Reader Comments

Post a new comment on this article

Virus Sequences

Posted by charlesrunckel on 10 Jun 2011 at 03:42 GMT

Hello everyone,

It seems that Genbank will not be releasing the sequences for the viruses until after the weekend. I'm pasting them below in case anyone needs them before them. My apologies, and please let me know if you have any questions regarding them.

Charles Runckel
DeRisi Lab - UCSF


>HQ871931 Lake Sinai virus 1 Orf1, RNA-dependant RNA polymerase, and capsid protein genes, complete cds
GGGAAGUUUACAGGCGUACGACUUCUUAGCAUCGGUUUCAUGUGGUUACUGGUAAUUGGCCGCAGGUCAUCCCACACAUCAUGGUUAAGCUUGCGUUUGCCGCCUUUGUGUCUCUUUACAUCAUAUGUCAGGUUCCUCCUAUUUCCUAUUGGAUUGAGGAUCUCAUUGAUGAUUUUGAUACAAUGUGCAGUCAUGAGUACGCUGCCGCAGAUGCUUACAAUAACUUCGUUCACAGACACCGCGUUGCUGCCUAUGCUGCUGGCGUGCGUAUCCACCGUUACCGCACGCCGUGGUAUUGCGCCGCGUCACGGUCUGUUCCGGUCGUCCAUCCUCUUAACUGGUUGAUGACCCAGUACGAUCUUACUACUGGCCAUGUUCGUGAAUUACUGGAUCGACUGGAGGUUGUCAAUGUUACCCUUCGUGAUGGCCUCCGCACUGUUGCUGACACUGCGUUUACAGCUUAUAUGUACUAUCAGAUAAUGUGGUGUCAGCUCGCACUGAUUGUGCUGCUUGUUGGCUUGUUCUCUGCCAUCAUAUGCUCCAGUCGUGUUAGGGUUGUCAGAGUGCGCAACCGUGUUCGAGGUUAUUCGAUCACCGAUUUGCGUAAUGAGUUUGAUGAAUCCACCUCGGACAUCACGUUGCCCCUGUCACGUGGUCACUCUUGCCUCAAUUUCCAGCGCCGUGUGGCCGAGUCCUGGUGCUUGGAUCAGUUGCUGCGUUAUUUCCAUGGUGUGCGUUUCAUCUCUGCCUCCACGGGACGGUGGGCCGAGCUUGGCCAUCGAAUUCACAGGUGCUCGCCGGUCGUCAUGGAUGGCUCUUUUGUCCCUGAGGCCACGCAUCAUGGCGUGUUGUGCCGGCGCCAGCCGUCUGCUUGCCGUGAUAGGUUUGAAAUUCCUGCGUGUGUUAUCAGUCAUGCUGAUUAUUACAUGUCGCCUGACCAGUUGGCCUCCACGGUUACUGGCCCCACCUUCAUUAUCAACCAUGACUACCUUGCCCCUGACUCAUUGUCUGUGGCUGAAGCCACAACUCGUGUCGCCAACGGCCAUGUUACUUCUUCAGUGCGUGAGGGGCCAAUUUAUGGGCCGCACCCGUAUUAUUUGUGGAAUAACGAGGGAGUUGUCGUGUCCUCUGCAGGCGCAUUCCGUUACUAUCGCGUUGGCCGCCUGUUUGACACCUCCGUGUAUUAUGCGUUUCCUGCUGCCGGUACGUAUUCUUGUGAUGACUCCACGAACUUGCGUAGGUCCACGGUUGGCGACCUUCAUUACUAUUCCCCUCAUGAAAAGAAAUUUGUUAGUUACUCAGCCGAUGACACGAACUACCAUGUGUUCGGCACGUCGGUGCCAAGGUCUCUUGCUGACUACUGCGCUGCAACCUUCUGCCGUUCUGCCCGUGACGACAAAUUUUAUGACGGACUAAGAUCUUAUUAUCAGAACAGGUGCAGAGCAAUUGGAUUCACCGAUGCCCGUGAUACCCUUAUUUUGGACUUCAUUAUCCAUCUGUGUGACGAGGCCAGUCUGAAGACCUUCGGUUUCUCCCGACUUUCCGUCGCACCAUCUUCUUGGACCGCUUAUUGUCUCUCGUGGCUUCUCGUCAAAGUGAACCACAUGAUGCCCCUGGCGCUCACGUCGUUUGUCGUUAGCGCUCUCCAUCGGUUCUUUGGGGCCAAGUCAGCCCCGUGGAACUGGGCAUCGAUUCACUUGCCCACGUAUGAUAUGGUCACGUCGCCUUUCCGUUUGCGUAUGUUCGGUCGUAACCCCACCACAUUCAAUCUGGAGCGAUUUCGUGCUGAGGCCUCGACUGUUGGUGCCCCCAGUCCUGGCCAGUCUGCCGAGGGUACCGGCGAAAACGGUGACCAACAUGAUAUCAAGCUUGGUGACCCGAGUCCUUCGACCAGUUCCGUCCCCUCACUCUCGUCUGGUGACUCCAUUGAAACGUCAGACCACUUACUAUUCGACAACCGAUCCAGGCCGGCUUCUGUCAACUCUCGCUCCACGAACACGCAAGCGAGCCGAAGUUCUGGAAUAUCGUCUAACAAGAGCAAAGCAAGGCGCAAGUCCCAUAGAUCUUCGCACGAUAACUCCGAUGCUGACCACGGCCACAGUGUUUGUCAUCCCAAGAGAACCACUUACCCAUUGUGCCCCGACCCGACUGCCUCGUGCGGACCUCAUUUCUUCAUGUCAGUGUGUGAGCAUGAUGAGUCAAUACCUACGGUGUUCCAUGCACACUCGGUGGGAGGUCAAGAUAUCACCCACGACAUUGAUUCAGGUUUGGGAGCAAUUAUAUCAAAACGCUUUAGUGCUUCGCAGCUACGCCUCCUUAGCUGGUCUAUCGACGGAAUACUCAACACUUUAUCUCGCGCCGCCACCUCAUCGUUUGUCGAAUCGUCGCUGUUGUCCUUGUUACGAUUUAUGCAACAAGUACCUGCAGUUGAGUCCUCUGCAGAAACUCGCCGGUGUCUUUUAUUUGGUGGCCCUAGAGAAAGAUUUAAGGGAUACGACACCUUUGACCUUGGAUUCAUGGGUGUCGCGGUACCCUCUGACAAGACAAAGGGAAUUGAGGCUUGCUUACGAGAGGUUGCACGGCAGCAUGCUCGUGCAGACGUCCCACACGAAGGUGCGUAAUUUUAUAAAGGUUGAGCCCAUGGCUAAGUGCUCAGACCCGCGGAAUAUAUCGCCUCGCAAUGACGCCACCCUUGCAACACUGGGACCAUAUUUUUCCGCGAUUGAGCAUCGUGCUGCGUCCCUUCCUUUUCUCGUUAAGGGCUGUGACAUCCCGGCCCGUUCCUCGAAGAUGUCUAGCCUGUUGGGCUGGCCUGACUAUUAUGAGAUUGAUUACUCCCGAUUCGACUUGUCUAUUAGUGCUGAAGUUAUUUCACAGUACGAGCAUGCCUGGGUCUCUCUUGUUUAUCCUCCUCUCAAUUACCCUGGCUUCUGGCAGACUCUCGUUUCGACACUCAUUACCUCGGGCUUUAGUGAGUACGGUAUUACUUACUCUUUGCCUGGGUCACGUUGUAGCGGUGACCCACAUACGUCCGUUGGUAAUGGUUUGCUGAACGGGUUCUUAACCUGGCUCGUUACUUUUGACAAGGACUGUUCUUAUUUCUGUGAGGGCGAUGACGGCAUUAUCGGUUGUUCUCCACCUAUCGGUGAUGAGAUCGAGAUCAUCCCUGAUUUAGGAUUCAUGCUGAAGAUAGAUCAUUACCACCACAUUAACGACUGUUCUUUCUGCGGUAUGUAUCUUUUGGAUGAUUCUGGCACUCUUGGCAUGUAUUCUGACCCGUUGCGCACUCUUUCCAAGAUCCAUGUUUGUUGCGCUGAUGGUCUUCCCAACAAUUUGAUUGUGGCCAAGGCGCUUAGUGUUCUUAACCUCAAUCCAGCCACUCCAAUUAUCACCGCAUUUUGCCGCCAUAUUCUGCGUGUUGUUCAUUCUAAAUUGCUUAACCCGCGAAAUCGUAACAGACUCACUGCUGCUGUAAAGCGGGUCUCGCCUAUUAUGGCUUAUAUGCCUUUCCAGACUGCCCCUGUGUAUCGUGAGCCCAGUCCCGAGAUGCGCGCCGCGUUCGCUGCGCGUACUGGCAUAUCUCCUGCGUUGCAAUGUCAGUAUGAGCAGUAUCUGCUCUCAUUAUUGUUUGUUCCGUCGCGUUAUGCCUUACUUAAACGAGACAUUGAGCUCGACGGCCUACAGACCACCCUUCUUGGCGACUUCAGGUCUGUUCUUUACGCGUGAACAUUAUAAAUUUACUAUCAUGAAUCAACAACAAAUGAACCCCGCGCAGCGAUCGUUGCGCCCCCGCGCUCAAUCUACUCCCUCUCGGUCCGCUCGACGACGACGCAAUCGUAGGCGCCGUAACCCUUCAACGCCUGCUGGUACGGUUGCAAUUCAACCGUCACGCAUCACUCGUCGAGUAGUUUCCAGUUUGGCCCGGCGCCCUCUCACCAUUACAACCGCCGGUUUGGCCUGGCUUCGGCAGUAUUUGAACCCUAUGGGCCCUUCUACAUCCAGUGUGAGUGGCUUUCCUGAUGGGUCUGCUGUUACCACAUGCAUUGCCGAUUACACCAACACAUUCAAUAUCUCUUUCCCUCCUCGUGAGGCGAUUUAUUGUACCGGUUCUAAUUCUGAUGAGAAACCUGUUAUGCUGGACGCCGCCACCUAUGCUAAGAUCGACGCGUGGACUAAGUCGGAUAUCACCUUGUGCAUACUCGCCUUGCCCAUGCUCCGCAAUGUGGUUAUGAUUCGCCUCUACGCUUCUACUCCGACCGCUUUCACAUUAAGCGAAGGAGUACCCAAUUUCGUCCAAAGAUUUCCUAAUUGGAGCGCCUUUACCACCGAGGGCAAGGUGCUUAAUAAUGGCGACUCACCCGGAUAUAUUCAGUCGUUUGUUUACCUGCCUAACGUGGAUAAACACCUCUCUGCCGCCCGAGGCUUUCGUCUUUUGUCUCGCGGUUUGACCGGCAUUUACACCGCUCCGUCCCUUGAAACUCAGGGAUUUGUCACCGCAUGUCAGUACCUUGCCGAGGGUGCGCUUCAAACCCAAACAGUCGGCAACGACUUUGUACAGUCUGUUGAGGUCAAUGCUGACAAGACCGUCAAGAACGUUAAUGGUAAACGUCUCCACUAUUCCGGACCUCCGAAAUUCGUGUUCCCGCUUGAGGGCGACAACUGUGCUCCCUCAUCCCUUGUGGAGACAUACCAUCAAGCUUACCAGGCUCGUGCUGUAGACGGAUUUUACAUGCCAAUCCUUUCUUCUUCCCGUGACAAUCCUUUCAUCUCCCCAAAACCACAGCCCAUAGCGGUGUUCAACCGCUGGUAUUACCGUGGUUGUCUCGAUCCAGUCCCUGCUUCCAAGGUCGCUGACGGACCUUCACAAUACUACUAUGAUCUUAACGUCGCCGACGACGUUGCUCCGCUUUACAAUACUGGUGUCGUGUGGAUGGAGGGUAUUUCUUCCAAGUUUUCUUUGAAGCUGAAGACCCGCACUGUCAUUCAGUAUAUUCCCACUUCAGGAUCGGUUCUUGCCAAUUUUACUCGGCAUGAGCCCACAUAUGAUCAGGUUGCUCUUGAUGCUGCCGAUCGUAUCAGAAACAUGAUGCCUCAUGCUUACCCCGCCGCUUAUAAUGACUGGGGCUGGCUUGGUGAUUUGCUCGACUCCACGUUGUCUAUGUUGCCUGGCAUCGGUACUGCUUAUCGCUUUGCCAAGCCCCUCAUCAAGCCGGCGUGGAACUGGCUUGGUGGCAAGGUCUCUGACUUCUUUGGCAACCCCGUGUCCCGUGACGGCGACAUUUAUUUCGAUGCUAAGUAACGGAGACGCAAUCUCUGGCUGUUAGAAAUCUUUGAUUUCGACAUGCCCAUCGUGCUUACUUUGUACGUUUUAUUUGUUAUUGUGUGGUUACUGGUAAUCAGUCGCAGACUGUUCCACACUAUGCCUACCAGAGGUUCUUAUAGUUCUAUGCUCGCCACAGAGUGUUUGAGAGCCCAACUCGCGYUGGCUCGGCAGGUCGCUGACUGCAU
>HQ871932 Aphid lethal paralysis virus strain brookings non-structural polyprotein and capsid protein precursor, genes, partial cds
CAUGGGAAUACCUAUUAUAUCACACACGCCAAAUUAAACAAUAUUUAAAUAACGCAUCUCACGGAAUUAUGGAAACACUAUCAGGAUUUUUUGGAAAAUAUUGGCAAUUUGUUAAACAAGCAGUUCUCGUUGGCUUAUCGGUGUUCAGCACAUAUAUGUGUGUGAAAGCAUCAUUCGCUUUAGGAGAUUACGUAAAAGGAAAGAUUAUGCCUAAGUAUAUAUCAGACGAUGACGAGAUGGCCCAACUUGUAAGUGAAGCUAACGCUUGCUUUGAGAAGGGUUGUCAAAAUUGUCGCCUAUGCAAAAAUGCGGCUAUGACACAAUUGAACGUAAAAUGGAACUCUGCUUGCUUAUGCUAUGUGAAACGUAUGGAAAAAGGAAAGGACAUGAUUAAUAAAUAUGCUAUUUCUCUUUAUGGUAAUCAGCGUGUAUCUAACAAUCACGAUUUAUCUGUUACUGACAUGGCUGACAUUAUCAACCAAGUUGCAGAUUGUGAUUGUAGUACAUGUGACUGCUGUAAUGACCCGGAACUAUUGGAUAAACUUACGAAUGUGGCUCAAUUACACAACACCAAUUGUGUGUGUCUGUUGACUCGUUUCUAUCAAGGAUUUAAGACUGCGGAUCUAUAUGAGAUGACAAAGCAACUAAAUGUUACUUUACCAUCUAUUAUUAAGAAUCCCGAAUUGAAACGACUAAUCGACUCACACGCAAAAGUGUAUGACAAUGCUGUUACACAACGUAGGAAUAACACUCGAAUUGUAGGACAUGGACCCACAUAUGACGCACGCCCUAGACAACGACAAAUGGCUACUCGAAUUGGAGCACAGGCCCCGGUAUAUGAUAACCGCGUUACAAUAAAGAAAAAUACUAUUGUAGCCGCGCAAAAUCUAUUACCCGCUUUUGCCAAAAUCGAGCCCAAGGAACAGGAAAUGGAAAUACAAACACGAACUGCUUGCAACGGAUGUAACAACUGCUCACCCAUCGACGCUCAACGAUCUCUACCAGAACAAGAUAAAGGCUCUAUAGUGAUCGCGCGUGAUGUUGUGUACAGGAAUUUAUUCCGUUUCACUGUUGUGUUAAGGACAGAGGAAGGCGAAAAACGACGUGGAUUUGGACAAAUAUUUAUGUUAGGCGGUCGAUUAGGUAUGAUACCGAAACACUUCCUUUCAGUAAUGGAACAUUAUGUAGAAACUUAUGGACAAGAAAACUGCUUCUUUGUAUUGGAAAAUUGUAGUAAUAGUAUAUCUCCAUUAAUACCAUGCUCUGUUAUUUUAACAGAAGAGAAUCACAUUCGUGAUGCUCACAGAGAUAUUGCUAUAAUACAACUCCCAACAAAUGUAGGUGGUUUUGCACAAGCUUACAAACACAUUAUUGACGAGACUGAUUUGGCCCGUGUAUCUGAUUCCCCUGCUAUUUUGGCGAGGUAUCAAGGUGCAUCUGAACGUGACAAGAAAACUGGAACUAAUUAUUACAGAGAAAUCUUUUGGUUAUCUACAGCAACCCCUGAAGACCACCUUGUUGAAAGCACGGUGCCUGAAGCUAAUGUUGUAGUACAUAAUCGUGGUUCUUACACAUAUCAUGCCGUGACCUUCUUUGGUGACUGCGGAUCGAUUUUAAUCGCAUCCAACGCCGCUAUAACAUCGAAGAUUAUGGGUAUGCAUAUUGCUGGAAUUACGCACAUGAACAAAGGAAUAUCUGUAGCACUGACACGACAAAUAAUUGACCGAUUGAUGAGACAUUUUCAACCAAUCAGCCAAUAUGGACACGAAAUUGUACCCCUGACUGUUAACCCCGAUAUUUUAAAAGACAACGGAACAUUUUUGAUCUAUGGAACUGAACCAGGUAGACGGAUUAUGGGAAGCGUUAAAACUGCUCUCCAAAAGUCCCCUGCCUAUGGAAAAUUGAUCGAAAGCCCAAAUAAACCUGGAUAUUUACGUGAAUUUAUAAAUGAUGACGGAAUUACUAUUGACCCUAUGACUUUACAACGGAAUAAAUAUGGUGUUGUUCGCCCGUACGUCCCACAAGACAGAGUUGAAGCUGUUUAUGAAGCAAUGAGUGUAUUCUAUCAACGAGAAUAUAUUAACUCACCUGCCCAUUACAAACUUCCACUUACGCGUGAACAAGCUAUUAUUGGAAUAAACGGAGACCCAUUCGUCAACGCCAUUAACCGUCAAACUGCUCCCGGCUACCCAUAUACAUAUGAGAAGGCUGGAAAGAGCGGAAAGACGAAAUGGUUUGGCGAUGGAAUGGAUUACGAUUUAAACAAUGAAGCAUGUAGAGAAUUGAUGGCUGAUGUAGAUGAGCUCGCCCAGUGCAUGAUCGAUAACGUUAGGCCUCGCAUUAUUUGGAUCGAUACAUUGAAAGAUGCUAAGAUCCCUAUCGCGAAAGCCAACGUAGGUAAAACUCGAUUAUUCACCGCUUGCCCACUACACUACACAAUUCUCUUCCGACAAUACUUUUUGCCUUUUAUUGCUCAUUCUAUGCGUAAUCGCGUGCAAAAUUCUAUUGCUGUAGGCAUUAAUCCAAUGUCACCAGAAUGGGACCUAUUAGCCAAACGUUUGAAGAAAAAUGGAAAACAUGUCAUUGCUGGAGAUUACUCUAACUUUGACGGCACACUCCCGGUACAAUAUGUUGAAGUUGCCGUGAAAAUUAUGGUCGACUGGUUUAUGAGAAGCUGGGACACCAUAGUUCGCGAAGAACGCAACAUUAUAAAUGGACACGAACUGACUUACGAUGAAUUUGAACAAUUUUUGAUGAAAAUUGGAGUCGAGUGCAUUAACCAUCUGCACAUAUCUAACCAUAAAAACGUUUCCGGUGCUGCUUUAAUAUAUUACGUUCGUAAUGGUAUUCCAUCUGGAUGCCCUGCGACUGCUAUAUUGAACAGUAUCGUAAAUCAUUGCUGUCUUGCUGAUUCUUGGCUAGACAUAAUGAAUGGAACGUCGUAUGCUACGAUGAACUCGUUUUUUGAGCAUACUUCGUCUAUUUUUUAUGGUGAUGACUUCAUAAUGAAUAUACGACCAGAGGUUAUUGAUGUUUAUAAUCAAGAAACUCUCACCCCGAUUUUGAAACGCAACCUGGAAAUGACUAUGACUGAUGAAGCAAAAACAGGAGAAUGUGUUAAAGCACGAACUCUUGAAGAAGUUUCAUUUUUAAAAAGGAAAUUUAGGUUUGAAUCUUUCGUAGGAUUGUGGGUUGCUCCAAUUGACAUUGAUGUUAUUUUGGAUGCACCUAAUUGGGUACGUGUUGGUAAUCAAUUACCUCUACGUAUCUGUGUUGACACAAUCAGCGGCGGAUUAACCGAACUGGCUAUGCAUGAUAAAUCCACGGAUUCAAAAUGGAGAUCUAAGAUGAUAAAUCUUGGUCUCGACUUGACCCGUGGUACUGGAAUUGAAUUUAACCCGGACUCAAGAUCAACCACGCUAUUGAAACUCAGAAAUGAGGAGCUUGGCGGAGAUUUUGAGGUUAAUUACUAAUUUGACCUUUAGAUUAUAAUGUUAGGACUAUAAAAAUUAAUUUAAUGCAUUUAGUAAUUUUAGGCUUAGUUAUUUAACUUUACUUAUCAAGAUGGCCGUUGGCAGCCCCACGAAAUCUAGAUUAGUCCGAAUGUCCUAUUUUGAUUAGGUGGUCAGAUAGGUCAGAAACUCACCUGCAAAUUUUCAAGAAACAAAUAUGACACAUGAACAACAACAAAUUCUUACUUUCUCUUCUGAAGGUAUGAUGCCCUCAACUAGUAUAUACACAGACCCAUUAGAUUUAGAUAUGUCAUAUCUAACAUCUGUAGAUGACGGUCGCAAUCACUCUAUCAUUGAUUUUCUUCAACGUCCGAUUAAUAUAUCAAAUGUUGAAUGGAAAACUACGGAUAACGCCGGCGCGACUUUAGUUGCCGUCGACCUACCGUUGGAUCCUAUACUGAAUAAUUCAAUGUAUAAAGCGAAAUGCGAACGUUUUUACGGAUUUAGAGCUGAUGUAGAAUUAAAAUUACAAGUUAACGCUCAACCCUUUCAAGCUGGGCGUUUAUUAUUAGUAUAUAUACCUGGAUAUAAGUAUUUAGGUGCAUCCCGACAAAAAUAUUAUGACGAUCGCACUAAUGUAGACGAUGCUAGUUUGGUGCCACUGACAGGUUCUCCACGAGUAGAUUUAGAUCUAUCAACGUGUACUGAAGCCUCAAUGUGUAA
>HQ888865 Lake Sinai virus 2 strain BruceSD_T17E01 Orf1, RNA-dependant RNA polymerase, and capsid protein genes, complete cds
GGCCGCAGGUCAUCCCACACACGAUGAAGGUUGUCUUCUUGGUUUCGUUUGCUGUGUUCCUCAUCUGUCAGGUCCCACCAGUUUCGUACUGGCUGGAGGAUGCGUUGGAUGAGUAUAACACGAUGUGCAGCUAUGAGUAUGCUGCUGCUGAGGCUUACAACAAUUUCAUUCAUAAGCAUCGCGUGGCCGCCUAUGCCGCCGGCGUCCGUAUUUUGCGCUACCGUACACCGUGGUACUGCUUUGCGUCACGAAGCGUCCCCGUAGUCCAUCCAUUUUCCUGGCUUAUGGGUCAAUAUGACGCCACGAUCGACCGCGUCGGCACGCUGAUGCAGCGACUCGAGAUCGCCAAUGUCUCGAUUUCUGACGGCCUUCGCACCGUCGCUGACACUGCUCUCAAGGCUUACUUCUACUAUCAGAUUAUUUGGUUCCAGCUCUUCUCGAUCAUCAUGCUGGUCGGUUUCUUUUCUGCUGUCAUCUGCUCUAGUCGUGUGCGUGUUGUUCGCAUACGUAACAGGGUGCGUGGUUACAGCGUCGCUGAACUGCGCUCCGACUUUGAGGAGAGUAUGUCCGCUAUACUGGCCCCCUUAUCUCGUGGACACUCUUGUUUGAACUUUCAGCGUCGUGUCGUCGAGUCGUGGGCCAUCGACCAAUUGCUUCGAUAUUUUCGAUGCUUUAGGUCUGUUGCGUCAUCACAGGGUAGGUGGGCGGAAGUUGGUCAUCGUCUCCACCGCUGCUCACCUGUUGUUAUGGAUGGCGCGUUCGUACCUGAGUAUGAUCAGCGUUUCAGUGCCUGCCGUCGUCACCCCUCCGUUUGUCCGGAUAGGUUUGAUACCCCUGCUGCGAUUCUCAGCCAUGUUGAUUAUUACAUGACUCCUGAUCAGUUGGCCGCAGCUGUGACCGGACCUACAUUCAUCGUCAAUCACGACUAUUCAUCCAUUGAUACCUUGUCCGUUGCCGAGGUAUCUUUACGGUCGGCCGGUGGGUUGGUCACUGCCAGCGUUCGUGAUGGGCCUACCUUUGGCCCUCACCCGUAUUAUCGCUGGUCCGACGAGGGGGUUGUGGUUGCUUCUUCCGGUGCGUUUCAAUAUUUCAGAAUUGGACGCCUGUUCGACACCACCCUCUACUACGCAUUUCCAACCUCUGGAACAUAUUCUCAGGAUGACCCUUCAGCUCUUCGCCGUUCCACCAGCGGCGACCUCCAUUACUAUUCCCCGCACGAAAAGCGCUUCGUCAGUUAUACAGCUGAUGACACUCAUUACCACGUCUUUGGCGUUUCCGUCCCACGUUCGUUGGCCGAUUACUGUGCAGCUACUUUUUGCAGAGCAGUUCGUGAUGAUAAGUUUUAUGACAGUCUGCGUUCUUACUACCAGAAUAGGUGUCGGGCCAUAGGGUUUGCCGACGCCCGCGACACACUGAUGCUCGACUUCAUCAUCCAUCUGUGCGACGACGCUAGCUUGCGUACUUUCGGCUUUUCCCGGUUGUCUUCCGCUCCUUCGUCCUGGUCAGCUUAUUGCUUGUCGUGGAUUCUGGUCAAGGUUAAUCAUAUGAUGCCACUGGCCCUCACCUCAUAUGUCUUGAAUGUGCUGCACCGCUUCUUCGGCGCUAAGGCCGCGCCGUGGAACUGGGCAACGAUUCACUUGCCAACUUAUGAUAUGGUGACGUCACCAUUUCGGUUGAGGCUAUUUGGGCGUAAUCCCACAGUCUUCAACCUUGAGCGAUUUCGUGCUGAGGCCACGGUUGUUGGUUCCCCCGAUCGUGGCCAGUCUGCCGAGGGUGCCAGCCAAGACCAUUACGAACAUGAUAUCAAGUCUUGUGACGCGAGUGCUGCGUCCAGUUCCUCUCCCACACCCCUACCUGGUGACUCCUCUACGUCGGGAUCAGUCUUAUUACUCGACGACACUACCGACCGAGUUCGUGUGGAUGACUCGUCCGCGAGAUCGACACCGGGCCGAAGUUCUGGAAUAUUGUCUAACAAAGGCAAAACAAGGCGCAAGUCCCAUAGACCUUCGCACGAUAACCCCGAUAUUGACCACGGCUACAGUGUUUGUCAUCCCAAGAGAACCACUUACCCAUUGUGCCCCGACCCGACUGCCUCGUGCGGACCUCAUUUCUUCAUGUCAGUGUGUGAGCAUGAUGAGUCAAUACCUACGGUGUUCCAUGCACACGCGGUGGGAGGUGAAGAUAUCACCCAUGUUGUUGAUCCGGCUCUGGGAGCGUCUAUAUCGCAACGGUUUAGCGCUUCGCAGUUACGCCUCCUUGGCUGGUCUAUCGACGGAAUUUUCAAUACUUUAUCUGGCGCCGCCACCUCGUCAUUCGUCGAGUCGACGUUGUUGUGCUUAUCACGAUUUAUGCGUGAAGUACCGCCAACUCAGCCCGUUACAGAAGCUCGCCGCAGUCUUUUAUUCUGUCGCCCUCGAGAGAGAUUUAGGGGAUACGACACCUUUGACAUUGGAUUCAUGGGUAUCGCGGUACCCUCAGGCAAGACAAAGGGAAUUGAGGCUUGCCUUCGCGAGGUUGCAAGGCAGCACUCUCGUGCAGACCUCCCAAACGAAGGUGCGUAAUUUCAUUAAGGUUGAGCCCAUGGCCAAGUGUUCCGACCCACGGAACAUUUCACCUCGAAGCGAUGCGACCCUUUCAACCCUUGGCCCUUAUUUUUCUGCCAUCGAGCAUAAUGCCGCUGGUUUACCCUUCUUAAUUAAGGGAUGUGACAUGGCGGCUCGUGCCGCCAAGAUGCGUGACCUCCUGGGUUGGCCUCACUAUUACGAGAUCGACUACUCUCGUUUUGAUUUGUCGAUAAGUGCUGAGGUCAUAUCUCAGUUUGAGCAUGCUUGGAUCUCGUUGGUCUACGCCCCCGACAUGCACCCGCUGUUCUGGCAGACGCUGGUCGCCACGUUGGUCACUUCAGGGUUUAGUGAGUAUGGCAUUACCUAUACCCUCCCCGGAUCGCGUUGCGGCGGCGACCCUCAUACGUCUGUCGGCAAUGGCAUCCUCAACGCGUUCCUCACAUGGCUUGUCACGUUUGAUAAGAGUUGCUCUUAUUAUUGUGAAGGUGACGAUGGGAUUAUUGGCUGUGCUCAGCCUAUUUGCGAUGAGAUUGAGAUUAUACCGGACUUGGGCUUCAUGCUCAAGAUCGAUCACUAUGAGCAUGUCGACGAUUGUUCGUUUUGCGGUAUGUACUUGCUGGAUGAUCGUGGAUCGCUCCGCAUGUACUCUGACCCGGUGCGCACACUGUCUAUGAUACAUGUGUGCUGCGCCGAUGGUCUACCCAACAAUUUGAUCGUGGCCAAGGCUCUGAGCCUUCUCAAUCUGAAUCCAUGUACCCCCAUCGUCACAGCCUUUUGUCGUCACAUAUUGCGCGUAGUUCGGUCCGUGUUGCUUAAUCCGCGAAACCGUAACAGACUUGCUGCUGCCGUUAAGCGUGUUGCUCCGUGGRCGGUUUAUUUUCCGUUUAGUUAUGAACCGUUCCACUCUGAACCAACUCCAGCCAUGCGCGCUGCUUUCUCGGCGCGCACAGGUAUAUCUCCUGCCUUGCAGAUAUCGUACGAGCAGUAUCUCCUCAAUUUAAAAUAUGUCCCCUCUACUUACCGCUAUCUCAAGCGCGAUCUCGACAUUGACGGUGUCCAUACCGCGUUGUUGGGUGAGUUUAGGUCUGUUCUUUACGCGUAAUUAAUAGAAAUUAUCACGAUGAAUCCACCAACUACGACUACGACUACGACGCGCACCAUCCGCGCCCCAAAAGUUCAACUGACGCCCAAUUCUGCUACUCGGCGUCGGCGUAAUCGUCGGCGCCGUCGACCUGCCGCUGCUAUUGCCGGGCCUUUAUCCAUUCAGCCUUCGUCUAUUAAUAGGCGUAUGGUGUCCAGGGUCACCAGGAGGUCCGCCGUUGUUACUGCGGCUGGUCUAGCGUGGCUGCGUCAAUAUCUCAACCCCAUGGGUCCCGACACAACCAGUGUUACAGGCUACCCCGAUGGUUCUGCUGUCACCACAUGUAUCGCAGAUUAUUCCAACACGUUUAAUGUGUCUUUCCCGCCCAGGGAGGCUCUUUAUUGUACUGGGUCCUCUUCUUCGGAAAAGCCUACCCUUGUCGACGCUGAUAAUUAUGCCAAGAUAGACAAGUGGUCCAACUACGACAUCACGCUAUGCGUGCUUGCACUACCCAUGUUGCGCAACGUUGUGAUGCUUCGUCUUUACCCGCAUACCCCUACCGCUUUCGCCCUUACUGAGCAGACUCCUAAUUUUCCUCAACGUUUUCCCAACUGGAGUGUUUACUCCGCUGAUGGUACCCGGUUCAACAACGGCGAUGAGCCUGGUUACCUUCAGUCCUAUGUUUACUUGCCGAACGUUGACAAGCACCUUUCUGCUGCCCGGGGAUACCGCUUACUGUCCCGCGGCAUCACUGGUAUCUUUAGUGCUCCUGCUCUUGAGACUCAGGGAUUCGUCACAGCUUGCCAGUAUUUGGCUGAGGGGUCUAUACAAUCUCAGUCCAUUAAGUCUGACGCUGUUCGAUCCGUCACUGUUAACAGUGAUGGUACUGUUAAGAACGUUGAGUCUAGCUCACAAACAGUUUCGUCUAUGCCCCGAUAUGUGUUCCCGUUAGACGGAGAUAAUUGUGCUCCGUCGUCCCUCACUGAAACUUACCAUCAAGCCUAUCAGUCUAAGGCUACUGAUGGAUUUUACAUGCCUGUGUUAUCAUCAUCGAGGGACAAUCCCUUCCACCCGCCACAGCCCAGGGCCAUUGCAGUUUAUGGCUCUUUCUUGGCUAGGGGUUGCCUUGACCCUGUUUCGGAAGCCCACGAGGCUGAUGGCCCAACUCAUGACAUUUACCGUUUGAAUGUUGCCGAUGAUGUGGCACCAUUGUUCAAUACCGGCGUCGUAUGGUUUGAGGGCAUCUCACCUAAAUUUUCUCUCAAACUUAAGACUCGAACUGUAUUGCAAUAUAUUCCCACCUCCGGCUCUGUCUUGGCUAACUUCACCAGACACGAGCCUACUUACGAUCAGAUAGCGCUCGAUGCUGCUGAUCGUCUGCGUAACCUGAUGCCUCACGCUUACCCUGCCGCAUACAACGAUUGGGGAUGGCUUGGUGAUCUGCUCGAUUCUGCCAUCUCCAUGUUGCCGGGUGUAGGUACUGUGUAUAACAUUGCCAAACCACUCAUCAAGCCUGCGUGGAACUGGCUCGGAAAUAAGGUGUCUGAUUUCUUCGGAAACCCGGUGGCUCGUGACGGCGACAUCUUCUUUGACGCUAAGUAAUCGGAGGCGUAAUCUCUCGGCGCUAGAAAUUUAACGAUUUCGAUAUGCCAAGUAUCUUGACGUUGUAUUUCGUCUUUAUUGUAGUGUGGUUACUGGUAAUCAGUCGCA
>JF423195 Big Sioux River virus isolate BSRV1 nonstructural polyprotein gene, partial cds
GAACGUGACGGCUUCGAUUAUGCAAUCAGAUAUGCCAGCUAAUUUAUUACCCCAACUGAGAGAAUUAUUUUGUACCUCAACAGCUCAGUCUGCUUCCAUUGAUGGACAACUAGUACUAAGACUUUUAGCUUUGUGCUCGUUUUCAUUGAUGGUUAGUAAGAUACCAACUUCUAAAGACAUUGAUAUUUUUAUCAAUCGUCUUGAUCGAGUUCCAAAAGCACUGAGUGGCAUGGAGAGUAUGUGGAAACGCAUAGACUCCGUGUCAACUGUACUAUGGAAUUGGAUGGAAGUAACUGUGUUGAAGAGAGAAGGAGUGAUUCCUCGAUCUGAUAUCCUUGAUUCUGUUUCUAAGUGGGCCAAUGAACUUAGUCGUUUGUUGACCCUAGCUUCUCGAAGAGAAAUCCAGAGAGACGUUGRAACCUUGCAUGCUGCAGGACGGAUGUAUUCUGAAGGAAUACGCUUAAUGAAGCAAUGUAAAGAUUUGAACCUUAGUAAGGGAAACAUGGAAAUCAUCGCCCGAAAUUUACCAGCYGCUAAACUCUUGUUAGACGAAGCUAAUAUGAGUGGAGCRGAUAGAUCAAAAYUCVGGACUGAACCGUUAAUCGUAUGGUUUUCAGGUGCUUCUGGVAAHGGAAAAUCAGGGUUAUCAUAUCCUUUCAUCUUAGACAUGAUGAGAGUGUAUGGUGAUCCUCCUGAUACAUGGCAACAAAAUGUAUACGCCCGCGUGCCCGAAACUGAGUACUGGGACGGCUACAUUAACCAAGAAUACAUUAUUUAUGACGAUUUUAUACAAAUUAAAGAUUCACAACUUAAACCAAAUCCUGAAUUAUUUGAAAUGAUUAGAUUAGGAAACAUGUUCCCUUAUCAGUGUCAUAUGGCAUCAAUAUUGGAUAAAAACAAUACUUUUGCUGAACCAAAAUUAAUAUGUUUAACAUCAAAUUUACGAAGAUUGCAAAUAGAGUCAUUGAAUUGUCCCGAAGCUGUAUCGCGUCGUAUAGAUUACGCUUUUAAUGUUCGUAUCAUCCCAGAAUACCAAAUGGAAUAUACGGAUGCUAAUGGCGAUAGGCUAUAUAGAUUAGAUGCUGCUAAGGCUCGUAGAGAUUUUGGUGACGUUUUAUGUUUUGACGUCUACCGAUUCGACAUGUUUGAUGCAUCUAGUAGAGUAUUUUUACAGACUGAUUUGACUUACACUGAAAUGGUUGAGUUAUGUCAACGGAAAAUGAAAGAUAGAGCAACAGAUUUUUACGAUUUUGCUAGCUUUUUAGAAACGUACAGGAAUAAGGGAGKCGCUCAAGUAGAGAAACUCAAGCAUGAAACUGUACAUUUUGAUAUAACAGAUGAUUACUCUCCAGAAUAUAAUGGACAAACAAUGGAGUUCACAUCAACCGCGCAAGUAGGAAUUUCGGAAAUUGUUUCUGAAAUAUCACCUCBUUCCACUUUACUCGAACGCAUAUAUUGGAGGACCUGUAAGAG
>JF423196 Big Sioux River virus isolate BSRV2 nonstructural polyprotein gene, partial cds
AACUACAGCACCUGGAUAUCCUUAUUCUCAACAGCGGAAAGGUAAGAAAGGUAAAACGUUAUGGUUUGGAGACAGUAUGGAAUACGAUCUUACUGGACCUGACGCGCUUAGGCUGAAAGAUGAUGUUAUUAAGUUGGAAGCUAAUAUAUUAAAAGGCGAAAGACCCGAAGUUGUUUGGACUGACACCCUUAAAGAUCAAAAAAUAGCCAUAGCUAAAGCUAACCUUGGUAAAACGCGCCUAUUUUCUGCAGCGCCUAUGCAUUAUGCAAUCGCAUUGCGGAAAAUUUGUGCGCCUUUUGUAGCUCACUUAUCACGAAUGCGCAUACGUAAUACUAUUUGCGUAGGUGUAAAUCCUUUUUCCACUGAAUGGGGGGAGGUAGCACGAAAAUUGAGUACAAAGGGUCGAGACGUUAUAGCUGGCGAUUAUUCUAAUUUUGACGGGACGUUACCAGCACAAUUUGUAUAUGCUGCAACAGAAAUCAUGGCCGAUUGGUAUGAUUUGAAUUGGGACUUUGUAGAAGCUCACAAACGCAAUUAUAUCGCGGGAGUAGAGCUAAACAAAGAUCAAUUUUUACUAUAUUGUAGAAAAUUAUAUUAUGAAUGUGUACACCAUUUGCACGURACUAAUUAUGAUUCUGGAGCAUUAUUAUACUAUGUCCGAAACGGCAUACCUUCAGGGUGCCCCGUCACUGCACCCCUUAAUUCCAUAGUUAAUCAAAUGGCCCUCAUAUAUUGUUGGUUUAAGAUAUACGAAGGAAGUGACAAAGCUAGUGUGAAAGAGUUUUUUGAACAUACCUCGAGUGUUUUUUAUGGAGAUGACUUCGUAAUGAACAUUCGAGCUGACGCUA
>JF423197 Big Sioux River virus isolate BSRV3 nonstructural polyprotein and structural polyprotein genes, partial cds
GAAAUUGACAAUCGUUGGCGUCCAAGAAUAACGCAACUGGGACUCAAGGUUACUGAAUCUAUACCAGGAGAGUUGUUUAUACCUGACACUAGGUAUGCAACACUUUUGGCGAUAAAGAAUCUUGAAACAGACAGUUUAGAAUGCUUAGAUAGUCUAAGUUGAGAACACCUCUACUGGGUCAUCCCGAGCCAUAGGCCGGUCUACCAGCAAGUGAACCCUCACUAAUCUAAUCCUCUUCUAUAAAAUCUGUUAUAAUCGUAAGUGUAGUCUAAUUAAGAGAACGCUCUGCAGAGUCAACCCGUUAAUACCGGUCCAUCUGUAUCGUAAACUCUUAGUAACAUGAACGAUUAUGUUAACAUACACGUAGAUAGCAUAGUCUUAUUUGAAGAACGCUCUACUGGGUCAAUCCGUUAAAACCGGUCCACCAGCAACGUAAACUUCAUUCAAUGAAAGAAGCGUGUAUAUAAAACAAACAAAAUUGCUACAAUGUGAUCUUGUGCAAUAAAUGCUGACGUGAAAACGUUGUACAUUGCUAUUGUAGUUGGUUAGCUAUUUAGCUUUACUCAUCAAGACGCCUGAGUGCAGCCCACCAAAGUCUAGAUACGUCACAAGCGGCAGAGCAUUAGGUCGUGCAUGUUGCUCAAAAUUGACCUGCUAAUAUACAAGAAAACAAAUCAACAACAACCCAACAACAAAUAUUAUCAUUUAGCUCAGAAGGUGAAGCACCGCGUUCCCAAACUGUUUCAAAUCCCUCUAAACUUGACAACCCUUUAUUAGAUUGUGCUCGUGAUGGAAAGACUCACACAGUGACAUCCUUCCUUGAACGACCUAUUAACUUUAGGACUGCAAGUUGGGGUAAUCAAGCGGCCGGAACGCGAUUAACGUCAUUCAACUACCCUUCUGACGUAGUCAAAAAUACCAUGUAUAGUAGAAAAUUACAAAAUUUUUUAGCUUUGCGAGCUGAUUUAGUUGUGCGUGUUCAAGUGAAUGCCCAACCAUUUCAUGCUGGCAGGUUGAUGCUAUCAUGGACU
>JF423198 Big Sioux River virus isolate BSRV4 structural polyprotein gene, partial cds
AACUAUUCUACCGUAGUUGACUUACGAUCUGAUACCGAUGUUGAAUUUAACUUACCAUAUGUUGCAACUGUACCUUGGUUACACGUUAAGGAAAGUCCGUGGACUGGCUCAUUUAAUCAAACACAAGUUUGUGGAGCUGUCCAUGUAGAAGUUUUGAAUGAACUUGUUAAUACAUCAACAGUAUCUGAUUCCGUUGAAGUUUUAGUUGAGGUUUGUGGUGCAGAAGAUAUUGAGUUUGCUAUACCUAUUCAGCCCAAUUUGACACCACGCGCGAGGCCAGCCACUACACGCACACGUAACGUUAUGCGUAUGUUGACCAAUAGCGUGGCACAAGUUGGUACUGAUACGGGCGAUACUCCUUCGGAGCAAGCGCGGGUAGAACCAACCAAUUUUUCUGAAGUACCACUUCAGCCAAAAGCUACUACUUAUAAUGAAGCAAUGUUGACGAUGGGAGAAAAAGUAACAUCUUUUAGACAAUUAAUUAAAAGAUUUCACAUGUUAACACCAUCAACUGAAGAACGGUAUUGGAAUUUUAGUAAACCUUUUUGGAUUAACCCCAAUAAAUUUGUCGGUACAACCUUAGAAGGAACUAAUGAUCUAGAUUCACUUUCGUGGUUUGCCUCUUUGUAUGCUUUUUACAGAGGUUCCACGAGGGUGAAAAUCGCUCCAAUAAAUAAAACCGGGCCUAUGCAAGUUUUGUUAAAACCCACUUACCUUUAUGGUAAUGGGUCUAUUAUAGAACCUGAUACAACUUGGCCAAGAGUUGAUGCUCGAGGCGCUGAUGUUUUCUUACCGCGCACCGAAGGGAUAUACGAGUUAUCGUUUCCUUACUAUAGCUCUUACCCUGUAACUCUUACAACAUACAACGCUACUAAUUCUGAUGUUUUGGAUGCGAGAAACGGUUUCAACCGCGCUAUUGCUACUUUUCACGAAGAUACACAAGCUUACGUUUAUAGAGCUGCAGGUGAUGACUUUAGUUUUGGAUUUCUCUUAGGU
>JF423199 Crithidia mellificae isolate GAPDH glyceraldehyde phosphate dehydogenase gene, partial cds
GAGAUCGACGUGGUCGCCGUGGUGGACAUGAGCACGGACGCCGAGUACUUCGCGUACCAGAUGAAGUUCGACACGGUGCACGGCCGCCCGAAGUACACGGUGGAGGUUGCGAAGAGCUCGCCUGAGGUGAAGAAGCCGGACGUGCUCGUGGUGAACGGCCACCGCAUCCUGUGCGUGAAGGCGCAGCGCAACCCGGCGGACCUGCCGUGGGGCAAGCUCGGCGUGGAGUACGUGAUCGAGUCGACCGGCCUGUUCACGAACAAGGCGAAGGCCGAGGGCCACGUGAAGGGUGGCGCGAAGAAGGUGGUGAUCAGCGCGCCGGCGUCUGGCGGCGCGAAGACGAUCGUGAUGGGCGUGAACCACCACGAGUACGACCCGGCCACGCACCAUGUCGUGUCGAACGCGUCCUGCACGACCAACUGCCUGGCCCCGAUCGUGCACGUGCUGACGAAGGAGAACUUCGGCAUCGAGACCGGCCUGAUGACGACCAUUCACUCCUACACGGCGACGCAGAAGACGGUGGACGGCGUGUCGCUCAAGGACUGGCGCGGCGGCCGCGCUGCUGCGGUGAACAUCAUCCCGAGCACGACUGG

No competing interests declared.