Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Genetic Variants of LRRK2 in Taiwanese Parkinson’s Disease

  • Yih-Ru Wu ,

    Contributed equally to this work with: Yih-Ru Wu, Kuo-Hsuan Chang

    Affiliation Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan

    ⨯
  • Kuo-Hsuan Chang ,

    Contributed equally to this work with: Yih-Ru Wu, Kuo-Hsuan Chang

    Affiliation Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan

    ⨯
  • Wen-Teng Chang,

    Affiliation Department of Life Science, National Taiwan Normal University, Taipei, Taiwan

    ⨯
  • Ya-Chin Hsiao,

    Affiliation Department of Life Science, National Taiwan Normal University, Taipei, Taiwan

    ⨯
  • Hsuan-Chu Hsu,

    Affiliation Department of Life Science, National Taiwan Normal University, Taipei, Taiwan

    ⨯
  • Pei-Ru Jiang,

    Affiliation Department of Life Science, National Taiwan Normal University, Taipei, Taiwan

    ⨯
  • Yi-Chun Chen,

    Affiliation Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan

    ⨯
  • Chih-Ying Chao,

    Affiliation Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan

    ⨯
  • Yi-Chung Chang,

    Affiliation Department of Life Science, National Taiwan Normal University, Taipei, Taiwan

    ⨯
  • Bo-Hsun Lee,

    Affiliation Department of Life Science, National Taiwan Normal University, Taipei, Taiwan

    ⨯
  • Fen-Ju Hu,

    Affiliation Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan

    ⨯
  • Wan-Ling Chen,

    Affiliation Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan

    ⨯
  • Guey-Jen Lee-Chen ,

    t43019@ntnu.edu.tw (GJLC); cmchen@adm.cgmh.org.tw (CMC)

    Affiliation Department of Life Science, National Taiwan Normal University, Taipei, Taiwan

    ⨯
  • Chiung-Mei Chen

    t43019@ntnu.edu.tw (GJLC); cmchen@adm.cgmh.org.tw (CMC)

    Affiliation Department of Neurology, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taipei, Taiwan

    ⨯

Abstract

Genetic variants of leucine-rich repeat kinase 2 (LRRK2) were reported to alter the risk for Parkinson’s disease (PD). However, the genetic spectrum of LRRK2 variants has not been clearly disclosed yet in Taiwanese population. Herein, we sequenced LRRK2 coding region in 70 Taiwanese early onset PD patients (age at onset ≤ 50), and found six amino acid-changing single nucleotide polymorphisms (SNPs, N551K, R1398H, R1628P, S1647T, G2385R and M2397T), one reported (R1441H) and 2 novel missense (R767H and S885N) mutations. We examined the frequency of identified LRRK2 variants by genotyping 573 Taiwanese patients with PD and 503 age-matched control subjects. The results showed that PD patients demonstrated a higher frequency of G2385R A allele (4.6%) than control subjects (2.1%; odds ratio = 2.27, 95% confidence interval: 1.38–3.88, P = 0.0017). Fewer PD patients (27.7%) carried the 1647T-2397T haplotype as compared with the control subjects (33.0%; odds ratio = 0.80, 95% confidence interval: 0.65–0.97, P = 0.0215). However, the frequency of 1647T-2385R-2397T haplotype (4.3%) in PD patients was still higher than in control subjects (1.9%, odds ratio: 2.15, 95% confidence interval: 1.27–3.78, P = 0.0058). While no additional subject was found to carry R767H and R1441H, one more patient was observed to carry the S885N variant. Our results indicate a robust risk association regarding G2385R and a new possible protective haplotype (1647T-2397T). Gene-environmental interaction and a larger cohort study are warranted to validate our findings. Additionally, two new missense mutations (R767H and S885N) regarding LRRK2 in PD patients were identified. Functional studies are needed to elucidate the effects of these LRRK2 variants on protein function.

Citation: Wu Y-R, Chang K-H, Chang W-T, Hsiao Y-C, Hsu H-C, Jiang P-R, et al. (2013) Genetic Variants of LRRK2 in Taiwanese Parkinson’s Disease. PLoS ONE 8(12): e82001. https://doi.org/10.1371/journal.pone.0082001

Editor: Mathias Toft, Oslo University Hospital, Norway

Received: May 20, 2013; Accepted: October 19, 2013; Published: December 5, 2013

Copyright: © 2013 Wu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by grants NSC98-2628-B-182A-001-MY3, NSC 99-2811-B-182A-007 and NSC100-2811-B-182A-003 from National Science Council, Executive Yuan, and CMRPG3B138 from Chang Gung Memorial Hospital, Taipei, Taiwan. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Parkinson’s disease (PD) is the second most common neurodegenerative disorder in the world [1]. It affects 1% of the population aged over sixty, and is characterized by a slowness of movement (bradykinesia) and a difficulty in initiating movement (akinesia) [1]. The pathogenesis of PD is associated with progressive degeneration of dopaminergic (DA) neurons and the presence of eosinophilic cytoplasmic inclusion bodies (Lewy bodies) with enrichment of α-synuclein in the ventral midbrain [2].

The etiology of PD remains to be explored. Mutations in the gene for leucine-rich repeat kinase 2 (LRRK2) account for some patients with autosomal dominantly inherited PD [3,4]. LRRK2 gene encodes a large multidomain protein that includes ANK (ankyrin repeat), LRR (leucine-rich repeat), ROC (Ras of complex proteins; GTPase), COR (C-terminal of ROC), MAPKKK (mitogen-activated kinase kinase kinase) and WD40 domains [5,6]. Up to now, a number of putatively mutations and single nucleotide polymorphisms (SNPs) in the LRRK2 gene have been reported (the Human Gene Mutation Database, http://www.hgmd.cf.ac.uk/ac/index.php?gene=LRRK2).

In Taiwan, the LRRK2 G2385R and R1628P variants may play significant roles in susceptibility to PD [7–10]. In contrast, LRRK2 G2019S, a common mutation amongst PD patients in North America, Europe and North Africa [3,4,11–14], has not been found in Taiwanese PD patients [15]. The disease penetrance for G2019S carriers is age dependent, increasing from less than 20% at age 50 years or younger to 80~85% at age 70 years [16,17]. Age at onset (AAO) of mutation carriers is broad, ranged from 28 to 73 years, and mutation carriers were clinically indistinguishable from idiopathic PD [18,19]. To further examine the genetic variations of LRRK2 in Taiwanese PD, we sequenced the LRRK2 coding region in 70 Taiwanese PD patients and assessed the association of identified SNPs with the risk of PD by utilizing a large case-control cohort of patients and controls, to provide more insight into LRRK2 variants in Taiwanese PD patients.

Results

Mutation analysis of LRRK2

LRRK2 cDNA fragments encompassing ANK to WD40 domains from 70 patients with the age at onset of PD ≤ 50 were amplified for sequence analysis. In addition to twelve exonic variants (N551K, L953, R1398H, K1423, G1624, R1628P, K1637, S1647T, G1819, E2108, G2385R and M2397T) (Table 1), one reported (R1441H) [20–23] and five novel (R767H and S885N in Figure 1A; R1483, Y2018 and N2047, data not shown) variants were identified. The three missense substitutions were then examined using PCR-based BspHI RFLP (R767H), ARMS test (S885N), or BstUI RFLP (R1441H) (Figure 1B) in PD patients (n = 612) and controls (n = 508). While no additional subject was found to carry R767H and R1441H, one more patient was observed as carrying the S885N variant. No controls were observed carrying the novel variants R767H and S885N. R767H, S885N, and R1441H are located in the ANK, in between ANK and LRR, and in the ROC domain, respectively. The three missense variants are highly conserved among the known mammalian homologues of the LRRK2 protein (Figure 1C).

Exon  Accession no.   Amino acid (nucleotide) change  Remarks
14rs7308720N551K (AAC>AAG)Polymorphism
19R767H (CGT>CAT)Novel mutation Novel mutation
20S885N (AGT>AAT)Novel mutation
22rs7966550L953 (TTA>CTA) Polymorphism
30rs7133914R1398H (CGT>CAT) Polymorphism
30rs11175964K1423 (AAG>AAA)Polymorphism
31ss48398558R1441H (CGC>CAC)Mutation*
31R1483 (CGA>AGA)Novel variant
34rs1427263G1624 (GGC>GGA)Polymorphism
34rs33949390R1628P (CGT>CCT)Polymorphism
34rs11176013K1637 (AAA>AAG)Polymorphism
34rs11564148S1647T (TCA>ACA)Polymorphism
37rs10878371G1819 (GGT>GGC)Polymorphism
41Y2018 (TAC>TAT)Novel variant
42N2047 (AAT>AAC)Novel variant
43rs10878405E2108 (GAG>GAA)Polymorphism
48rs34778348G2385R (GGA>AGA)Polymorphism
49rs3761863M2397T (ATG>ACG)Polymorphism

Table 1. Exonic variants identified in early-onset PD.

* Reported [20–23]
CSV
Download CSV
thumbnail
Download:
Figure 1. Mutation identification and amino acid sequence alignment.

a Chromatograms of direct cDNA sequencing of R767H, S885N and R1441H. b Restriction enzyme RFLP or ARMS analysis of R767H, S885N, R1441H mutations. On agarose gel, R767H results restriction by BspHI and leads to additional 419 and 154 bp bands, whereas R1441H prevents restriction by BstUI and leads to an additional 715 bp band. c Evolutionary conservation of the regions of LRRK2 R767H, S885N and R1441H using the program Vector NTI.

https://doi.org/10.1371/journal.pone.0082001.g001

Case-control study of N551K, R1398H, R1628P, S1647T, G2385R and M2397T

A case–control study in a cohort of PD (n = 573) and ethnically matched controls (n = 503) was conducted to assess the association of the six amino acid-changing variants with risk of PD. The genotype distributions in PD and controls did not deviate significantly from Hardy–Weinberg equilibrium for any of the six variants examined (data not shown). The SNPSpD method was employed for correction of multiple SNP testing. SNPSpD output of six λs was shown in Table 2. As described by Cheverud [24], high correlation among variables leads to high λs. In this case, the first λ (2.37) was less than 6 (the number of variables in the correlation matrix), suggesting that not all variables are completely correlated. The magnitude of pair-wise LD was quantified by the metrics D’ and Δ2. The D’ and Δ2 coefficients of 551 and 1398 sites were 0.94 and 0.77, respectively, suggesting less historical recombination and more LD between 551 and 1398 sites. This was also true for 1647 and 2397 sites, with a D’ coefficient of 0.93 and a Δ2 coefficient of 0.59.

D’
N551KR1398HR1628PS1647TG2385RM2397T
Δ2N551K2.370.941.000.960.880.72
R1398H0.771.451.000.930.980.77
R1628P0.000.000.960.960.040.87
S1647T0.050.050.040.870.890.93
G2385R0.000.000.000.050.230.94
M2397T0.050.070.020.590.040.12

Table 2. Pairwise linkage disequilibrium measures for LRRK2 SNPs.

Lewontin’s standardized disequilibrium coefficients (D’) are given above the diagonal and the squared pairwise correlations (Δ2) are given below the diagonal; the eigenvalues (λs) associated with the LD correlation matrix are given along the diagonal (bold, italic).
CSV
Download CSV

The genotype and allele distributions of the six variants for both patients and controls are outlined in Table 3. A statistically significant difference in G2385R A allele (4.6% vs. 2.1%, P = 0.0013) distribution between patients and controls was observed. When odds ratios of the at-risk genotype/allele were calculated, an increase in risk of developing PD was demonstrated for G2385R A allele (odds ratio: 2.27, 95% confidence interval: 1.38 - 3.88, P = 0.0017). The allele distribution of G2385R was further analyzed after being stratified by age. In the early onset PD (EOPD) group (AAO ≤ 50), a significant difference in G2385R A allele (5.1% vs. 0.8%, P = 0.0063) distribution between patients and controls was observed. EOPD patients with A allele have odds ratio 6.61 (95% confidence interval: 1.72 - 43.35, P = 0.0155) as compared with controls. In the late onset PD (LOPD) group (AAO > 50), a significant difference in G2385R A allele (4.5% vs. 2.5%, P = 0.0295) distribution between patients and controls was also observed. The LOPD patients with A allele has an odds ratio of 1.84 (95% confidence interval: 1.08 - 3.26, P = 0.0288) as compared with controls. The difference in A allele distribution between EOPD and LOPD groups were not significant (5.1% vs. 4.5%, P = 0.7329). The allele distribution of other variants did not show a significant difference between early and late onset PD patients groups as well as controls.

Frequency (%)P-valueOdds ratio(95% CI)P-value
PD (n=573)Controls (n=503)
Age (years)62.1 ± 11.559.4 ± 12.9
Sex (female)44.7%49.3%
N551KN551K
CC, CG, GG85.7, 13.6, 0.783.9, 15.7, 0.40.5118CG+GG vs. CC0.87 (0.62-1.21)0.4134
G allele7.58.30.5209G allele0.91 (0.67-1.25)0.5770
R1398HR1398H
GG, GA, AA84.3, 15.0, 0.780.9, 18.9, 0.20.1224GA+AA vs. GG0.79 (0.58-1.08)0.1442
A allele8.29.60.2413A allele0.84 (0.62-1.23)0.2418
R1628PR1628P
GG, GC, CC94.1, 5.9, 0.095.6, 4.4, 0.00.2504GC vs. GG1.38 (0.80-2.42)0.2521
C allele3.02.20.2568C allele1.37 (0.80-2.39)0.2586
S1647TS1647T
TT, TA, AA40.5, 46.4, 13.136.4, 49.7, 13.90.3851TA+AA vs. TT0.84 (0.66-1.08)0.1675
A allele36.338.80.2381A allele0.90 (0.76-1.07)0.2381
G2385RG2385R
GG, GA, AA90.8, 9.2, 0.095.8, 4.2, 0.00.0010GA vs. GG2.34 (1.41-4.02)0.0014
A allele4.62.10.0013A allele2.27 (1.38-3.88)0.0017
M2397TM2397T
TT, TC, CC29.3, 50.6, 20.125.8, 52.5, 21.70.4318TC+CC vs. TT0.84 (0.64-1.10)0.2041
C allele 45.447.90.2391C allele 0.90 (0.76-1.07)0.2391

Table 3. Genotype and allele distribution and association analysis.

CSV
Download CSV

To examine if there is any haplotype of LRRK2 551, 1398, 1628, 1647, 2385 or 2397 site may associate with PD, pairwise haplotype analysis in the LRRK2 gene was performed and the results (frequency ≥ 1%) are shown in Table 4. The 1647T-2397T haplotype was notably lower in PD patients than the controls (27.7% vs. 33.0%, P = 0.0244), with a trend toward decrease in risk of developing PD (odds ratio: 0.80, 95% confidence interval: 0.65 - 0.97, P = 0.0215). However, when G2385R was linked to 1647T-2397T (1647T-2385R-2397T haplotype), an increase in risk of developing PD (odds ratio: 2.15, 95% confidence interval: 1.27 - 3.78, P = 0.0058) was still observed, suggesting that 1647T-2397T haplotype cannot counteract the genetic effect of 2385R in PD.

Haplotype*PD / NC (%)P-valueOdds ratio (95% CI)P-value
Wild type (N551-R1398-R1628-S1647-G2385-M2397)00000051.2 / 48.60.39231.00
2397T0000013.7 / 2.60.15951.35 (0.82-2.25)0.2479
1647T0001001.3 / 1.50.72100.83 (0.40-1.73)0.6218
1647T-2397T00010127.7 / 33.00.02440.80 (0.65-0.97)0.0215
1647T-2385R-2397T 000111 4.3 / 1.9 0.0019 2.15 (1.27-3.78)0.0058
1628P-1647T-2397T0011012.8 / 2.0 0.23111.33 (0.76-2.40)0.3243
1398H-2397T0100011.0 / 1.40.35380.65 (0.29-1.45)0.2984
551K-1398H 110000 1.0 / 0.90.72091.11 (0.47-2.74)0.8135
551K-1398H-2397T1100015.8 / 6.70.45040.83 (0.58-1.19)0.3190

Table 4. Haplotype distributions of LRRK2 polymorphisms in patients with Parkinson’s disease (PD) and controls and associations in PD risks.

* Wild type = 0, variant = 1; examples: N551-R1398-R1628-S1647-G2385-M2397 nominated as 000000, 1647T-2397T nominated as 000101, 1647T-2385R-2397T nominated as 000111.
CSV
Download CSV

Discussion

The present study consolidates the role of LRRK2 G2385R as a risk factor of PD, and supports that S1647T-M2397T haplotype may lower the susceptibility of PD among Taiwanese population. We also identify one reported (R1441H) and two novel missense mutations (R767H and S885N) of LRRK2. Although the genome-wide association studies (GWAS) reported a strong association between LRRK2 genetic variations and PD [25,26], the GWAS association signal has not been driven by identified missense variant as the G2385R, which may be due to this risk variant is ethnic specific.

The G2835R variant on the WD40 domain was first reported in a PD patient from Taiwan, with less than 1% frequency in Caucasian controls [20]. This variant is more common in Asia and is associated with an increased risk of PD in Japan, Singapore and Mainland China [27–30], in addition to Taiwan [7–9]. When over-expressed in human HEK cells, the G2835R variant was more toxic and associated with a higher rate of apoptosis under condition of oxidative stress [27]. Acting differently from the common LRRK2 kinase-activating G2019S mutation [31], the G2385R mutant causes a partial loss of the kinase function of LRRK2 [32]. In M17 neuroblastoma cell line, G2019S mutation decreased the average length of neurites and G2019S/G2385R double mutants counteract the neurite shortening effect of G2019S, suggesting that the impact of G2385R is strong enough to overcome the kinase-activating effect of the G2019S [32]. Since both loss and gain of kinase function variants are pathogenic, it is likely that the kinase activity of LRRK2 can be tolerated over only a narrow range. It is also possible that the G2385R mutation leads to pathogenic effects via other mechanism, which raises another therapeutic aspect for PD.

The protective LRRK2 variants and haplotypes have been reported in PD patients. For example, R1398H and N551K reduce the risk of PD in Han-Chinese population [33]. Individuals carrying haplotype 551K-1398H-1423K have a significant reduction of PD risk in the white, Asian, and Arab-Berber populations [34]. Herein we identified a new LRRK2 haplotype 1647T-2397T related to the reduced risk for PD, although results seen in single variant disease-association analysis does not find risk alterations in these two polymorphisms. S1647T is located at the highly evolution-conserved COR domain, which is thought to be a regulator of ROC GTPase activity [35]. In a Taiwanese study, S1647T is associated with increased PD risk, after considering the interaction effects with pesticide exposure [36]. These results contrast with the effect of 1647T-2397T to reduce PD risk, suggesting that other, yet unknown, molecular mechanisms are involved. Located on WD40 domain, M2397T is a risk-associated polymorphism in inflammatory bowel disease [37]. This variant decreases the amount of LRRK2 by altering the protein stability when expressed in HEK-293 cells [38]. This mechanism may contribute to its protective role in PD. As the risk of developing PD with 1647T-2385R-2397T haplotype is similar to that with 2385R allele alone, the protective effect of 1647T-2397T haplotype may be absent in the population carrying G2385R risk variant. Alternatively, the protect effect of 1647T-2397T may be attributable to the absence of G2385R variant. A larger cohort study will be needed to delineate the genetic effect of 1647T-2397T haplotype on PD risk reduction.

Two novel (R767H and S885N) and one reported (R1441H) missense mutations were identified in this population study. R767H is located in the ANK domain [6], which may play a role in protein folding [39]. Although the substitution of arginine with histidine would not dramatically affect the protein polarity, the newly added guanidine group may affect the protein stability by modifying the folding structure of LRRK2. S885N mutation substitutes serine with asparagine at the hinge between the ANK and LRR domains. The molecular mechanism of this mutation remains elusive. R1441H lies within the ROC GTPase domain, and more recently identified mutations affecting the same amino acid (R1441C, R1441G) have been described in affected PD patients [4,20]. R1441C mutation has been shown to increase LRRK2 kinase activity [31]. Both R1441C and R1441G mutations affect the GTPase activity of LRRK2 [40]. Lymphoblastoid cell lines carrying R1441H mutation showed increased apoptosis following exposure to proteasome inhibitor [41]. Thus, these mutations act dominantly and most likely cause enzymatic or structural gain-of-function that leads to neuronal toxicity.

Although our results are significant, there are limitations in this study. The role of gene-environmental interaction has not been evaluated. The sample size in our study may not be able to identify an association when the genetic effect of the allele is weak. This may explain the lack of protective effects of R1398H and N551K and increased risk of R1628P seen in a Chinese multicenter study [33]. Additionally, there is insufficient segregation to prove the pathogenicity of the two novel mutations (R767H and S885N). Nevertheless, our population study provides more information about the genetic variant of LRRK2 in Taiwanese PD patients, and discovers two novel LRRK2 mutations. Further study is needed to identify the functional implications of these genetic variants, which may shed light on developing new therapeutic strategies for PD.

Materials and Methods

Ethics statement

This study was performed according to a protocol approved by the Institutional Review Board of Chang Gung Memorial Hospital (ethical license No: 97-2476A3), and all examinations were performed after obtaining written informed consents.

Patient population

A total of 573 unrelated Taiwanese PD subjects (44.7% females) were recruited from the neurology clinics of Chang Gung Memorial Hospital (CGMH). All patients were diagnosed with probable idiopathic PD according to the published criteria [42] by two neurologists specialized in movement disorders (Y.-R. Wu and C.-M. Chen). Subjects with a prior history of multiple cerebrovascular events or other causes of parkinsonian symptoms (e.g. brain injury or tumor, encephalitis, antipsychotic medication) were excluded. The mean age at onset of PD was 62.1±11.5 years, ranging between 19 and 93 years. A group of 503 normal controls without neurodegenerative diseases were recruited from the same ethnic community. Control subjects (49.3% females) had mean age at examination of 59.4±12.9 years, ranging between 20 and 90 years.

Genetic analysis

Genomic DNA was extracted from peripheral blood lymphocytes using standard protocols. For PD patients with onset ≤ 50 (n = 70), RNA was extracted using PAXgene Blood RNA Kit (PreAnalytiX). The RNA was DNase (Stratagene) treated, quantified, and reverse-transcribed to cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Using overlapping primers, LRRK2 cDNA encompassing ANK, LRR, ROC, COR, MAPKKK and WD40 domains was polymerase chain reaction (PCR) amplified (Table 5), gel purified and sequenced directly using the ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). The reported R1441H (ss48398558) and the novel R767H and S885N mutations were verified by genomic DNA PCR (Table 5) and sequencing. For population screening, the R767H and R1441H were examined using the BspHI (gain of site) and BstUI (loss of site) restriction enzymes, respectively; amplification refractory mutation system (ARMS) PCR was designed for S885N population screening (Table 5). For case–control studies, the N551K (rs7308720), R1398H (rs7133914), R1628P (rs33949390), S1647T (rs11564148), G2385R (rs34778348) and M2397T (rs3761863) SNPs were determined using the EarI (gain of site), BspHI (gain of site), FspBI (gain of site), AflIII (loss of site), AccI (gain of site) and TaaI (gain of site) restriction enzymes, respectively (Table 5). In addition, primers and probes for allele specific primer extension assay (Table 6) were designed for N551K, R1398H and M2397T SNPs determination.

Test (amplified region)Anneal (°C) / MgCl2 (mM)  Product / RFLP enzyme (fragment, bp)
cDNA sequencing (ANK, LRR and ROC domain) F: TTGACTTAGTAATATTCCATCAAATGTCTTCC R: TCTCACTAGTTGTAATAATCGTTTCCGGTC 56 / 2.0 2663
cDNA sequencing (COR and MAPKKK domain) F: GAGAAGCAACGCAAAGCCTGCATGAGTA R: CCCATCTTCGGTATTGATGACCAGGAGAGTAC 66 / 2.0 2322
cDNA sequencing (WD40 domain) F: ACGTAATTGTTGAATGCATGGTTGCTACAC R: TTCAGGGTATCCACATTCAAACATAGAGTTG 65 / 2.0 1896
N551K (AAC>AAG) (exon 14) F: tcacaaactggtcctagcag R: CCCCACTGTCATCTTATGTC 48 / 2.0 EarI: GAAGAG (186 /166, 20)
R767H (CGT>CAT) (exon 19) F: CCCAGGTATCTTACAGTGAG R: GCCAAGAAGGTTCAACT 48 / 2.0 BspHI: TCATGA (573 / 419, 154)
S885N (AGT>AAT) (exon 20) F1:CAGAAGCATAGCAATACG F2:TGACTCTTCTATGGACAA R:CGTTCCAGTCTAGTCAGA 46 / 2.0 540, 308
R1398H (CGT>CAT) (exon 30) F: TAGGTACTTTGATCGGTTGCTGAC R: GACTTCATTACTCGGAAAGTTTCCC 52 / 2.0 BspHI: TCATGA (509 / 299, 210)
R1441H (CGC>CAC) (exon 31) F: GTGGCAGTCATATTTGCTTGAGTG R: ACCAGCCTACCATGTTACCTTGAA 56 / 2.0 BstUI: CGCG (483, 232 / 715)
R1628P (CGT>CCT) (exon 34) F: TAGAGAAATTAGGTACTGTGTTGCACTT R: AAGAATAGATAGTGAATTTCCATGTAGC 56 / 1.5 FspBI: CTAG (157 / 83, 74)
S1647T (TCA>ACA) (exon 34) F: TAGGCCACATGGTTGCTAGAG R: CCTGCTTGGAACCAGCAAAT 54 / 1.5 AflIII: ACATGT (267, 82 / 349)
G2385R (GGA>AGA) (exon 48) F: TATAAGGTTGTATTACACGTAG R: TCTGAAAAGATGGTGCTGAGAAG 59 / 2.0 AccI: GTAGAC (265 / 186, 79)
M2397T (ATG>ACG) (exon 49) F: CCAACAGGTCTCCTTGAT R: CCTAGCTGTGCTGTCATC 46 / 2.0 TaaI: ACNGT (754 / 553, 201)

Table 5. Primers and conditions for PCR amplification of LRRK2 cDNA and genomic DNA.

CSV
Download CSV
Forward primerReverse primer Probe
551 C/Gcagggaggatacagaatttcatcccccactgtcatcttatgtctcctagcagctttgaa[C/G]
1398G/Acggttgctgacaaatatgcctcgctgcgtcataaaatgg[G/A]tgaggaattctatagtact
2397T/Ctggtggtggtgtcatgttttcctccagttcctatccaaagag[T/C]ggtaaaagaaaacaagg

Table 6. Primers and probes for allele specific primer extension (ASPE) assay of LRRK2 N551K, R1398H and M2397T polymorphisms.

CSV
Download CSV

Statistical analysis

The genotype frequency data and the expected genotypic frequency under random mating were computed and Chi-square tested for Hardy-Weinberg equilibrium using a standardized formula. The genotype and allele association analysis was carried out using the Chi-square test. The SNPSpD method [43] was used to generate an adjusted significance threshold for correction of multiple SNP testing (http://genepi.qimr.edu.au/general/daleN/SNPSpD/). The experiment-wide significance threshold of 0.0092 was required to keep the type I error rate at 5%. Measures of pairwise linkage disequilibrium (LD) between SNPs, including Lewontin’s standardized disequilibrium coefficients (D’), the squared pairwise correlations (Δ2), and eigenvalues (λs) were computed with the LDMAX software-part of the GOLD Command Line Tools package [44]. PHASE version 2.1 was used to infer the LRRK2 gene haplotypes [45]. The LRRK2 pairwise haplotype frequencies were computed and Chi-square tested for significance. Odds ratios with 95% confidence intervals (95% CI) were calculated to test association between genotype/allele/haplotype and disease.

Acknowledgments

We thank the patients and controls for participating in this study.

Author Contributions

Conceived and designed the experiments: YRW GJLC CMC. Performed the experiments: WTC YCH HCH PRJ CYC Y. Chang BHL FJH WLC. Analyzed the data: YRW GJLC CMC. Contributed reagents/materials/analysis tools: YRW KHC Y. Chen CMC. Wrote the manuscript: YRW KHC GJLC CMC.

References

  1. 1. Lang AE, Lozano AM (1998) Parkinson’s disease. First of two parts. N Engl J Med 339: 1044–1053. doi:https://doi.org/10.1056/NEJM199810083391506. PubMed: 9761807.
  2. 2. von. Bohlen , Halbach O, Schober A, Krieglstein K (2004) Genes, proteins, and neurotoxins involved in Parkinson’s disease. Prog Neurobiol 73: 151–177. doi:https://doi.org/10.1016/j.pneurobio.2004.05.002. PubMed: 15236834. Available online at: Available online at: PubMed: 15236834.
  3. 3. Paisán-Ruíz C, Jain S, Evans EW, Gilks WP, Simón J et al. (2004) Cloning of the gene containing mutations that cause PARK8-linked Parkinson’s disease. Neuron 44: 595–600. doi:https://doi.org/10.1016/j.neuron.2004.10.023. PubMed: 15541308.
  4. 4. Zimprich A, Biskup S, Leitner P, Lichtner P, Farrer M et al. (2004) Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron 44: 601–607. doi:https://doi.org/10.1016/j.neuron.2004.11.005. PubMed: 15541309.
  5. 5. Guo L, Wang W, Chen SG (2006) Leucine-rich repeat kinase 2: relevance to Parkinson’s disease. Int J Biochem Cell Biol 38: 1469–1475. doi:https://doi.org/10.1016/j.biocel.2006.02.009. PubMed: 16600664.
  6. 6. Mata IF, Wedemeyer WJ, Farrer MJ, Taylor JP, Gallo KA (2006) LRRK2 in Parkinson’s disease: protein domains and functional insights. Trends Neurosci 29: 286–293. doi:https://doi.org/10.1016/j.tins.2006.03.006. PubMed: 16616379.
  7. 7. Fung HC, Chen CM, Hardy J, Singleton AB, Wu YR (2006) A common genetic factor for Parkinson disease in ethnic Chinese population in Taiwan. BMC Neurol 6: 47. doi:https://doi.org/10.1186/1471-2377-6-47. PubMed: 17187665.
  8. 8. Di Fonzo A, Wu-Chou YH, Lu CS, van Doeselaar M, Simons EJ et al. (2006) A common missense variant in the LRRK2 gene, Gly2385Arg, associated with Parkinson’s disease risk in Taiwan. Neurogenetics 7: 133–138. doi:https://doi.org/10.1007/s10048-006-0041-5. PubMed: 16633828.
  9. 9. Farrer MJ, Stone JT, Lin CH, Dächsel JC, Hulihan MM et al. (2007) Lrrk2 G2385R is an ancestral risk factor for Parkinson’s disease in Asia. Parkinsonism Relat Disord 13: 89–92. doi:https://doi.org/10.1016/j.parkreldis.2006.12.001. PubMed: 17222580.
  10. 10. Lu CS, Wu-Chou YH, van Doeselaar M, Simons EJ, Chang HC et al. (2008) The LRRK2 Arg1628Pro variant is a risk factor for Parkinson’s disease in the Chinese population. Neurogenetics 9: 271–276. doi:https://doi.org/10.1007/s10048-008-0140-6. PubMed: 18716801.
  11. 11. Kachergus J, Mata IF, Hulihan M, Taylor JP, Lincoln S et al. (2005) Identification of a novel LRRK2 mutation linked to autosomal dominant parkinsonism: evidence of a common founder across European populations. Am J Hum Genet 76: 672–680. doi:https://doi.org/10.1086/429256. PubMed: 15726496.
  12. 12. Di Fonzo A, Rohé CF, Ferreira J, Chien HF, Vacca L et al. (2005) A frequent LRRK2 gene mutation associated with autosomal dominant Parkinson’s disease. Lancet 365: 412–415. doi:https://doi.org/10.1016/S0140-6736(05)70236-1. PubMed: 15680456.
  13. 13. Lesage S, Dürr A, Tazir M, Lohmann E, Leutenegger A-L et al. (2006) LRRK2 G2019S as a cause of Parkinson’s disease in North African Arabs. N Engl J Med 354: 422–423. doi:https://doi.org/10.1056/NEJMc055540. PubMed: 16436781.
  14. 14. Ozelius LJ, Senthil G, Saunders-Pullman R, Ohmann E, Deligtisch A et al. (2006) LRRK2 G2019S as a cause of Parkinson’s disease in Ashkenazi Jews. N Engl J Med 354: 424–425. doi:https://doi.org/10.1056/NEJMc055509. PubMed: 16436782.
  15. 15. Fung HC, Chen CM, Hardy J, Hernandez D, Singleton A et al. (2006) Lack of G2019S LRRK2 mutation in a cohort of Taiwanese with sporadic Parkinson’s disease. Mov Disord 21: 880–881. doi:https://doi.org/10.1002/mds.20814. PubMed: 16511860.
  16. 16. Kachergus J, Mata IF, Hulihan M, Taylor JP, Lincoln S et al. (2005) Identification of a novel LRRK2 mutation linked to autosomal dominant parkinsonism: evidence of a common founder across European populations. Am J Hum Genet 76: 672–680. doi:https://doi.org/10.1086/429256. PubMed: 15726496.
  17. 17. Hulihan MM, Ishihara-Paul L, Kachergus J, Warren L, Amouri R et al. (2008) LRRK2 Gly2019Ser penetrance in Arab-Berber patients from Tunisia: a case-control genetic study. Lancet Neurol 7: 591–594. doi:https://doi.org/10.1016/S1474-4422(08)70116-9. PubMed: 18539535.
  18. 18. Goldwurm S, Di Fonzo A, Simons EJ, Rohé CF, Zini M, et al. (2005) The G6055A (G2019S) mutation in LRRK2 is frequent in both early and late onset Parkinson's disease and originates from a common ancestor. Arch Neurol 63: 1250–1254. J Med Genet 42:e65.
  19. 19. Kay DM, Zabetian CP, Factor SA, Nutt JG, Samii A et al. (2006) Parkinson’s disease and LRRK2: frequency of a common mutation in U.S. movement disorder clinics. Mov Disord 21: 519–523. doi:https://doi.org/10.1002/mds.20751. PubMed: 16250030.
  20. 20. Mata IF, Kachergus JM, Taylor JP, Lincoln S, Aasly J et al. (2005) Lrrk2 pathogenic substitutions in Parkinson’s disease. Neurogenetics 6: 171–177. doi:https://doi.org/10.1007/s10048-005-0005-1. PubMed: 16172858.
  21. 21. Zabetian CP, Samii A, Mosley AD, Roberts JW, Leis BC et al. (2005) A clinic-based study of the LRRK2 gene in Parkinson disease yields new mutations. Neurology 65: 741–744. doi:https://doi.org/10.1212/01.WNL.0000172630.22804.73. PubMed: 16157909.
  22. 22. Spanaki C, Latsoudis H, Plaitakis A (2006) LRRK2 mutations on Crete: R1441H associated with PD evolving to PSP. Neurology 67: 1518–1519. doi:https://doi.org/10.1212/01.wnl.0000239829.33936.73. PubMed: 17060595.
  23. 23. Huang Y, Halliday GM, Vandebona H, Mellick GD, Mastaglia F et al. (2007) Prevalence and clinical features of common LRRK2 mutations in Australians with Parkinson’s disease. Mov Disord 22: 982–989. doi:https://doi.org/10.1002/mds.21477. PubMed: 17427941.
  24. 24. Cheverud JM (2001) A simple correction for multiple comparisons in interval mapping genome scans. Heredity (Edinb) 87: 52–58. doi:https://doi.org/10.1046/j.1365-2540.2001.00901.x. PubMed: 11678987.
  25. 25. Satake W, Nakabayashi Y, Mizuta I, Hirota Y, Ito C et al. (2009) Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson’s disease. Nat Genet 41: 1303–1307. doi:https://doi.org/10.1038/ng.485. PubMed: 19915576.
  26. 26. Simón-Sánchez J, Schulte C, Bras JM, Sharma M, Gibbs JR et al. (2009) Genome-wide association study reveals genetic risk underlying Parkinson’s disease. Nat Genet 41: 1308–1312. doi:https://doi.org/10.1038/ng.487. PubMed: 19915575.
  27. 27. Tan EK, Zhao Y, Skipper L, Tan MG, Di Fonzo A et al. (2007) The LRRK2 Gly2385Arg variant is associated with Parkinson’s disease: genetic and functional evidence. Hum Genet 120: 857–863. doi:https://doi.org/10.1007/s00439-006-0268-0. PubMed: 17019612.
  28. 28. Funayama M, Li Y, Tomiyama H, Yoshino H, Imamichi Y et al. (2007) Leucine-rich repeat kinase 2 G2385R variant is a risk factor for Parkinson disease in Asian population. Neuroreport 18: 273–275. doi:https://doi.org/10.1097/WNR.0b013e32801254b6. PubMed: 17314670.
  29. 29. Li C, Ting Z, Qin X, Ying W, Li B et al. (2007) The prevalence of LRRK2 Gly2385Arg variant in Chinese Han population with Parkinson’s disease. Mov Disord 22: 2439–2443. doi:https://doi.org/10.1002/mds.21763. PubMed: 17960808.
  30. 30. An XK, Peng R, Li T, Burgunder JM, Wu Y et al. (2008) LRRK2 Gly2385Arg variant is a risk factor of Parkinson’s disease among Han-Chinese from mainland China. Eur J Neurol 15: 301–305. doi:https://doi.org/10.1111/j.1468-1331.2007.02052.x. PubMed: 18201193.
  31. 31. West AB, Moore DJ, Biskup S, Bugayenko A, Smith WW et al. (2005) Parkinson’s disease-associated mutations in leucine-rich repeat kinase 2 augment kinase activity. Proc Natl Acad Sci U S A 102: 16842–16847. doi:https://doi.org/10.1073/pnas.0507360102. PubMed: 16269541.
  32. 32. Rudenko IN, Kaganovich A, Hauser DN, Beylina A, Chia R et al. (2012) The G2385R variant of leucine-rich repeat kinase 2 associated with Parkinson’s disease is a partial loss-of-function mutation. Biochem J 446: 99–111. doi:https://doi.org/10.1042/BJ20120637. PubMed: 22612223.
  33. 33. Tan EK, Peng R, Teo YY, Tan LC, Angeles D et al. (2010) Multiple LRRK2 variants modulate risk of Parkinson disease: a Chinese multicenter study. Hum Mutat 31: 561–568. PubMed: 20186690.
  34. 34. Ross OA, Soto-Ortolaza AI, Heckman MG, Aasly JO, Abahuni N et al. (2011) Association of LRRK2 exonic variants with susceptibility to Parkinson’s disease: a case-control study. Lancet Neurol 10: 898–908. doi:https://doi.org/10.1016/S1474-4422(11)70175-2. PubMed: 21885347.
  35. 35. Gasper R, Meyer S, Gotthardt K, Sirajuddin M, Wittinghofer A (2009) It takes two to tango: regulation of G proteins by dimerization. Nat Rev Mol Cell Biol 10: 423–429. doi:https://doi.org/10.1038/nrg2624. PubMed: 19424291.
  36. 36. Lin CH, Wu RM, Tai CH, Chen ML, Hu FC (2011) Lrrk2 S1647T and BDNF V66M interact with environmental factors to increase risk of Parkinson’s disease. Parkinsonism Relat Disord 17: 84–88. doi:https://doi.org/10.1016/j.parkreldis.2010.11.011. PubMed: 21167764.
  37. 37. Liu Z, Lenardo MJ (2012) The role of LRRK2 in inflammatory bowel disease. Cell Res 22: 1092–1094. doi:https://doi.org/10.1038/cr.2012.42. PubMed: 22430149.
  38. 38. Liu Z, Lee J, Krummey S, Lu W, Cai H et al. (2011) The kinase LRRK2 is a regulator of the transcription factor NFAT that modulates the severity of inflammatory bowel disease. Nat Immunol 12: 1063–1070. doi:https://doi.org/10.1038/ni.2113. PubMed: 21983832.
  39. 39. Mosavi LK, Minor DL Jr, Peng ZY (2002) Consensus-derived structural determinants of the ankyrin repeat motif. Proc Natl Acad Sci U S A 99: 16029–16034. doi:https://doi.org/10.1073/pnas.252537899. PubMed: 12461176.
  40. 40. Li X, Tan YC, Poulose S, Olanow CW, Huang XY et al. (2007) Leucine-rich repeat kinase 2 (LRRK2)/PARK8 possesses GTPase activity that is altered in familial Parkinson’s disease R1441C/G mutants. J Neurochem 103: 238–247. PubMed: 17623048.
  41. 41. Lin CH, Tzen KY, Yu CY, Tai CH, Farrer MJ et al. (2008) LRRK2 mutation in familial Parkinson’s disease in a Taiwanese population: clinical, PET, and functional studies. J Biomed Sci 15: 661–667. doi:https://doi.org/10.1007/s11373-008-9260-0. PubMed: 18523869.
  42. 42. Gelb DJ, Oliver E, Gilman S (1999) Diagnostic criteria for Parkinson disease. Arch Neurol 56: 33–39. doi:https://doi.org/10.1001/archneur.56.1.33. PubMed: 9923759.
  43. 43. Nyholt DR (2004) A simple correction for multiple testing for single-nucleotide polymorphisms in linkage disequilibrium with each other. Am J Hum Genet 74: 765–769. doi:https://doi.org/10.1086/383251. PubMed: 14997420.
  44. 44. Abecasis GR, Cookson WO (2000) GOLD--graphical overview of linkage disequilibrium. Bioinformatics 16: 182–183. doi:https://doi.org/10.1093/bioinformatics/16.2.182. PubMed: 10842743.
  45. 45. Stephens M, Smith NJ, Donnelly P (2001) A new statistical method for haplotype reconstruction from population data. Am J Hum Genet 68: 978–989. doi:https://doi.org/10.1086/319501. PubMed: 11254454.