line. Isolates of Ca7 distributed in focus A, and foci 37 and 41 were on this route (blue spots on Figure 3), which supports such hypothesis. Therefore, this line might also be the main transmission route of Y. pestis. Some clones originated from this main route, like Ca8 (bv. orientalis, pink line in Figure 3) and Cb4′ (bv. mediaevalis, red line in Figure 3), have been subsequently transmitted to other places of the world by human business activity, like business through the silk road, or other coincident events, like the Caffa siege in 1346 [40].

Focus B in China extends along the Tianshan Mountain, connecting with Pre-Balkhash (focus 30) of Kazakhstan, and had been proposed to be the point of entry of Y. pestis strains into China from Central Asia [10]. The YPa polymorphism would fit with the expected evolutionary direction of Y. pestis in this long narrow focus. From west to east, focus B can be separated into three sections of similar size: B4, B3 and B2 (Figure S3). The majority of B4 isolates have the most complete SSSs, with “a-1-2-3-4-5-6-37-38-39” in its first part of spacers array. In contrast, some B3 isolates miss spacer a2, others a5 and a38. The latter subgroup lost a2 to form the spacers array observed in B2 isolates. The internal deletions of spacers indicate that the origin of Ca37 was from west side of the Tianshan Mountain (located on the main transmission route) and the evolutionary direction was from west to east (Figure 3 and Figure S3).

Conclusion

The research on CRISPR is still in its infant period. The analyses of spacers identified in the present research are helping to provide some rules for further illuminating the mechanism of CASS. The region-specific features made CRISPR loci as robust and easily standardized typing tools for Y. pestis, which will be helpful in rapidly tracing the source of outbreaks, as well as setting-up effective prevention and treatment during plague epidemic. Such results open the way to the development of a spoligotyping assay, which can be applied to any new isolate of Y. pestis. We proposed an evolutionary model of Y. pestis based on polymorphism of CRISPR loci, and our model suggested a main transmission route of Y. pestis. The branches derived from this main route may lead to the formation of natural plague foci in other places of the world. Nevertheless, the exact evolutionary scenario still needs to be uncovered by analyzing more isolates.

Materials and Methods

Bacterial strains

Three hundred and sixty-six Y. pestis strains from China, 35 strains from the FSU, and 4 strains from Mongolia were initially genotyped by MLVA as previously described (Pourcel et al., 2004). The three CRISPR loci were then investigated in a representative collection of 125 Chinese strains plus the FSU and Mongolian strains (Table S1). The strains were collected by the Xinjiang, Yunnan, Qinghai and Inner Mongolia Center for Disease Prevention & Control, China; as well as Antiplague Research Institute of Siberia and Far East, Irkutsk, Russia and the Russian Research Anti-Plague Institute “Microbe”, Saratov, Russia. All the strains were cultivated in the Luria-Bertani broth and the genomic DNAs were extracted using the conventional phenol-chloroform extraction method.

CRISPR loci amplification

Three CRISPR loci (YPa, YPb, YPc) were amplified respectively with the following primer pairs that targeted the region flanking the CRISPR [18]. YP1-L (5′-AATTTTGCTCCCCA AATAGCAT-3′) and YP1-R (5′-TTTTCCCCATTAGCGAAATAAGT A -3′) were used for amplifying the YPa region; YP2-L (5′-ATATCCTGCTTACCGAGGGT-3′) and YP2-R (5′-AATCAGCCACGCTCT GTCTA-3′) for YPb; and YP3-L (5′-GCCAAGGGATTAGTGAGTTAA-3′) and YP3-R (5′-TTTA CGCATTTTGCGCCATTG-3′) for YPc. The amplifications were performed in a 30 µl volume containing 10 ng of DNA template, 0.5 µM of each primer, 1 unit of Taq DNA polymerase, 200 µM of dNTPs, and 10×PCR buffer containing 500 mM KCl, 0.1 M Tris HCl (pH 8.3) and 25 mM MgCl2. The cycling condition were 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 40 s, annealing at 58°C for 40 s, extension at 72°C for 1 min, and a final extension at 72°C for 5 min in a MJ-Research PTC-225 PCR machine. An aliquot of 5 µL of the product was subjected to electrophoresis on 1.2% agarose gel in 0.5×TBE buffer (0.045 mM Tris-boracic acid, 1 mM EDTA, pH 8.0). The gels were stained with ethidium bromide for visualization under UV light.

Purification and sequencing

PCR products were purified by using TIAN quick Midi Purification Kit (TIANGEN Biotech Co., China) following the user's manual. The purified products were sequenced on an Applied Biosystems 3730 automated DNA sequencer by the dye termination method. Sequence assembly and editing were performed with the Seqman module of the DNAstar package (DNAstar Inc., Madison, Wis.)

In silico analysis

Seven Y. pestis genomes (Antiqua: NC_008150, CO92: NC_003143, KIM: NC_004088, Nepal516: NC_008149, Pestoides F: NC_009381, Microtus str. 91001: NC_005810, Angola: NC_010159) and the BLAST software were downloaded from NCBI website (http://www.ncbi.nlm.nih.gov). The spacer sequences were searched against GenBank using BLAST to find a homologous sequence [41]. The spacers arrays were acquired and analyzed online by using the “CRISPR Finder Tool” and “spacers dictionary” tools in CRISPRs database (http://crispr.u-psud.fr/) [22], [42][44]. The RNA secondary structural prediction is performed using the RNAstructure 4.5 software [45].

Spacer nomenclature and the name of natural plague foci

Because of the large number of new spacers identified in this work, the use of the 26-letter alphabet was not suitable; therefore, a new nomenclature system was employed to designate spacers. The prefix a, b, or c refers to the three CRISPR loci YPa (YP1), YPb (YP2) and YPc (YP3), respectively, and spacers were numbers. As a result, for YP1 spacer “a” used once by previous report will be designated here as “a1”, allele “YP1-abcde” is now “a1-a2-a3-a4-a5”, or in an abbreviated format “a-1-2-3-4-5”, or the more abbreviated “a1∼5” (this format can be used only when the spacers' number are continuous). The start of spacer array is recorded from the opposite side of the leader sequence. The name of natural plague foci of China is “focus+a capital letter”, like “focus B” [9]; natural plague foci of the FSU are named by “focus+a number”, like “focus 34” [3]. The geographic position and background data for the natural plague foci were documented by previous reports [3], [9].

Supporting Information

Figure S1.

The distribution of proto-spacers in prophage genes

https://doi.org/10.1371/journal.pone.0002652.s001

(0.78 MB TIF)

Figure S2.

Gel electrophoresis results of PCR products of isolates from focus L (Cc1) and M (Cc3). The ladder of marker was 2000, 1000, 750, 500, 250, 100 from top to bottom. From left to right, the first ten strands in fist line were products of isolates from focus L, the others 30 strands were products of isolates from focus M.

https://doi.org/10.1371/journal.pone.0002652.s002

(4.22 MB TIF)

Figure S3.

Evolutionary models of isolates from focus B. A: Evolutionary models. The number in bracket is the amount of isolates from corresponding region. “?” represent some RSSs and unique spacers. B: The geography position of focus B.

https://doi.org/10.1371/journal.pone.0002652.s003

(1.91 MB TIF)

Table S3.

Diversity of spacer sequence

https://doi.org/10.1371/journal.pone.0002652.s006

(0.03 MB DOC)

Table S4.

Diversity of spacer's array

https://doi.org/10.1371/journal.pone.0002652.s007

(0.03 MB DOC)

Table S6.

Distribution of CRISPR clusters

https://doi.org/10.1371/journal.pone.0002652.s009

(0.11 MB DOC)

Acknowledgments

Due to the limited space of this paper, we cannot include all the scientists from the Qinghai Institute for Endemic Diseases Prevention and Control, the Center for Disease Control and Prevention of Xinjiang Uygur Autonomous Region, and the Yunnan Institute for Endemic Disease Control and Prevention for their help to identify the Y. pestis isolates and extract DNAs from them. Ms Jin Wang was especially appreciated for her kind help during all experiments.

Author Contributions

Conceived and designed the experiments: RY YL YC YS AA GV. Performed the experiments: YL YC OG MP CP SD. Analyzed the data: RY YL YC YS AA OG YY CP XW GV. Contributed reagents/materials/analysis tools: AA MP ZG SD SB. Wrote the paper: RY YL YC GV. Other: Modified the paper: YS GV AA RY.

References

  1. 1. Perry RD, Fetherston JD (1997) Yersinia pestis–etiologic agent of plague. Clin Microbiol Rev 10: 35–66.RD PerryJD Fetherston1997Yersinia pestis–etiologic agent of plague.Clin Microbiol Rev103566
  2. 2. Gage KL, Kosoy MY (2005) Natural history of plague: perspectives from more than a century of research. Annu Rev Entomol 50: 505–528.KL GageMY Kosoy2005Natural history of plague: perspectives from more than a century of research.Annu Rev Entomol50505528
  3. 3. Anisimov AP, Lindler LE, Pier GB (2004) Intraspecific diversity of Yersinia pestis. Clin Microbiol Rev 17: 434–464.AP AnisimovLE LindlerGB Pier2004Intraspecific diversity of Yersinia pestis.Clin Microbiol Rev17434464
  4. 4. Greenfield RA, Drevets DA, Machado LJ, Voskuhl GW, Cornea P, et al. (2002) Bacterial pathogens as biological weapons and agents of bioterrorism. Am J Med Sci 323: 299–315.RA GreenfieldDA DrevetsLJ MachadoGW VoskuhlP. Cornea2002Bacterial pathogens as biological weapons and agents of bioterrorism.Am J Med Sci323299315
  5. 5. Grygorczuk S, Hermanowska-Szpakowicz T (2002) [Yersinia pestis as a dangerous biological weapon]. Med Pr 53: 343–348.S. GrygorczukT. Hermanowska-Szpakowicz2002[Yersinia pestis as a dangerous biological weapon].Med Pr53343348
  6. 6. Inglesby TV, Dennis DT, Henderson DA, Bartlett JG, Ascher MS, et al. (2000) Plague as a biological weapon: medical and public health management. Working Group on Civilian Biodefense. Jama 283: 2281–2290.TV InglesbyDT DennisDA HendersonJG BartlettMS Ascher2000Plague as a biological weapon: medical and public health management. Working Group on Civilian Biodefense.Jama28322812290
  7. 7. Achtman M, Morelli G, Zhu P, Wirth T, Diehl I, et al. (2004) Microevolution and history of the plague bacillus, Yersinia pestis. Proc Natl Acad Sci U S A 101: 17837–17842.M. AchtmanG. MorelliP. ZhuT. WirthI. Diehl2004Microevolution and history of the plague bacillus, Yersinia pestis.Proc Natl Acad Sci U S A1011783717842
  8. 8. Pourcel C, Andre-Mazeaud F, Neubauer H, Ramisse F, Vergnaud G (2004) Tandem repeats analysis for the high resolution phylogenetic analysis of Yersinia pestis. BMC Microbiol 4: 22.C. PourcelF. Andre-MazeaudH. NeubauerF. RamisseG. Vergnaud2004Tandem repeats analysis for the high resolution phylogenetic analysis of Yersinia pestis.BMC Microbiol422
  9. 9. Zhou D, Han Y, Song Y, Huang P, Yang R (2004) Comparative and evolutionary genomics of Yersinia pestis. Microbes Infect 6: 1226–1234.D. ZhouY. HanY. SongP. HuangR. Yang2004Comparative and evolutionary genomics of Yersinia pestis.Microbes Infect612261234
  10. 10. Zhou D, Han Y, Song Y, Tong Z, Wang J, et al. (2004) DNA microarray analysis of genome dynamics in Yersinia pestis: insights into bacterial genome microevolution and niche adaptation. J Bacteriol 186: 5138–5146.D. ZhouY. HanY. SongZ. TongJ. Wang2004DNA microarray analysis of genome dynamics in Yersinia pestis: insights into bacterial genome microevolution and niche adaptation.J Bacteriol18651385146
  11. 11. Li Y, Dai E, Cui Y, Li M, Zhang Y, et al. (2008) Different region analysis for genotyping Yersinia pestis isolates from China. PLoS ONE 3: e2166.Y. LiE. DaiY. CuiM. LiY. Zhang2008Different region analysis for genotyping Yersinia pestis isolates from China.PLoS ONE3e2166
  12. 12. Hai R, Yu DZ, Wei JC, Xia LX, Shi XM, et al. (2004) [Molecular biological characteristics and genetic significance of Yersinia pestis in China]. Zhonghua Liu Xing Bing Xue Za Zhi 25: 509–513.R. HaiDZ YuJC WeiLX XiaXM Shi2004[Molecular biological characteristics and genetic significance of Yersinia pestis in China].Zhonghua Liu Xing Bing Xue Za Zhi25509513
  13. 13. Achtman M, Zurth K, Morelli G, Torrea G, Guiyoule A, et al. (1999) Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. Proc Natl Acad Sci U S A 96: 14043–14048.M. AchtmanK. ZurthG. MorelliG. TorreaA. Guiyoule1999Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis.Proc Natl Acad Sci U S A961404314048
  14. 14. Guiyoule A, Grimont F, Iteman I, Grimont PA, Lefevre M, et al. (1994) Plague pandemics investigated by ribotyping of Yersinia pestis strains. J Clin Microbiol 32: 634–641.A. GuiyouleF. GrimontI. ItemanPA GrimontM. Lefevre1994Plague pandemics investigated by ribotyping of Yersinia pestis strains.J Clin Microbiol32634641
  15. 15. Lucier TS, Brubaker RR (1992) Determination of genome size, macrorestriction pattern polymorphism, and nonpigmentation-specific deletion in Yersinia pestis by pulsed-field gel electrophoresis. J Bacteriol 174: 2078–2086.TS LucierRR Brubaker1992Determination of genome size, macrorestriction pattern polymorphism, and nonpigmentation-specific deletion in Yersinia pestis by pulsed-field gel electrophoresis.J Bacteriol17420782086
  16. 16. Lindstedt B-A (2005) Multiple-locus variable number tandem repeats analysis for genetic fingerprinting of pathogenic bacteria. Electrophoresis 26: 2567–2582.B-A Lindstedt2005Multiple-locus variable number tandem repeats analysis for genetic fingerprinting of pathogenic bacteria.Electrophoresis2625672582
  17. 17. Klevytska AM, Price LB, Schupp JM, Worsham PL, Wong J, et al. (2001) Identification and characterization of variable-number tandem repeats in the Yersinia pestis genome. J Clin Microbiol 39: 3179–3185.AM KlevytskaLB PriceJM SchuppPL WorshamJ. Wong2001Identification and characterization of variable-number tandem repeats in the Yersinia pestis genome.J Clin Microbiol3931793185
  18. 18. Pourcel C, Salvignol G, Vergnaud G (2005) CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies. Microbiology 151: 653–663.C. PourcelG. SalvignolG. Vergnaud2005CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies.Microbiology151653663
  19. 19. Vergnaud G, Li Y, Gorge O, Cui Y, Song Y, et al. (2007) Analysis of the three Yersinia pestis CRISPR loci provides new tools for phylogenetic studies and possibly for the investigation of ancient DNA. Adv Exp Med Biol 603: 327–338.G. VergnaudY. LiO. GorgeY. CuiY. Song2007Analysis of the three Yersinia pestis CRISPR loci provides new tools for phylogenetic studies and possibly for the investigation of ancient DNA.Adv Exp Med Biol603327338
  20. 20. Mojica FJ, Diez-Villasenor C, Soria E, Juez G (2000) Biological significance of a family of regularly spaced repeats in the genomes of Archaea, Bacteria and mitochondria. Mol Microbiol 36: 244–246.FJ MojicaC. Diez-VillasenorE. SoriaG. Juez2000Biological significance of a family of regularly spaced repeats in the genomes of Archaea, Bacteria and mitochondria.Mol Microbiol36244246
  21. 21. Jansen R, Embden JD, Gaastra W, Schouls LM (2002) Identification of genes that are associated with DNA repeats in prokaryotes. Mol Microbiol 43: 1565–1575.R. JansenJD EmbdenW. GaastraLM Schouls2002Identification of genes that are associated with DNA repeats in prokaryotes.Mol Microbiol4315651575
  22. 22. Grissa I, Vergnaud G, Pourcel C (2007) The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics 8: 172.I. GrissaG. VergnaudC. Pourcel2007The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats.BMC Bioinformatics8172
  23. 23. Horvath P, Romero DA, Coute-Monvoisin AC, Richards M, Deveau H, et al. (2007) Diversity, activity and evolution of CRISPR loci in Streptococcus thermophilus. J Bacteriol. P. HorvathDA RomeroAC Coute-MonvoisinM. RichardsH. Deveau2007Diversity, activity and evolution of CRISPR loci in Streptococcus thermophilus.J Bacteriol
  24. 24. Deveau H, Barrangou R, Garneau JE, Labonte J, Fremaux C, et al. (2007) Phage response to CRISPR-encoded resistance in Streptococcus thermophilus. J Bacteriol. H. DeveauR. BarrangouJE GarneauJ. LabonteC. Fremaux2007Phage response to CRISPR-encoded resistance in Streptococcus thermophilus.J Bacteriol
  25. 25. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, et al. (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315: 1709–1712.R. BarrangouC. FremauxH. DeveauM. RichardsP. Boyaval2007CRISPR provides acquired resistance against viruses in prokaryotes.Science31517091712
  26. 26. Bolotin A, Quinquis B, Sorokin A, Ehrlich SD (2005) Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology 151: 2551–2561.A. BolotinB. QuinquisA. SorokinSD Ehrlich2005Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin.Microbiology15125512561
  27. 27. Mojica FJ, Diez-Villasenor C, Garcia-Martinez J, Soria E (2005) Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements. J Mol Evol 60: 174–182.FJ MojicaC. Diez-VillasenorJ. Garcia-MartinezE. Soria2005Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements.J Mol Evol60174182
  28. 28. Lillestol RK, Redder P, Garrett RA, Brugger K (2006) A putative viral defence mechanism in archaeal cells. Archaea 2: 59–72.RK LillestolP. RedderRA GarrettK. Brugger2006A putative viral defence mechanism in archaeal cells.Archaea25972
  29. 29. Goyal M, Saunders NA, van Embden JD, Young DB, Shaw RJ (1997) Differentiation of Mycobacterium tuberculosis isolates by spoligotyping and IS6110 restriction fragment length polymorphism. J Clin Microbiol 35: 647–651.M. GoyalNA SaundersJD van EmbdenDB YoungRJ Shaw1997Differentiation of Mycobacterium tuberculosis isolates by spoligotyping and IS6110 restriction fragment length polymorphism.J Clin Microbiol35647651
  30. 30. Brudey K, Driscoll JR, Rigouts L, Prodinger WM, Gori A, et al. (2006) Mycobacterium tuberculosis complex genetic diversity: mining the fourth international spoligotyping database (SpolDB4) for classification, population genetics and epidemiology. BMC Microbiol 6: 23.K. BrudeyJR DriscollL. RigoutsWM ProdingerA. Gori2006Mycobacterium tuberculosis complex genetic diversity: mining the fourth international spoligotyping database (SpolDB4) for classification, population genetics and epidemiology.BMC Microbiol623
  31. 31. Mokrousov I, Limeschenko E, Vyazovaya A, Narvskaya O (2007) Corynebacterium diphtheriae spoligotyping based on combined use of two CRISPR loci. Biotechnol J 2: 901–906.I. MokrousovE. LimeschenkoA. VyazovayaO. Narvskaya2007Corynebacterium diphtheriae spoligotyping based on combined use of two CRISPR loci.Biotechnol J2901906
  32. 32. Haft DH, Selengut J, Mongodin EF, Nelson KE (2005) A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes. PLoS Comput Biol 1: e60.DH HaftJ. SelengutEF MongodinKE Nelson2005A guild of 45 CRISPR-associated (Cas) protein families and multiple CRISPR/Cas subtypes exist in prokaryotic genomes.PLoS Comput Biol1e60
  33. 33. Derbise A, Chenal-Francisque V, Pouillot F, Fayolle C, Prevost MC, et al. (2007) A horizontally acquired filamentous phage contributes to the pathogenicity of the plague bacillus. Mol Microbiol 63: 1145–1157.A. DerbiseV. Chenal-FrancisqueF. PouillotC. FayolleMC Prevost2007A horizontally acquired filamentous phage contributes to the pathogenicity of the plague bacillus.Mol Microbiol6311451157
  34. 34. Sorek R, Kunin V, Hugenholtz P (2007) CRISPR-a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol. R. SorekV. KuninP. Hugenholtz2007CRISPR-a widespread system that provides acquired resistance against phages in bacteria and archaea.Nat Rev Microbiol
  35. 35. Tyson K, Metheringham R, Griffiths L, Cole J (1997) Characterisation of Escherichia coli K-12 mutants defective in formate-dependent nitrite reduction: essential roles for hemN and the menFDBCE operon. Arch Microbiol 168: 403–411.K. TysonR. MetheringhamL. GriffithsJ. Cole1997Characterisation of Escherichia coli K-12 mutants defective in formate-dependent nitrite reduction: essential roles for hemN and the menFDBCE operon.Arch Microbiol168403411
  36. 36. Dai E, Tong Z, Wang X, Li M, Cui B, et al. (2005) Identification of different regions among strains of Yersinia pestis by suppression subtractive hybridization. Res Microbiol 156: 785–789.E. DaiZ. TongX. WangM. LiB. Cui2005Identification of different regions among strains of Yersinia pestis by suppression subtractive hybridization.Res Microbiol156785789
  37. 37. Zhou D, Tong Z, Song Y, Han Y, Pei D, et al. (2004) Genetics of metabolic variations between Yersinia pestis biovars and the proposal of a new biovar, microtus. J Bacteriol 186: 5147–5152.D. ZhouZ. TongY. SongY. HanD. Pei2004Genetics of metabolic variations between Yersinia pestis biovars and the proposal of a new biovar, microtus.J Bacteriol18651475152
  38. 38. Song Y, Tong Z, Wang J, Wang L, Guo Z, et al. (2004) Complete genome sequence of Yersinia pestis strain 91001, an isolate avirulent to humans. DNA Res 11: 179–197.Y. SongZ. TongJ. WangL. WangZ. Guo2004Complete genome sequence of Yersinia pestis strain 91001, an isolate avirulent to humans.DNA Res11179197
  39. 39. Barrangou R, Yoon SS, Breidt F Jr, Fleming HP, Klaenhammer TR (2002) Identification and characterization of Leuconostoc fallax strains isolated from an industrial sauerkraut fermentation. Appl Environ Microbiol 68: 2877–2884.R. BarrangouSS YoonF. Breidt JrHP FlemingTR Klaenhammer2002Identification and characterization of Leuconostoc fallax strains isolated from an industrial sauerkraut fermentation.Appl Environ Microbiol6828772884
  40. 40. Wheelis M (2002) Biological warfare at the 1346 siege of Caffa. Emerg Infect Dis 8: 971–975.M. Wheelis2002Biological warfare at the 1346 siege of Caffa.Emerg Infect Dis8971975
  41. 41. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410.SF AltschulW. GishW. MillerEW MyersDJ Lipman1990Basic local alignment search tool.J Mol Biol215403410
  42. 42. Grissa I, Bouchon P, Pourcel C, Vergnaud G (2007) On-line resources for bacterial micro-evolution studies using MLVA or CRISPR typing. Biochimie. I. GrissaP. BouchonC. PourcelG. Vergnaud2007On-line resources for bacterial micro-evolution studies using MLVA or CRISPR typing.Biochimie
  43. 43. Grissa I, Vergnaud G, Pourcel C (2007) CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. I. GrissaG. VergnaudC. Pourcel2007CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats.Nucleic Acids Res
  44. 44. Grissa I, Vergnaud G, Pourcel C (2008) CRISPRcompar: a website to compare clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. I. GrissaG. VergnaudC. Pourcel2008CRISPRcompar: a website to compare clustered regularly interspaced short palindromic repeats.Nucleic Acids Res
  45. 45. Mathews DH, Disney MD, Childs JL, Schroeder SJ, Zuker M, et al. (2004) Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proc Natl Acad Sci U S A 101: 7287–7292.DH MathewsMD DisneyJL ChildsSJ SchroederM. Zuker2004Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure.Proc Natl Acad Sci U S A10172877292