The authors have declared that no competing interests exist.
Conceived and designed the experiments: BL LR CL. Performed the experiments: CL YH MP YY. Analyzed the data: CL MP SL LL. Contributed reagents/materials/analysis tools: CL TS WZ XW. Wrote the paper: CL YH LL.
Tissue engineering has brought new possibilities for the treatment of spinal cord injury. Two important components for tissue engineering of the spinal cord include a suitable cell source and scaffold. In our study, we investigated induced mouse embryonic fibroblasts (MEFs) directly reprogrammed into neural stem cells (iNSCs), as a cell source. Three-dimensional (3D) electrospun poly (lactide-co-glycolide)/polyethylene glycol (PLGA-PEG) nanofiber scaffolds were used for iNSCs adhesion and growth. Cell growth, survival and proliferation on the scaffolds were investigated. Scanning electron microcopy (SEM) and nuclei staining were used to assess cell growth on the scaffolds. Scaffolds with iNSCs were then transplanted into transected rat spinal cords. Two or 8 weeks following transplantation, immunofluorescence was performed to determine iNSC survival and differentiation within the scaffolds. Functional recovery was assessed using the Basso, Beattie, Bresnahan (BBB) Scale. Results indicated that iNSCs showed similar morphological features with wild-type neural stem cells (wt-NSCs), and expressed a variety of neural stem cell marker genes. Furthermore, iNSCs were shown to survive, with the ability to self-renew and undergo neural differentiation into neurons and glial cells within the 3D scaffolds
Neural functional recovery after spinal cord injury (SCI) has, for many years, been a difficult problem to overcome [
Cells can provide new neurons to form new neural circuits and also secrete cytokines promoting the regeneration of the spinal cord axon [
Another important aspect of tissue engineering is choosing an appropriate scaffold for seeding cells into for their adherence and growth. A biocompatible and biodegradable scaffold is key for tissue engineering to treat SCI [
All experimental protocols and animal handling procedures were approved by the Animal Care and Use Committee of Sun Yat-sen University (Approval Number: SYXK2012-0083), and were consistent with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Pregnant CD-1 mice were obtained from Beijing Vital River Experimental Animal Technology Co., Ltd. SD rats were supplied by Shanghai Slaccas laboratory animal co., Ltd.
Dulbecco’s Modified Eagle Medium (DMEM) high glucose powder (13.4g, GIBCO) and sodium bicarbonate (3.7g) were dissolved in 500ml double diluted H2O (ddH2O) for preparation of 2×DMEM. 2×DMEM was sterilized through a 0.22μm filter. For preparation of 1% agarose solution, agarose G-10 (BIOWEST) was dissolved in ddH2O and heated until boiling in a microwave. Pre-warmed 2×DMEM medium and 1% agarose solution were mixed equally and added to a cell culture dish. The mixture of agarose and DMEM formed a 5mm thick layer of 0.5% gel when the solution cooled down.
MEFs were isolated from E13.5–14.5 day CD-1 mouse embryos. Embryos were washed in phosphate buffered saline (PBS) three times. Embryo heads, limbs and spinal cords were carefully removed. The remaining embryos were cut into 1mm3 pieces. These pieces were then incubated in 0.25% trypsin with 1mM EDTA solution for 10 min. An equal amount of DMEM (GIBCO) with 10% fetal bovine serum (FBS) was added after incubation. Trypsinized tissues were left for 10 min at room temperature and then the supernatant was transferred into a new collection tube. Cells were harvested by centrifugation at 300g for 10 min and resuspended in DMEM with 10% FBS. MEFs were cultured at 37°C with 5% CO2. Passage 2‒3 (P2-3) MEFs were used for reprogramming.
WT-NSCs were isolated from E13.5–14.5 day CD-1 mouse embryos. Embryos were washed in phosphate buffered saline (PBS) for three times. Brains were separated and coronal blocks between rhinal fissure and hippocampus were isolated. The blocks was laid in a new dish and two parasagittal cuts were made by razor blade just lateral to the lateral ventricles. A horizontal cut was made to remove the tissue above the corpus callosum. This procedure leaves a small, rectangular chunk of tissue surrounding the lateral ventricles containing a high density of NSCs. Then, the tissue were washed in PBS for three times before cut into 1mm3 pieces. These pieces were then incubated in 0.25% trypsin with 1mM EDTA solution for 5 min at 37°C. An equal amount of DMEM (GIBCO) with 10% fetal bovine serum (FBS) was added to neutralize trypsin. Trypsinized tissues were left for 10 min at room temperature and then the supernatant was transferred into a new collection tube. Cells were harvested by centrifugation at 300g for 10 min and resuspended in DMEM/F12 supplement with B27 and N2 (Invitrogen) supplements, 20 ng/ml basic fibroblast growth factor (bFGF; PeproTech) and 20 ng/ml epidermal growth factor (EGF; PeproTech). WT-NSCs were cultured at 37°C with 5% CO2. Passage 5–8 WT-NSCs were used for further experiment.
The pMXs-Sox2 and pMXs-GFP plasmids were gifts from the Center for Stem Cell Biology and Tissue Engineering of Sun Yat-sen University. The Platinum E retroviral packaging cell line was kindly provided by the Cell-Gene Therapy Translational Medicine Research Center, the Third Affiliated Hospital of Sun Yat-sen University. Retroviruses were generated according to the recommendation of the manufacturer. P2-3 MEFs were seeded on a new dish one day before infection. MEFs were then transduced with Sox2 retrovirus for 24 h and cultured in MEF medium (DMEM+10%FBS). After infection (48 h), MEFs were collected and cultured in induction medium (DMEM supplemented with 15% FBS, 1mM L-glutamin, 1mM sodium pyruvate, 0.1mM nonessential amino acids (NEAA), 1× penicillin/streptomycin, 0.1mM β-mercaptoethanol (GIBCO) and 1000 units of recombinant leukemia inhibitory factor (LIF, Millipore) on prepared low-attachment dishes. The medium was changed every other day. After 7 days of reprogramming, cells were collected and seeded on gelatin-coated dishes. On reaching confluence, cells were collected and cultured on low-attachment dishes to form neurospheres. After three rounds of neurosphere formation, NSC-like cells were cultured and passaged in suspension culture. Then iNSCs were transduced with GFP retrovirus for 24 h and cultured in suspension culture for further experiment.
2×104 iNSCs was seeded onto gelatin-coated glass coverslips in 24-wells plates with NSCs medium (DMEM/F12 supplement with B27 and N2 (Invitrogen) supplements, 20 ng/ml basic fibroblast growth factor (bFGF; PeproTech) and 20 ng/ml epidermal growth factor (EGF; PeproTech). The culture medium was changed into NSC differentiation medium (DMEM/F12 supplement with 5% FBS, 1μmol/L RA, 1mM L-glutamin, 1mM sodium pyruvate, 0.1mM NEAA, 1× penicillin/streptomycin (GIBCO) 24h later and cultured for 7–14 days with a medium change of every other day.
For immunofluorescence analyses, cells were fixed in 4% paraformaldehyde (Wuhan, Boster Biotech Co., Ltd., China) at 4°C for 10min. Then washed with PBS (Wuhan, Boster Biotech Co., Ltd., China) for three times, and incubated in blocking solution (6% fetal bovine serum(FBS), Life technologies) in PBS with 0.1% Triton X-100 (Sigma) for 1h at room temperature. The cells were then incubated with primary antibodies overnight at 4°C. Primary antibodies consisted of Nestin (ms IgG, 1:200; Abcam), MAP2 (rb IgG, 1:1000; Millipore), GFAP (rb IgG; 1:200; Santa Cruz), MBP (ms IgG; 1:200; Santa Cruz). Next morning, the cells were washed with PBS for three times and further incubated with secondary Alexa488- or Alexa555-labeled antibodies (1:400; Life technologie) for 60min at room temperature. Nuclei were detected by Hoechst 33342 (Sigma) staining. Micrographs were taken with a fluorescence microscope (Leica, Germany).
Total RNA was isolated from cultured cells using Trizol (Invitrogen). One microgram of total RNA per sample was reverse transcribed using the Reverse transcription Kit (Takara) and the cDNA was diluted with 80μL of water. The diluted cDNA was used for quantitative PCR with MaximaTM SYBR Green/ROX qPCR Master Mix (Thermo). All qPCR reactions were done in triplicate, and all expression data were normalized to GAPDH expression. All primer sequences are listed in
GENE | Accession Numbers | Forward primer | Reverse primer |
---|---|---|---|
Blbp | S69799.1 | CGCAACCTGGAAGCTGACA | GCCCAGAGCTTTCATGTACTCA |
Ascl1 | NM_008553.4 | TCGTCCTCTCCGGAACTGAT | TAGCCGAAGCCGCTGAAGT |
Zfp42 | NM_009556 | CCGGGATGAAAGTGAGATTAGC | TCACCTCGTATGATGCACTC |
GAPDH | NM_008084 | AGGTCGGTGTGAACGGATTTG | GGGGTCGTTGATGGCAACA |
Nestin | NM_016701 | GCAGAGTCCTGTATGTAGCCAC | AGAGTCAGATCGCTCAGATCC |
Pax6 | NM_013627 | GTTGTGTGAGTAAAATTCTGGGC | GAGTCGCCACTCTTGGCTTA |
Nanog | NM_028016 | CACAGTTTGCCTAGTTCTGAGG | GCAAGAATAGTTCTCGGGATGAA |
iNSC-derived neurons were tested on a microscopic workbench with a patch clamp. Neurons were immersed in extracellular fluid containing 95% O2 and 5% CO2 during the whole process. Cells were visualized using an OLYMPUS patch clamp microscope. Medium-sized neurons with a bright cell margin and smooth surface were selected for patch clamp analysis. Neurons were inserted into the clamp and stimulated by an electric current and data were recorded using and AXON MultiClamp 700B amplifier and Igor 5.0 software.
PLGA (75:25) and PEG (molecular weight 4000) were dissolved in hexafluoroisopropanol according to the proportion (15% and 1.5%), then placed in the 5mL plastic syringes with 0.4mm needles. The scaffolds were fabricated at an applied voltage of 15 kV with a voltage regulated DC power supply (DW-P203-1ACFD, Tianjin Dongwen High Voltage Power Supply Plant, China), and at a feeding rate of 1.0 mL/h. The distance between the collector and the needle was 12cm. Electrospun PLGA-PEG nanofibrous scaffolds were collected from receiving screen surface. Same method was used to produce electrospun PLGA nanofibrous scaffolds.
Cell viability on PLGA-PEG scaffolds was evaluated by Cell Counting Kit-8 (Nanjing, KeyGEN Biotech Co., Ltd., China) according to the manufacturer’s procedure. Briefly, after cultured for 2 days, 100μl CCK-8 solution was added to each well (n = 3) and OD of the solution was measured at 450 nm (Elx800, Biotek, USA) after incubated for 2 h at 37°C.
iNSCs (1×104 per well) were seeded onto PLGA-PEG scaffolds in 96-well plates. After incubation for 3, 6 and 9 hours at 37°C, scaffolds were washed in PBS for three times to remove the cells that did not adhere to the scaffolds. The remaining cells were collected with 0.25% trypsin with EDTA and counted under inverted optical microscope (NIKON TS100, Japan).
Cell proliferation in scaffolds was evaluated by Cell Counting Kit-8 (Nanjing, KeyGEN Biotech Co., Ltd., China) 1, 2, 3, 5, 7, and 9 days after seeding. Scaffolds were incubated with CCK-8 solution for 2 h at 37°C and OD of the solution was measured at 450 nm with the 96-well plates (Elx800, Biotek, USA). The proliferation curve of iNSCs on scaffolds was drawn.
Scaffolds were fixed in 2.5% glutaraldehyde overnight at 4°C, and washed with PBS for three times, then dehydrated with a series of graded ethanol and freeze dried for 2 days. The dried samples were covered with gold using sputter coating (IB5 ion coater, EIKO, Japan). And the cell morphologies were observed with SEM (Quanta 200, FEI, USA).
Gelatin sponge (GS) and PLGA-PEG film were used to assemble the 3D scaffolds (
GS and PLGA-PEG film were used to assemble 3D PLGA-PEG scaffolds (A). PLGA-PEG film and GS were rolled together into a cylinder of 4mm diameter (B). The cylinder was cut transversely into 2 mm long cylinders (C).
1×106 iNSCs were seeded on each 3D scaffold. After cultured for 7 days, cell distribution and survival within 3D scaffolds were evaluated after Hoechst33342 staining and calcein-AM/PI staining respectively. 10 μg/ml Hoechst33342 (Sigma), 2μmol/L calcein-AM and 4μmol/L PIwas added for nuclei staining, live cell staining and dead cell staining respectively. After incubation, scaffolds were washed with PBS for three times. Then scaffolds were fixed with 4% paraformaldehyde for 10 min before frozen section was performed. Peripheral and central parts of the scaffolds were chosen to evaluate the distribution and survival within 3D scaffolds. Sections were examined with fluorescence microscope (Leica, Germany).
Thirty adult female SD rats (220g-250g, supplied by Slaccas laboratory animal co., LTD, Shanghai) were divided into three groups: PLGA group (n = 10), PLGA-PEG group (n = 10), and SCI group (n = 10). The rats were anesthetized with 10% chloral hydrate (0.3ml/100g) before surgery. The spinal cord was transected after laminectomy at T10-11 level (
Spinal cord was transected after laminectomy at T10-11 level (A). A 2-mm spinal cord segment completely removed at T10 spinal cord level (B). Then, the 3D scaffolds of 2.0 mm in length with iNSCs were transplanted to the gap (C).
For postoperative care, the bladder was emptied manually twice a day for 2 months. And all rats received intramuscular injection of penicillin (50,000 U/kg/day) for 3 days in order to prevent infection. Cyclosporine (10mg/kg/day) was used for the suppression of the immune rejection.
1 week and 2 months after operation, rats were sacrificed for tissue processing. All rats were anesthetized with 10% chloral hydrate before perfused transcardially with saline containing 0.002% heparin and 4% paraformaldehyde in 0.01M PBS (pH 7.4). The spinal cord were dissected and postfixed in 4% paraformaldehyde at 4°C for 24h, and then placed in 30% phosphate buffered sucrose at 4°C for 48h. Last, the spine cords were embedded in the optimum cutting temperature (OCT) compound (Sakura) and frozen in -80°C refrigerator before frozen sections. All spinal cord slices were cut at 10μm thickness.
Spinal cord sections of each group were stained with Hematoxylin and eosin (H&E) for cavity assessment. One in every five of the whole series of sections from each animal was selected for cavity areas analyses. The cavity areas of the spinal cord were analyzed by Image-Pro Plus software (Media Cybernet-ics, Silver Spring, MD). Cavities within 3 mm rostral or caudal to the graft site were measured, and those with a diameter less than 50μm were excluded. The total areas of all the cavities in every section were averaged for every experimental case. Measurement of cavity area was conducted blindly.
Basso, Beattie, and Bresnahan (BBB) locomotor scale were used for the assessment of hindlimb locomotor recovery after SCI for all animals. Score ranges from 0 (no hindlimb movement) to 21 (normal hindlimb move). All observers were blinded to the operation procedure of the rats. And the test was performed one day post-operation and once every week up to the eighth week after operation.
Data were represented as means±SDs. All statistical analyses were performed using the statistical software SPSS13.0. The data were analyzed using a student t-test when two group of data were compared, and one-way analysis of variance (ANOVA) was used when three group of data were compared. The significant level was set at 0.05.
MEFs were cultured in monolayer before induction (
MEFs in monolayer culture for 7 days, no significant morphological change was observed (A). MEFs in low-attachment culture for 7 days, neurosphere-like clones were formed (B). iNSCs morphology was maintained over prolonged passaging at P8(C) and P20 (D) iNSC were similar to that of wt-NSCs. Scale bars = 200μm (A, C, D), 400μm (B).
The reprogrammed NSC-like cells expressed NSC makers, including nestin and Pax6 (
NSC markers were assessed by immunofluorescence, including Nestin (A) and Pax6 (B). Scale bars = 100μm (A, B).
QRT-PCR revealed that expression of typical NSC-related genes dramatically increased on the 7th day of induction compared to MEFs (A) and iPSCs (B) with negligible expression of pluripotency-related genes (D). Furthermore, iNSCs were similar to wt-NSCs in terms of expression of NSC-specific genes (C).
Next, we evaluated the differentiation potential of iNSCs into neurons, astrocytes and oligodendrocytes. When iNSCs were cultured onto gelatin-coated dished in the absence of epidermal growth factor (EGF) and fibroblast growth factor (FGF), but in the presence of FBS and retinoic acid, they exhibited neural lineage cell-like morphology on the 7th day (
Differentiated cells gradually migrated from neurospheres two days after adherence (A). Seven days later, neurites and differentiated cells were observed around the adherent iNSCs (B and C). Scale bars = 200μm (A), 100μm (B).
Neurons, oligodendrocytes, and astrocytes were assessed by immunofluorescence for Tuj1 (A), MAP2 (B), GFAP (C), and MBP (D). Scale bars = 100μm (A, C), 200μm (B, D).
In addition, the resulting neurons exhibited functional membrane properties. Whole-cell patch-clamp recordings were performed after 3 weeks of differentiation and 65.2% of the cells we detected showed action potentials (
The neurons differentiated from iNSCs exhibited functional membrane properties. Whole-cell patch-clamp recordings showed action potentials of iNSCs-derived neurons (B) which is similar to wt-NSCs (A).
iNSC cell viability on the seventh day in both the PLGA and PLGA-PEG group were not significantly different compared with the blank (
Cell viabilities of iNSCs in both PLGA and PLGA-PEG group were no significant differences than blank (A). Cells adhesion rates on PLGA-PEG scaffolds were significantly higher than those of PLGA scaffolds at each time point (P<0.05) (B). And for the detection of cell proliferation, the numbers of iNSCs in PLGA-PEG group were significantly higher than that of PLGA group (P<0.05) (C).
The morphometric SEM results indicated that iNSCs differentiated into neural cells, which grew well on both kinds of electrospun nanofibers (
PLGA (A) and PLGA-PEG (B) nanobifers were observed by SEM. The results indicate that iNSCs differentiated into neural cells and neuritis grew better on PLGA-PEG electrospun nanofibers (D) compared to PLGA nanofibers (C). Hoechst staining shows normal morphology and quality of nuclei, no obvious cellular apoptosis or necrosis in PLGA-PEG groups (F). Besides, both of SEM and nuclei staining showed the cell population grew on PLGA-PEG scaffold was larger than that of PLGA scaffold (P<0.05 Student t-test, n = 5) (G). Scale bars = 50μm (E, F).
Hoechst33342 staining of sections was performed to determine the distribution of iNSCs within the 3D scaffolds. Central and peripheral scaffold sections were examined and there was no significant difference in cell number between these areas (cell numbers per counting area (0.5×0.6 mm2): 280.2±43.23 vs. 267.6±38.53/counting area, p>0.05, Student t-test, n = 5). The above results showed that iNSCs were distributed evenly within the 3D scaffolds (
On the seventh day, iNSCs that are stained with Hochest33342 were distributed evenly in peripheral (A) and central part (B). Furthermore, survival percentage of iNSCs on the seventh day in peripheral (D) and central part (E) showed no significant difference. NS indicate no significant difference between peripheral and central part (C, n = 5). Scale bars = 200μm (E, F).
We performed immunostaining through the spinal cord lesion to assess the survival and differentiation of iNSCs i
Two week after transplantation, Nestin-positive iNSCs (A), Tuj1-positive neurons (B) and GFAP-positive glial cells (C) were observed in graft site and surrounding spinal cord in PLGA-PEG group. Scale bars = 200μm (A-C).
8 weeks after transplantation, we can still see abundant MAP2/GFP-positive cells in PLGA-PEG group (B). However, only a small amount of GFP-positive cells was observed in PLGA group (A). Quantitative analysis revealed the numbers of GFP+ cells in PLGA-PEG group were significantly greater than PLGA group in 2 weeks and 8 weeks post-transplantation (P<0.05, Student t-test, n = 5) (C). Scale bars = 100μm (E, F)
Eight weeks post-operation, grafts integrated better with the host tissue of the spinal cord by bridging rostral and caudal stumps in the PLGA-PEG group compared with the PLGA group (
The PLGA and PLGA-PEG nanofibers both contributed to tissue structural integrity, whereas a large gap in the lesion site was still present in the control group (A). In both of PLGA and PLGA-PEG group, cavity areas were reduced compared with control group (B). The smallest cavity area was observed in PLGA-PEG group. However, larger cavities were observed in the PLGA group (P<0.05, Student t-test, n = 3) (C).
Behavioral analysis was performed using the Basso, Beattie, Bresnahan (BBB) Scale. Immediately after operation, BBB scores of all rats were nearly 0, indicating SCI model success. From 2 to 6 weeks post-operation, rapid functional recovery of rats was observed in the PLGA and PLGA-PEG groups. However, significant increase of the BBB score was observed in the control group. The results showed that functional recovery was improved in both the PLGA and PLGA-PEG groups. Notably, functional recovery of the rats in the PLGA-PEG group was better than in the PLGA group (
The functional recovery was improved in both of PLGA and PLGA-PEG group (*, P<0.05, one-way ANOVA, n = 10)). Notably, the functional recovery of the rats in PLGA-PEG group was better than PLGA group (#, P<0.05, one-way ANOVA, n = 10).
SCI is a severe disease resulting in functional damage and sensory loss [
In recent years, the rapid development of tissue engineering has promoted the invention and improvement of tissue engineering in spinal cord regeneration [
SCI is a very complicated disease involving multiple factors. In our study, we only carried out preliminary study on the cell-seeding source and scaffold materials. However, there remain many problems and difficulties that need to be investigated and overcome. To provide adequate cells, the induction efficiency of iNSCs needs to be improved significantly. Moreover, Sox2-retrovirus was used to trigger reprogramming, which could pose a safety risk. Therefore, an efficient non-viral induction method needs to be investigated.
We thank Dr. Peng Xiang for plasmids, Dr. Qi Zhang for Plat-e cell line, Miss. Cong Du, and members of Cell-gene Therapy Translational Medicine Research Center for help and discussion.