MAB and AMJ are employees of IDT; AS and TIN are employees of Alnylam Pharmaceuticals. DP has financial interest in Quiet Therapeutics. The remaining authors declare no competing financial interests.
Conceived and designed the experiments: SW RE DP. Performed the experiments: SW RE. Analyzed the data: SW RE DP. Contributed reagents/materials/analysis tools: AA AN MAB AMJ AS TIN. Wrote the paper: SW RE DP.
Mantle cell lymphoma is characterized by a genetic translocation results in aberrant overexpression of the CCND1 gene, which encodes cyclin D1. This protein functions as a regulator of the cell cycle progression, hence is considered to play an important role in the pathogenesis of the disease. In this study, we used RNA interference strategies to examine whether cyclin D1 might serve as a therapeutic target for mantle cell lymphoma. Knocking down cyclin D1 resulted in significant growth retardation, cell cycle arrest, and most importantly, induction of apoptosis. These results mark cyclin D1 as a target for mantle cell lymphoma and emphasize the therapeutic potential hidden in its silencing.
Mantle cell lymphoma (MCL) is an incurable B cell non-Hodgkin's lymphoma, characterized by the t(11; 14)(q13; q32) translocation that juxtaposes the proto-oncogene CCND1, which encodes cyclin D1 (cycD1), downstream of the immunoglobulin heavy chain gene promoter. This leads to overexpression of cycD1, which is not expressed in normal B cells
The overexpression of cycD1, together with its established role as cell cycle progression regulator, highlight cycD1 as a potential central player in the pathogenesis of MCL
In this study, we aimed to validate cycD1 as a therapeutic target for MCL. We down regulated cycD1 in two model cell lines: Granta-519 and Jeko-1. Electroporating these cells with two different RNAi strategies, cycD1-siRNA (siD1) and cycD1-dicer substrate (dsD1), which were designed to specifically target different regions of the CCND1 mRNA, resulted in significant decrease in CCND1 mRNA and cycD1 protein levels (
(A) RT-qPCR analysis of CCND1 mRNA levels 48 h post electroporation in Granta-519 and Jeko-1 cells. Expression was normalized to both house keeping genes eIF3a and eIF3c and depicted as mRNA concentration relative to siLuc electroporated cells. Data are demonstrated as the mean ± SEM of three independent experiments. Significance strength was evaluated using one tailed ANOVA. * indicates p value <0.001. (B) Representative Western Blot analysis of cycD1 expression 48 h post electroporation. α-Tubulin was used as a loading control. § indicates cycD1b isoform.
(A) Proliferation rates of the untreated (mock), siLuc, siD1 and dsD1 electroporated Granta-519 and Jeko-1 cells as determined by the XTT cell proliferation assay, 7d post 1st electroporation (5d post the 2nd one). The results are demonstrated as percentage of cell growth in comparison to the siLuc electroporated cells. (B–C) Cell cycle distribution of mock, siLuc, siD1 and dsD1 electroporated Granta-519 (B) and Jeko-1 (C) cells, 72 h post 1st electroporation (48 h post the 2nd one). (i) Representative cell cycle histograms analysis, applied with the Dean-Jett-Fox model, using FlowJo™ software. (ii) Cell cycle distribution, demonstrated as percentage of cells in each phase. (D–E) apoptosis of mock, siLuc, siD1 and dsD1 electroporated Granta-519 (D) and Jeko-1 (E) cells, 8d post the 1st electroporation (6d post the 2nd one). (i) Representative dot-blot analysis using FlowJo™ software. Early apoptosis is demonstrated on cells labeled with Annexin V, while late apoptosis is demonstrated by Annexin V and PI labeled cells. (ii) Percentage of total apoptotic cells (divided into early and late fractions). All data are represented as the mean ± SEM of three independent experiments. Significance was evaluated using one tailed ANOVA. * indicates p value <0.001.
Manipulating the expression of cycD1 in MCL cells, using different strategies and compounds, has been shown previously to reduce cells' viability and survival indexes
The therapeutic potential of cycD1 in MCL was revealed due to the rapid and potent silencing achieved with our screened RNAi sequences. It is worth mentioning that the relevance of selective cycD1 silencing has been questioned before
The therapeutic advantage of silencing cycD1 in MCL is emphasized when taken into consideration the results presented in this study together with two recently published studies
Granta-519 and Jeko-1 cells were purchased from the American Type Culture Collection (ATCC) and cultured as recommended.
siRNA sequences against the CCND1 gene NM_053056 (siD1, sense strand: GUAGGACUCUCAUUCGGGATT) and the luciferase gene as a control sequence (siLuc, sense strand: CUUACGCUGAGUACUUCGA) were designed and screened by Alnylam Pharmaceuticals (Cambridge MA, USA). Dicer-substrate (DsiRNA) against the CCND1 gene (dsD1, sense strand: GGAGCAUUUUGAUACCAGAAGGGAA) was designed and screened by Integrated DNA Technologies (IDT, Coralville, IA, USA). The screening was based on silencing efficacy and specificity.
1 nmole of each of the RNA duplexes (siLuc/siD1/dsD1) were electroporated into 10x106 Granta-519 or Jeko-1 cells using the Amaxa 4D-nuclefactor system (CM-119 program, SF solution). To maintain the expression of cycD1 low for longer period of time, a 2nd electroporation was preformed 48
Total RNA was isolated using EZ-RNA kit (biological industries, Israel) and cDNA was generated with high capacity cDNA kit (Life Technologies, Carlsbad, CA, USA) according to the manufacturers' protocols. qRT-PCR was performed with Fast SYBR® Green Master Mix and the ABI StepOnePlusTM instrument (Life Technologies). CCND1 (F:GAGGAGCCCCAACAACTTC C, R:GTCCGGGTCACACTTGATCAC) expression was normalized to the house keeping genes eIF3a (F:TCCAGAGAGCCAGTCCATGC, R:CCTGCCACAATTCA TGCT) and eIF3c (F:ACCAAGAGAGTTGTCCGCAGTG, R:TCATGGCATTACG GATGGTCC). Analysis was done with the StepOneTM software V 2.1 (Life Technologies) using the multiple endogenous controls option. When using multiple endogenous controls, the software treats all endogenous controls as a single population, and calculates the experiment-appropriate mean to establish a single value against which the target of interest is normalized.
Western blots were performed as described previously
Following a 2nd electroporation, cells were seeded onto 96 wells plate (1×105 cells per a well, 6 wells for a condition).
For cell cycle analysis, 5×105 cells were collected 72
The results are represented as the mean ± SEM of three independent experiments. One tailed ANOVA was preformed to estimate the significance strength of the results.
(TIF)
(TIF)
(TIF)
(TIF)
(TIF)