Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Correction: The miR-30 MicroRNA Family Targets smoothened to Regulate Hedgehog Signalling in Zebrafish Early Muscle Development

  • Ami Ketley,
  • Anne Warren,
  • Emily Holmes,
  • Martin Gering,
  • A. Aziz Aboobaker,
  • J. David Brook

Correction: The miR-30 MicroRNA Family Targets smoothened to Regulate Hedgehog Signalling in Zebrafish Early Muscle Development

  • Ami Ketley, 
  • Anne Warren, 
  • Emily Holmes, 
  • Martin Gering, 
  • A. Aziz Aboobaker, 
  • J. David Brook
PLOS
x

There is an incorrect sequence listed in the Microinjections section of the Materials and Methods. The corrected section is: Fertilized one-cell zebrafish embryos were injected with 6 ng miR-30 morpholino in 1 nl (TGCACCAGCTTCCAGTCAAGGATGTTTACAG), 50 pg of miR-30 duplex RNA and 50 pg in vitro-transcribed capped GFP mRNAs. Zebrafish smoothened 3′UTR sequence was amplified by RT-PCR and subcloned downstream of the GFP ORF that was inserted into vector pCS2+. A morpholino designed against smoothened was used to determine antibody specificity, (GAGGACATCTTGGAGACGCAACAAA) and injected at 2.5 ng per embryo (Fig. S3). The smoothened target protector sequence was GTGTATGTAAACACCATAAACTGAC and was injected at 9 ng/embryo.