Figures
Abstract
During a study on the mycobiota of brazil nuts (Bertholletia excelsa) in Brazil, a new Aspergillus species, A. bertholletius, was found, and is described here. A polyphasic approach was applied using morphological characters, extrolite data as well as partial β-tubulin, calmodulin and ITS sequences to characterize this taxon. A. bertholletius is represented by nineteen isolates from samples of brazil nuts at various stages of production and soil close to Bertholletia excelsa trees. The following extrolites were produced by this species: aflavinin, cyclopiazonic acid, kojic acid, tenuazonic acid and ustilaginoidin C. Phylogenetic analysis using partial β-tubulin and camodulin gene sequences showed that A. bertholletius represents a new phylogenetic clade in Aspergillus section Flavi. The type strain of A. bertholletius is CCT 7615 ( = ITAL 270/06 = IBT 29228).
Citation: Taniwaki MH, Pitt JI, Iamanaka BT, Sartori D, Copetti MV, Balajee A, et al. (2012) Aspergillus bertholletius sp. nov. from Brazil Nuts. PLoS ONE 7(8): e42480. https://doi.org/10.1371/journal.pone.0042480
Editor: Jose Luis Balcazar, Catalan Institute for Water Research (ICRA), Spain
Received: May 3, 2012; Accepted: July 6, 2012; Published: August 27, 2012
This is an open-access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.
Funding: This research was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo, Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Ministério da Agricultura, Pecuária e Abastecimento, (MAPA) Brazil. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Brazil nuts are one of the most important products extracted from the Amazon rainforest region. Trees of Bertholletia excelsa grow wild, reaching up to 60 meters, take 12 years to bear fruit and may live up to 500 years. The trees are found in groves of 50–100 individuals and the groves are separated by up to 1 km. Pollination is by wild, large bodied bees, especially Euglossinae species [1]. The Amazon rainforest has multiple ecosystems with a huge biodiversity. It has an important role in the global weather balance and is the location of many native peoples. The equatorial climate is hot and humid, with an average temperature of 26°C and relative humidity of 80–95%.
Several studies on the mycobiota of brazil nuts have been carried out. The most commonly isolated species are Aspergillus flavus, A. nomius, A. parasiticus, A. niger, A. tamarii, A. pulverulentus, A. flavo-furcatis, Penicilliumglabrum, P. citrinum, Rhizopus spp. and Fusarium oxysporum [2], [3], [4], [5].
Among these species, a major concern relates to those within Aspergillus section Flavi, because some of them have the potential for aflatoxin production. A major challenge in brazil nut production is controlling the high rate of contamination by species within Aspergillus section Flavi and hence the potential for high aflatoxin production.
The taxonomy of this section is still highly complex and continually evolving. Phylogenetic analysis based on sequence data from β-tubulin and calmodulin genes revealed that Aspergillus section Flavi includes seven main clades (A. flavus clade, A. tamarii clade, A. nomius clade, A. alliaceus clade, A. togoensis clade, A. leporis clade, and A. avenaceus clade), with 20 or more taxa [6]. According to these authors, the main clades are well defined. However, many subclades are represented by a single isolate and further collections and studies are needed to clarify speciation in this section.
During a course of studies on the mycobiota of brazil nuts, a new Aspergillus taxon in Aspergillus section Flavi was found in soil and several brazil nut samples collected at various stages of the production chain. This species is described here as Aspergillus bertholletius sp. nov. It does not produce aflatoxin.
Materials and Methods
Fungal isolation from brazil nuts samples and soil
A total of 290 brazil nut samples (174 nuts and 116 shells) each of approximately 2 kg were collected in the Amazon region and São Paulo State, Brazil. Besides that, 28 samples of soil (each approximately 200 g) were collected from Amazon rainforest close to Bertholletia excelsa trees. The sampling was carried out together with the Brazilian Ministry of Agriculture and all necessary permits were obtained for the described field studies. The taxonomic study is supported by Brazilian Resolution of Genetic Heritage Management Council (MMA/CGEN 21/06).
Approximately 100 g of shelled nuts and 100 g of shells were disinfected separately by immersion in 0.4% sodium hypochlorite solution for 1 min. Fifty pieces of nuts or shells were plated onto Dichloran 18% Glycerol agar (DG18), according to the methodology of Pitt and Hocking [7]. Plates were incubated for 5 days at 25°C.
For soil samples, under aseptic conditions, samples (25 g) were weighed and sterile peptone water (0.1%; 225 ml) was added. Aliquots were serially diluted and spread plated onto Dichloran 18% Glycerol agar. The plates were incubated at 25°C for 7 days, according to Pitt and Hocking [7]. All isolateswith the appearance of belonging to Aspergillus section Flavi were isolated onto Czapek yeast extract agar [7]and incubated at 25°C for 7 days.
Morphological examination
The fungi were examined on standard identification media for Aspergillus species, namely Czapek yeast extract agar (CYA), malt extract agar (MEA), Aspergillus flavus and parasiticus agar (AFPA) and 25% glycerol nitrate agar (G25N) [7] at 25°C and also at 37°C and 42°C on CYA. The incubation time for all media and conditions was 7 days.
The standard conditions used for the description of Aspergillus bertholletius are taken from Pitt and Hocking [7]. Capitalised colours are from the Methuen Handbook of Colour [8].
Molecular analysis
Isolates were cultivated in yeast extract and lactose (YEL) solid medium for seven days. From each culture, a suspension of approximately 107 conidia suspended in Tween 80 (2.5 ml) was inoculated into bottles containing YEL liquid (50 ml), and incubated in a shaker (180 rpm) at 28°C for 16 to 24 h. After incubation, mycelia were collected by vacuum filtration and washed in sterile water. Nucleic acids were extracted according to Azevedo et al. [9], and treated with ribonucleaseA (20 µg/ml). Partial amplification of the ß-tubulin gene was performed using standard amplification reactions and the following primer pair: Bt2a (5′ GGT AAC CAA ATC GGT GCT TTC 3′) and Bt2b (5′ ACC CTC AGT GTA GTG ACC CTT GGC 3′), as described by Glass and Donaldson [10]. Part of the calmodulin gene region was amplified using the cmd5 (5′ CCG AGT ACA AGG AGG CCT TC 3′) and cmd6 (5′ CCG ATA GAG GTC ATA ACG TGG 3′) primers previously reported by Hong et al. [11]. Similarly, the ITS1–5.8S–ITS2 region of rDNA was amplified with the primer ITS1 (5′ TCCGTAGGTGAACCTGCGG3′) and ITS4 (TCCTCCGCTTATTGATATGC3′) [12]. Fragments generated by PCRwere purified with Wizard® SV Gel and PCR Clean-Up System (Promega). The amplicons were submitted to direct sequencing in both directions (forward and reverse) with a Big Dye Terminator Cycle Sequencing Standart kit Version 3.1 (Applied Biosystems, Foster City, Calif., USA) under the following conditions: denaturation at 95°C for 60 s, followed by 30 cycles of denaturation at 95°C for 20 s, annealing at 50°C for 15 s, extension at 60°C for 1.5 min,and a final extension at 60°C for 3 min. A volume of HiDiformamide(10 µL) was added to the sequencing products, which were processed in an ABI 3500XL Genetic Analyser (Applied Biosystems, Foster City, Calif., USA. The sequences obtained were aligned to those type species sequences from Aspergillus section Flavi deposited in the NCBI database (http://www.ncbi.nlm.nih.gov/)using Clustal W [13]. The software package MEGA5 [14] was used to construct a neighbour joining tree [15].
Extrolite analysis
The cultures were analysed by HPLC with diode arraydetection according to the method of Frisvad and Thrane [16] as modified by Houbraken et al. [17]. The isolates were analysed on CYA and YES agar using three agar plugs. Five plugs of each agar medium were taken and pooled into same vial for extraction with 0.75 ml of a mixture of ethyl acetate/dichloromethane/methanol (3∶2∶1) (v/v/v) with 1% (v/v) formic acid.
Nomenclature
1. The electronic version of this article in Portable Document Format (PDF) in a work with an ISSN or ISBN will represent a published work according to the International Code of Nomenclature for algae, fungi, and plants, and hence the new names contained in the electronic publication of a PLOS ONE article are effectively published under that Code from the electronic edition alone, so there is no longer any need to provide printed copies.
In addition, new names contained in this work have been submitted to MycoBank from where they will be made available to the Global Names Index. The unique MycoBank number can be resolved and the associated information viewed through any standard web browser by appending the MycoBank number contained in this publication to the prefix http://www.mycobank.org/MB. The online version of this work is archived and available from the following digital repositories: PubMed Central, LOCKSS.
2. Repository of Aspergillus bertholletius Taniwaki, Pitt & Frisvad 2012 sp. nov. [urn:lsid:mycobank.org: 800125]
Results and Discussion
Of 290 brazil nut samples (nuts and shells), 15 samples showed the presence of Aspergillus bertholletius, with an incidence ranging from 2 to 46% infection after direct plating on DG18. In total, 65 isolates were found from shells and nuts and from soil close to Bertholletia excelsa trees. The origin of the Aspergillus bertholletius isolates is shown in Table 1, and the incidence of A. bertholletius in the samples throughout the brazil nut chain in Table 2. Most samples were not infected by A. bertholletius. However, one sample from a street market in the Amazon region was highly infected, with 46% and 36% of nuts and shells infected. Of 28 samples of soil from areas adjacent to B. excelsa trees, only one was contaminated with A. bertholletius, showing a count of 8.0×103 CFU/g. Isolation of A. bertholletius from brazil nuts and soil may have been underestimated because colonies of A. bertholletius on DG18 are similar to those of A. tamarii. Distinctions were found after incubating isolates on CYA at 37°C, where colonies of A. bertholletius are 5 to 15 mm in diameter, while those of A. tamariii are 50 mm or more in diameter [7]. When cultured on AFPA, A. bertholletius is readily recognised from A. tamarii on AFPA by a cream colony reverse, unlike the dark brown characteristic of A. tamarii. On the other hand, A. bertholletius differs from A. flavus and A. parasiticus which give an orange reverse colour on AFPA due to the production of aspergilic acid or noraspergillic acid which react with ferric ammonium citrate present in the medium [7].
Apart from very slow growth at 37°C, the morphology of strains of A. bertholletius are consistent with placement within Aspergillus section Flavi. However, that striking difference in growth rate at 37°C correlates well with the distinct separation of A. bertholletius from other species in section Flaviin a neighbour joining tree derived from b-tubulin and calmodulin sequences. The nucleotide sequence data of β-tubulin and calmodulin genes matched in showing that the A. bertholletius isolates represent a new phylogenetic clade in Aspergillus section Flavi (Figure 1 and 2). In addition, A. bertholletius was also differentiated from all other known Aspergillus when analyzing the ITS1–5.8S–ITS2 region. A comparison of a 459-bp fragment from this region of A. bertholletius relative to A. pseudotamarii, the taxon with the most similar sequence indicated by BLASTn tool, revealed 6 nucleotide substitutions and 3 insertion/deletions (Figure 3).
Numbers at branch nodes refer to bootstrap values (1000 replicates), only values of >70% are shown. The nucleotide sequence from the type strain of A. bertholletius CCT 7615 ( = ITAL 270/06) has been deposited in the GenBank databases under GenBank accession no. JQ744022.
Numbers at branch nodes refer to bootstrap values (1000 replicates), only values of >70% are shown. The calmodulin nucleotide sequences from the type strain of A. bertholletius CCT 7615 ( = ITAL 270/06) has been deposited in the GenBank databases under accession no. JX 198674.
Metabolite analysis indicated that A. bertholletius does not produce aflatoxins. However, one strain, the ex type strain, CCT 7615, produced O-methylsterigmatocystin, indicating that A. bertholletius may have silent genes for aflatoxin production. All strains produced the mycotoxin cyclopiazonic acid or its precursors and five of 18 strains examined produced the mycotoxin tenuazonic acid. Other metabolites produced were kojic acid (17/18 strains), ustilaginoidin C (9/18 strains) and indole alkaloids (16/18 strains). The isolates exhibited a unique profile of metabolites, consistent with production by an undescribed species.
Aspergillus bertolletius shares the production of cyclopiazonic acid with A. flavus, A. minisclerotigenes, A. oryzae, A. parvisclerotigenus, A. pseudocaelatus, A. pseudotamarii, and A. tamarii. It shares the ability to produce tenuazonic acid with A. caelatus and A. nomius and O-methylsterigmatocystin with all aflatoxin producers. It shares kojic acid with all species in Aspergillus section Flavi, except A. avenaceus [6].
Figure 4 shows the morphology of A. bertholletius colonies on Czapek yeast extract agar and malt extract agar after 7 days incubation at 25°C and the conidial heads.
(a) Colonies on Czapek yeast extract agar and malt extract agar after 7 days incubation at 25°C; (b, c, d) conidial heads, bar = 10 µm; (d) conidia, bar = 5 µm.
Aspergillus bertholletius Taniwaki, Pitt & Frisvad sp. nov. [urn:lsid:mycobank.org: 800125]
Etymology.
Named from the generic epithet of the brazil nut tree Bertholletia excelsa, the known habitat for this species.
Holotype.
CCT 7615 in Coleção de Cultura Tropical (Campinas, Brazil) is designated as the holotype of Aspergillus bertholletius. It was isolated from soil close to Bertholletia excelsa trees, Instituto de Tecnologia de Alimentos, Campinas, Brazil, 2006. Cultures derived from type include ITAL 270/06 (where ITAL is the culture collection of Instituto de Tecnologia de Alimentos, Campinas, Brazil), and IBT 29228 (where IBT is the culture collection of the Technical University of Denmark, Lyngby, Denmark).
Diagnosis.
This species differs from of species in Aspergillus section Flavi by slow growth on CYA at 37°C, linoleum brown conidia en masse, a unique profile of secondary metabolites and a distinct DNA sequence in the region of the ß-tubulin and calmodulin genes.
Description.
Colonies on CYA 60–70 mm in diameter, often almost covering the Petri dish, deep but velutinous; margins entire, narrow; mycelium inconspicuous; conidiogenesis heavy, brown near Linoleum Brown (M. 5E7); exudate and soluble pigment absent; reverse uncoloured to pale brown. Colonies on MEA 60–70 mm in diameter, similar to on CYA, but conidia slightly more green than on CYA, olive brown near Khaki (M. 4D5-E7); reverse pale.
Colonies on G25N 25 mm in diameter, low, often heavily sporing in colours near those on MEA; reverse pale.
Colonies on CYA at 37°C 5–15 mm in diameter, sometimes with brown sporulation.
Conidiophores borne from surface or aerial hyphae, 70–150×6–8 µm, with very thin, smooth walls; vesicles spherical, 10–17(–20) µm in diameter, bearing uncrowded phialides; phialides ampulliform, large and broad, 10–14×5–6(–7) µm; conidia uniform in size and shape, spherical, 5.5–6.5 µm in diameter, with finally spinose walls, borne in long, tangled chains. Sclerotia are not produced on any media.
Other isolates examined.
ITAL 116 ( = CCT 7612), ITAL 259 ( = CCT 7613),ITAL 262( = CCT 7614 = IBT 31739),ITAL 271/06 ( = CCT 7616 = IBT 30618), ITAL 272/06 ( = CCT 7617 = IBT 30617), ITAL 273/06 ( = IBT 30619), ITAL 275/06 ( = CCT 7618 = IBT 29227), ITAL 7157 ( = IBT 31548), ITAL 7179 ( = IBT 31554), ITAL 7180 ( = IBT 31555), ITAL 7189 ( = IBT 31151), ITAL 7191 ( = IBT 31553), ITAL 7192 ( = CCT 7619), ITAL 7193( = IBT 31549), ITAL 7194 ( = IBT 31556), ITAL 7195 ( = IBT 31557), ITAL 7196 ( = IBT 31546) and ITAL 7197( = IBT 31500), all from nuts of Bertholletia excelsa, the brazil nut tree and soil close to the tree.
Conclusion
A. bertholletius represents a new important phylogenetic clade in Aspergillus section Flavi applying a polyphasic approach using morphological characters, extrolite data, β-tubulin and calmodulin partial gene sequences.
Author Contributions
Conceived and designed the experiments: MHT JIP JCF. Performed the experiments: MHT JIP MHF JCF. Analyzed the data: MHT JIP MHF JCF. Contributed reagents/materials/analysis tools: BTI DS MVC AB. Wrote the paper: MHT JIP MHF JCF.
References
- 1. Wadt LHO, Kainer KA, Gomes DAS (2005) Population structure and nut yield of a Bertholletia excelsa stand in southwestern Amazonian. Forest Ecol Manage 211: 371–384.
- 2. Freire FCO, Kozakiewicz Z, Paterson RM (2000) Mycoflora and mycotoxins in Brazilian black pepper, white pepper and Brazil nuts. Mycopathologia 149: 13–19.
- 3. Bayman P, Baker J, Mahoney N (2002) Aspergillus on tree nuts. Mycopathologia 155: 161–169.
- 4. Olsen M, Johnsson P, Moller T, Paladino R, Lindblad M (2008) Aspergillus nomius, an important aflatoxin producer in Brazil nuts? World Mycotoxin J 123–126.
- 5. Gonçalves JS, Ferracin LM, Vieira MLC, Iamanaka BT, Taniwaki MH, et al. (2012) Molecular analysis of Aspergillus section Flavi isolated from Brazil nuts. World J MicrobiolBiotechno l28: 1817–1825.
- 6. Varga J, Frisvad JC, Samson RA (2011) Two new aflatoxin producing species, and an overview of Aspergillus section Flavi.. Stud Mycol 69: 57–80.
- 7.
Pitt JI, Hocking AD (2009) Fungi and Food Spoilage. 3rd edn. New York: Springer.
- 8.
Kornerup A, Wanscher JH (1978) Methuen Handbook of Colour. London: Eyre Methuen.
- 9. Azevedo ACS, Furlaneto MC, Soza-Gomez DR, Fungaro MHP (2000) Molecular characterization of Paecilomyces fumosoroseus (Deuteromycotina Hyphomycetes) isolates. SciAgric 57: 729–732.
- 10. Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous Ascomycetes. Appl Environ Microbiol 61: 1323–1330.
- 11. Hong SB, Cho HS, Shin HD, Frisvad JC, Samson RA (2006) Novel Neosartoryaspecies isolated from soil in Korea. I J SystEvolMicrobiol 56: 477–486.
- 12.
White TJ, Burns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds.) PCR Protocols: A guide to methods and applications, Academic Press, San Diego, pp 315–322.
- 13. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acid Res 22: 4673–4680.
- 14. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, et al. (2011) MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecul Biol Evol 28: 2731–2739.
- 15. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecul Biol Evolut 4: 406–425.
- 16. Frisvad JC, Thrane U (1987) Standardized high performance liquid chromatography of 182 mycotoxins and other fungal metabolites based on alkylphenone retention indices and UV-VIS spectra (diode array detection). J Chromatogr A404: 195–214.
- 17. Houbraken J, Spierenburg H, Frisvad JC (2012) Rasomsonia, a new genus comprising thermotolerant and thermophilic Talaromyces and Geosmithia species. Antonie van Leeuwenhoek 101: 403–421.