The authors declare the commercial funder Innovest: Innovest is a company that is owned by the University of Bergen and Haukeland University Hospital, both in Bergen, Norway. Innovest is managing funds and grants for researchers employed by the two institutions. Innovest also manages some strategic funds from the two institutions, and PRN receives 100000 US$ yearly from these. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials.
Conceived and designed the experiments: HR MV PRN CRK RNK. Performed the experiments: HR MV AEO JAP FEM JH DK PRN. Analyzed the data: HR MV AEO JAP FEM CWL JH DK AM SPG PRN CRK RNK. Wrote the paper: HR MV AEO JAP FEM CWL JH DK AM SPG PRN CRK RNK.
CEL-MODY is a monogenic form of diabetes with exocrine pancreatic insufficiency caused by mutations in
We established a monotransgenic floxed (flanking LOX sequences) mouse line carrying the human
Pancreatic exocrine function was normal in TgCEL mice on normal chow as assessed by serum lipid and lipid-soluble vitamin levels, fecal elastase and fecal fat absorption, and the normoglycemic mice exhibited normal pancreatic morphology. On 60% HFD, the mice gained weight to the same extent as controls, had normal pancreatic exocrine function and comparable glucose tolerance even after resuming normal diet and follow up up to 22 months of age. The cerulein-exposed TgCEL mice gained weight and remained glucose tolerant, and there were no detectable mutation-specific differences in serum amylase, islet hormones or the extent of pancreatic tissue inflammation.
In this murine model of human
Mutations in the
All protocols (Protocol number: 05-01, Protocol Title: Phenotyping mouse models of diabetes and insulin resistance) for animal use and euthanasia were approved by the Animal Care Use Committee of the Joslin Diabetes Center and Harvard Medical School in accordance with National Institutes of Health guidelines.
We excised the wild-type
(A) Structure of the construct that was linearized and subjected to pronuclear injection into fertilized C57BL/6 mice. (B) Pancreatic mRNA expression of human carboxyl-ester lipase, h
A transgenic floxed STOP-CEL mouse line was created at the Beth Israel Transgenic Mouse Facility (Boston, MA) by standard transgenic protocols using pronuclear injection of the construct (see above) into fertilized C57BL/6 mice. The elastase-Cre mouse line on C57BL/6 background was provided by Dr. Grippo
Genotype analysis was done by PCR analysis of tail-tip-derived DNA samples. For the elastase-Cre mouse line, the following primers were synthesized to differentiate wild-type mice from mice carrying EL-Cre: Cre F 5′ ccgtttgccggtcgtggg 3′ and Cre R 5′ cgtatatcctggcagcga 3′ to amplify a band of 337 bp in mice carrying EL-Cre. For the floxed STOP-CEL mouse line, the primers CEL-HIS-2F: 5′ gcctgcaactggttgtgt t 3′ and CEL-HIS-2R: 5′ gtggacatcttcaagggc at 3′ were used to amplify a band of 141 bp in mice carrying the construct. For the Rosa26 mouse lines, the primers R26F: 5′ ggcttaaaggctaacctgatgtg 3′, R26LR: 5′ gcgaagagtttgtcctcaaac 3′ and R26R: 5′ ggagcgggagaaatggatatg 3′ amplified a fragment of 374 bp in WT mice and a fragment of 1146 in mice carrying the Rosa26 construct. For the
Monotransgenic floxed STOP-Rosa26 mice on C57BL/6 background were crossed with elastase-Cre mice to create bitransgenic offspring that were genotyped and subsequently dissected. Thin tissue slices from pancreas, liver, spleen, epididymal fat, small intestines, colon, hypothalamus and testes/ovaries were fixed for 4 hours in formalin, stained overnight in x-gal and then transferred to 70% ethanol. Fixed tissue was paraffin-embedded and eosin-stained sections were used for direct microscopic examination. Sections of pancreas were also prepared by immunohistochemical staining with antibodies against
Total RNA was extracted using an RNeasy mini kit (Qiagen), and RNA was reverse transcribed using a high capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions.
To produce insulin resistance that might challenge the TgCEL mice, mice were placed on a high fat diet consisting of 60% fat, 20% carbohydrate and 20% protein (% of kcal) (“60% HFD”; males [n = 4 TgCEL+/−,Cre+/− and 4 controls] and females [n = 5 TgCEL+/−,Cre+/− and 5 controls], 9 months old at baseline). The diet was provided for 12 weeks prior to physiological testing (the 12 months age group). After this, the HFD was terminated and the mice reverted to normal chow until testing was repeated at 22 months of age in the remaining animals (males: n = 1 TgCEL+/−,Cre+/− and 2 controls, females: n = 5 TgCEL+/−,Cre+/− and 3 controls).
Acute pancreatitis was induced in TgCEL mice and controls of either sex by 6 hourly intraperitoneal injections of 50 µg/kg cerulein (Sigma, St Louis, MO)
The group of mice tested under basal conditions at seven months of age (males [n = 4 TgCEL+/−,Cre+/− and 4 controls] and females [n = 5 TgCEL+/−,Cre+/− and 5 controls]) were investigated at Joslin Diabetes Center, Boston, USA. Another group of mice were tested with high fat diet challenge in Bergen, Norway, at several time points: Nine months of age (baseline; males [n = 4] and females [n = 5]), after a 12 weeks high fat challenge at 12 months of age (males [n = 4] and females [n = 5] ), and at 22 months of age in the remaining animals (males [n = 1 TgCEL+/−,Cre+/− and 2 controls], females [n = 5 TgCEL+/−,Cre+/− and 3 controls]). A third group of mice were used only for islet isolation.
The remaining two groups of mice tested with cerulein challenge were tested with acute exposure at the age of 12–17 months (n = 6 TgCEL+/−,Cre+/− mice exposed to cerulein; males [n = 3] and females [n = 3], n = 6 TgCEL+/−,Cre+/− mice exposed to PBS; males [n = 3] and females [n = 3], n = 6 control mice exposed to cerulein; males [n = 2] and females [n = 4], n = 6 control mice exposed to PBS; males [n = 2] and females [n = 4]) or chronic exposure at 4–6 months of age [only female mice; n = 8 TgCEL+/−,Cre+/− mice exposed to cerulein, n = 8 TgCEL+/−,Cre+/− mice exposed to PBS, n = 8 control mice exposed to cerulein, n = 8 control mice exposed to PBS) as explained above. These groups of mice were investigated at Joslin Diabetes Center, Boston, USA.
We measured fed and fasting blood glucose levels by a Glucometer Elite (Bayer Health Care) using blood from tail snips. For other analyses, blood was collected in chilled heparinized tubes and centrifuged (5–10 min at 5000 rpm) and the supernatants were collected and stored at −20°C. Plasma insulin and glucagon levels were measured by ELISA using mouse insulin and glucagon standards, respectively (Crystal Chem Inc., Chicago, IL). Blood glucose and plasma insulin levels were measured in the random-fed state between 8∶30 and 11 am or after a 14–16-hr overnight fast. Serum triglyceride levels were measured by colorimetric enzyme assay (GPO-Trinder Assay; Sigma, St. Louis, MO). Free fatty acid levels were measured using the NEFA-Kit-U (Amano Enzyme, Osaka, Japan). Serum amylase was measured by an enzyme assay (Raichem, San Diego, CA).
For glucose tolerance tests (intraperitoneal glucose tolerance tests, ipGTT), mice were fasted overnight (14 hr) and then received intraperitoneal (i.p.) injections of glucose (2 g/kg body weight [b.wt.]). Tail vein glucose was measured as described above at 0, 15, 30, 60, and 120 min after injection. For insulin tolerance tests (ITT), fed mice received i.p. injections of insulin (1 U/kg b.wt. for females, 1.5 U/kg b.wt. for males; Humulin, Lilly, Indianapolis, IN) and tail vein glucose was measured at 0, 15, 30, and 60 min after injection. Stimulated acute-phase insulin secretion tests were performed after an overnight fast (14 hr). Tail vein glucose was measured and blood for insulin analysis collected and treated as described above at 0, 15, 30 and 60 min after an ip injection of either glucose (3 g/kg b.wt.; GSIS) or a combination of glucose in the same dose as above and arginine (0.3 g/kg b.wt., Arg-GSIS).
Fat malabsorption was measured by comparing the fecal excretion of fat and the non-absorbable dietary marker sucrose polybehenate to the ratio of behenic acid to other dietary fatty acids, using gas chromatography analysis as previously described
Islets were obtained by collagenase digestion as previously described
Weight and glucose levels were decided in fed mice before they were anesthetized and ex-sanguinated. Blood was collected and prepared as described above. The pancreas was rapidly dissected and divided into two or three parts. Pancreatic samples to be studied by light microscopy were weighed, fixed in pre-chilled zinc-formalin (Z-Fix), then paraffin-embedded, sectioned, hematoxylin and eosin (HE)-stained, and examined by direct microscopy. Other sections were prepared by immunohistochemical staining for amylase or for insulin, glucagon and somatostatin. Tissue samples for RNA extraction were either directly homogenized in tissue lysis buffer (pancreas), put in RNAlater (Ambion) (liver) or snap frozen (other tissues) and then stored briefly at −80°C.
Immunohistochemical analyses of pancreas sections were performed by methods previously described
We employed two-tailed Student’s t-tests of independent groups with assumption of unequal variances and a significance level of 5%. For the glucose tolerance tests, we performed analyses of variance (ANOVA) for repeated measures, using baseline measurements as a co-variate. For the comparison of the characteristics of the groups of mice after cerulein exposure, we also performed one-way analysis of variance (ANOVA) and used Bonferroni correction for post hoc analyses. Due to non-normal distribution, we used the Mann-Whithney U test for comparisons of islet area. We chose a significance level of 5% and analyzed all data using Stata 11.0 (Stata Statistical Software, Stata Corp., College Station, TX, USA).
We used the Cre-lox system
The TgCEL and control mice showed comparable body weights during development, and a relatively normal life span and behaviour. At seven and nine months of age, there were no significant differences in mean body weights between TgCEL and control mice (
Controls, white bars or open circles; TgCEL mice, black bars or filled circles. Results are given as mean ± SEM. Tail or hind leg vein blood was drawn in after an overnight fast and glucose was measured by glucometer. The characteristics were assessed in chow-fed mice at 7 and 9 months of age, at 12 months of age following 12 weeks on a 60% HFD (all tests: n = 4 [males] and n = 5 [females]), and at 22 months of age in mice that had been chow-fed after the HFD challenge (n = 2 controls, 1 TgCEL [males] and n = 3 controls, 5 TgCEL [females]). There were no statistical differences in body weight between male (A) and female (B) mice. Body weights increased during a 12-week challenge with a 60% HFD, but there were no differences in body weight development between TgCEL and control mice in male (C) and female mice (D). Fasting blood glucose levels also increased after 12 weeks of HFD but there were no differences in fasting blood glucose levels between TgCEL and control mice at any age in male (E) and female mice (F). A glucose tolerance test was performed in male mice (G, H, I, J) and female mice (K, L, M, N) after a 12–14 hr fast by i.p. injection of glucose (2 g per kg bodyweight). The test was performed in chow-fed mice at 7 months (G, K) and 9 months (H, L) of age, at 12 months (I, M) of age following 12 weeks of a 60% HFD. Although the 60% HFD increased glucose intolerance compared to baseline (9 months), there were no differences between TgCEL mice and controls in any of the groups.
Males | Females | |||||
Controls | TgCEL |
|
Controls | TgCEL |
|
|
|
||||||
Total serum cholesterol (mg/dL) | ||||||
Fasting | 125±17 | 106±5 | ns | 88±5 | 92±10 | ns |
Fed | 163±13 | 158±31 | ns | 122±26 | 135±21 | ns |
Serum triglycerides (mg/dL) | ||||||
Fasting | 107±13 | 92±8 | ns | 77±14 | 74±12 | ns |
Fed | 119±18 | 111±16 | ns | 70±23 | 71±22 | ns |
Free fatty acids (mEq/L) | ||||||
Fasting | 1.6±0.1 | 1.4±0.2 | ns | 1.0±0.1 | NA | |
Fed | 1.3±0.2 | 1.1±0.2 | ns | 1.0±0.2 | 0.9±0.2 | ns |
|
||||||
Serum amylase, fasting | 1344±114 | 1197±101 | ns | 1057±90 | NA | |
Fat absorption (%) | 94±2 | 93±2 | ns | 98±0,46 | 99±0,27 | ns |
Fat excretion (%) [60%HFD, n = 2] | 4.5±1.0 | 8.1±0.9 | ns | 7.5±1.6 | 6.0±0.1 | ns |
Fecal elastase (milliU/g) | 8.9±3.0 | 7.5±2.1 | ns | 14.2±4.7 | 21.1±7.4 | ns |
Vitamin A, retinol (µg/dL) | 38±7 | 30±3 | ns | 18±1,2 | 18±0,42 | ns |
Vitamin E, α-tocopherol (µg/dL) | 387±37 | 371±22 | ns | 462±30 | 432±32 | ns |
Vitamin E/total cholesterol ratio | 3.0±0.4 | 2.6±0.3 | ns | 3.6±0.23 | 3.7±0.72 | ns |
Values are mean ± SEM; ns, not significant; NA, not available.
Following a 60% HFD, TgCEL mice gained weight to the same extent as controls (with a weight gain in male mice of 57% for TgCEL and 55% for control mice, and in female mice of 81% in TgCEL and 114% in control mice;
Controls, white bars or open circles; TgCEL mice, black bars or filled circles. Results are given as mean ± SEM. Insulin was measured by ELISA. An insulin tolerance test was performed by i.p. injection of insulin (1.5 [males] or 1.0 [females] U/kg b.wt.) in 12 months old male (A) and female (B) mice. No differences were detected between the TgCEL and control mice. For 7 months old chow-fed mice, there were no statistical differences in fed or fasting plasma insulin levels in male (C) or (D) female mice. Similarly, we observed no differences in stimulated plasma insulin levels in female mice as demonstrated by a glucose-stimulated insulin secretion test by actual insulin values (E) or by percent change after glucose injection (F). Islet size and number as well as the organization of the exocrine pancreatic tissue were normal in HE-stained sections from TgCEL mice (G) and not different from controls (H) at 8 months of age.
There were no significant differences in serum glucose levels prior to short-term cerulein exposure between the four groups TgCEL/PBS, Control/PBS, TgCEL/Cerulein and Control/PBS (ANOVA p-value 0.56, mean glucose levels of 71±12, 65±8.9, 65±18, 73±8.8 mg/dl for the four groups, respectively). The serum amylase levels and pancreatic weight increased in the mice exposed to cerulein (ANOVA p<0.05) but there were no significant differences between the TgCEL and control mice (
(A) Serum amylase levels by the time of sacrification of the mice. (B) Pancreatic weight (grams) by the time of sacrification of the mice. (C) Pancreatic morphology in TgCEL or Control mice injected with cerulein or with PBS (HE staining).
At the end of the long-term cerulein exposure there was a borderline significant difference in weight development between the four groups TgCEL/PBS, Control/PBS, TgCEL/Cerulein and Control/PBS, although post hoc analyses did not reveal significant differences between any of the groups (
(A) Weight (grams) development during the chronic cerulein protocol in TgCEL mice and control mice subjected to cerulein or PBS. (B). Serum glucose levels during an intraperitoneal glucose tolerance test at the time of completion of the chronic cerulein protocol. (C) Pancreatic morphology in TgCEL or control mice injected with cerulein or with PBS (HE staining).
PBS | Cerulein | ||||
TgCEL | Control | TgCEL | Control | ANOVA p | |
|
|||||
Insulin(pg/mL) | 638±751 | 194±103 | 413±321 | 3668±9828 | 0.49 |
C-peptide (pM) | 490±385 | 455±423 | 430±194 | 328±199 | 0.77 |
Glucagon(pg/mL) | 46±26 | 36±11 | 46±30 | 75±62 | 0.21 |
GLP-1 (pg/mL) | 7±10 | 20±28 | 7±11 | 19±30 | 0.51 |
Amylin(pg/mL) | 14±7 | 13±9 | 18±6 | 16±9 | 0.63 |
We isolated islets from eight TgCEL mice (four males, four females; 4–6 months of age) and sex-matched littermate controls under basal conditions and extracted RNA after an overnight incubation as described in
We have created an over-expressing transgenic mouse model, TgCEL, to study
Next, we confirmed murine pancreatic expression of the human
Human
Several explanations are possible for the absence of a pancreatic phenotype in the TgCEL mice. First, we applied pronuclear injection to create transgenic mice which can result in a multiple array of transgenes
Second, it is possible that an embryonically pancreatic exocrine expression of the disease-associated allele earlier than day e14–e15 achieved with elastase-Cre
In conclusion, we have created a transgenic mouse line, the TgCEL, with pancreas-specific expression of human
(DOCX)
(TIF)
We want to thank Dr. Grippo for kindly providing us with the elastase-Cre mice. We would also like to thank Dr. Stefan Willems for the initial mass spectrometry sample preparation.