Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

< Back to Article

DNA-Interactive Properties of Crotamine, a Cell-Penetrating Polypeptide and a Potential Drug Carrier

Figure 6

Dependence of binding affinity on oligonucleotide sequence.

A. Fluorescence titration in the standard buffer with 0.01 M NaCl: ◯, d(ATGTGGAAAATCTCTAGCAGT) (21+); ▴, d(ACTGCTAGAGATTTTCCACAT) (21-); ▪, duplex (21+/−). B. NaCl-induced reversal.

Figure 6

doi: https://doi.org/10.1371/journal.pone.0048913.g006