Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Correction: A Network of HSPG Core Proteins and HS Modifying Enzymes Regulates Netrin-Dependent Guidance of D-Type Motor Neurons in Caenorhabditis elegans

  • Stephan Gysi,
  • Christa Rhiner,
  • Stephane Flibotte,
  • Donald G. Moerman,
  • Michael O. Hengartner

Correction: A Network of HSPG Core Proteins and HS Modifying Enzymes Regulates Netrin-Dependent Guidance of D-Type Motor Neurons in Caenorhabditis elegans

  • Stephan Gysi, 
  • Christa Rhiner, 
  • Stephane Flibotte, 
  • Donald G. Moerman, 
  • Michael O. Hengartner
PLOS
x

In Table 1, regarding the allele op468, the correct breakpoints are as follows: 5': AAATCAATATTTCAGCAATCG 3': AAGAGTTCATTTAGCTGTAT