The authors have declared that no competing interests exist.
Conceived and designed the experiments: S. Cirera MF CSB MB. Performed the experiments: CSB KHJ MB KBJ EHS HG GDS JRM KMM HL IB ØS AE CR RE JO S. Cirera PSL CD LM MF. Analyzed the data: CSB GDS RE JO PSL S. Cirera MF. Contributed reagents/materials/analysis tools: MB HG JRM KMM HL CR S. Cizinauskas LM. Wrote the paper: CSB KHJ MB GDS JRM MF.
The first cases of early-onset progressive polyneuropathy appeared in the Alaskan Malamute population in Norway in the late 1970s. Affected dogs were of both sexes and were ambulatory paraparetic, progressing to non-ambulatory tetraparesis. On neurologic examination, affected dogs displayed predominantly laryngeal paresis, decreased postural reactions, decreased spinal reflexes and muscle atrophy. The disease was considered eradicated through breeding programmes but recently new cases have occurred in the Nordic countries and the USA. The N-myc downstream-regulated gene (
The first cases of inherited polyneuropathy in Alaskan Malamutes were observed in Norway more than 30 years ago. Polyneuropathy in Alaskan Malamutes is one of several canine inherited neuropathies described in 22 breeds of dog that share many features with the human Charcot-Marie-Tooth (CMT) group of diseases
A novel autosomal recessive HMSN was first described in a small gypsy community of Lom in Bulgaria, and designated Hereditary Motor and Sensory Neuropathy-Lom (HMSNL)
The first cases of polyneuropathy in the Alaskan Malamute population appeared in Norway in the late 1970’s. Onset of signs was noticed in seven- to 18-months-old dogs. Affected dogs were of both sexes. Presenting clinical signs were exercise intolerance, inspiratory stridor and pelvic limb ataxia. Gait abnormalities progressed to ambulatory paraparesis, in some cases deteriorating to non-ambulatory tetraparesis. Additional examinations revealed decreased postural reactions, decreased to absent spinal reflexes, muscle atrophy and laryngeal paresis. On electromyography (EMG) testing, moderately to severely affected dogs and/or protracted cases had diffuse spontaneous activity, such as fibrillation potentials and positive sharp waves, in proximal and distal muscles in all four limbs. In addition, decreased motor nerve conduction velocities were found. The only aberrant finding on electrophysiology testing in mild and/or early cases was spontaneous activity in EMG of interosseus muscles
AMPN was considered to be virtually eradicated in Scandinavia through breeding programmes as new cases had not been reported for many years. However, a case of AMPN was diagnosed in Denmark in 2009, indicating that the disease had reappeared in Scandinavia. Single cases of AMPN had also occurred in Norway and Sweden during the last decade. The Scandinavian Alaskan Malamute Polyneuropathy survey including research partners from Denmark, Norway and Sweden was therefore initiated in 2010 and has later been extended by collaboration with researchers in Finland and the USA. The main focus for this research was to identify the genetic basis for AMPN.
Onset of clinical signs was noticed from the age of three to 19 months, (median, 13.5 months). As presenting clinical signs, voice changes and/or noisy breathing predominated - in some cases in combination with paraparesis. A few affected dogs expressed paraparesis as the only presenting clinical sign. Typically, clinical signs slowly progressed to exercise intolerance, gait abnormalities and inspiratory stridor, suggesting the presence of laryngeal paresis or paralysis. Gradually, gait abnormalities progressed from paraparesis and ataxia to tetraparesis and abnormal pelvic limb movements of a “bunny-hopping” nature. Many of the affected dogs had difficulty standing and walking up stairs and eventually collapsed. With progression of the disease, the dogs developed muscle atrophy, primarily in the pelvic limbs, but also in the paraspinal musculature. Electrophysiology testing was in accordance with the results reported by Moe and Bjerkås
Characteristic histopathological findings in the cranial tibial muscle and fibular nerve are shown from two Alaskan Malamutes (
Representative cranial tibial muscle and peroneal nerve biopsy transverse sections from a two year old female Alaskan Malamute (a,b) and a three year old female Alaskan Malamute (c,d) with histopathological findings consistent with polyneuropathy. Large and small groups of atrophic fibers were present with variable severity and fatty infiltration (a,c. H&E stain). A moderate to marked depletion of myelinated fibers was evident in resin embedded nerve biopsy sections (b,d. Toluidine blue stain). Nerve fiber loss resulted from chronic axonal degeneration (arrows in b,d).
Since
Alignment of NDRG1 protein sequences from five mammalian species: Homo sapiens, Pan troglodytes, Canis lupus, Bos taurus and Mus musculus shows a sequence similarity of 94.7%. Residue 98 (gly, marked with a frame) which is substituted in Alaskan Malamutes with the G>T mutation, is conserved in the five species.
A total of 102 Alaskan Malamute dogs from Denmark, Norway, Sweden, Finland and the USA known to be either healthy (n = 73), obligate carriers (healthy parents of affected offspring) (n = 7) or diagnosed with AMPN (n = 22) were genotyped for the G>T substitution. All affected Alaskan Malamutes had the T/T genotype. The healthy dogs had the G/G genotype except for 13 which had the G/T genotype. All obligate carriers had the G/T genotype. These results indicate complete co-segregation of the mutation with the disease according to an expected autosomal recessive mode of inheritance. Another 201 dogs representing 38 other breeds all had the G/G genotype (see
Identification of the genetic basis for AMPN will allow for establishment of an appropriate breeding programme and is therefore beneficial to the general health of the Alaskan Malamute breed. Moreover, this study also highlights the advantages of dogs for comparative genetic studies. Dogs are medically surveyed on a regular basis and the dog population consists of several partially inbred breeds with known, and from time to time new, genetic disorders segregating in most of the breeds. When considering the extensive amount of dog genome resources and rapidly increasing technologies, canine disorders have a great potential for serving as models for analogous human diseases
Various forms of inherited motor and sensory neuropathies have been identified in 22 different dog breeds over the past 50 years
Our results and observations support the theory that the mutation identified in Alaskan Malamutes causes AMPN: The clinical signs in Greyhound dogs and Alaskan Malamutes with polyneuropathy are comparable. The nonsynonymous G>T substitution causes the substitution (Gly98Val) of a residue that is conserved in mammals and this mutation was predicted to be “probably damaging” by PolyPhen-2. It is therefore reasonable to expect this substitution to have an effect on the function of the protein.Affected dogs were homozygous for the mutation, obligate carriers were heterozygous and healthy dogs were homozygous for the wild type allele (except for 13, which were heterozygous). This is in concordance with autosomal recessive inheritance and also supports the result of the test mating made in Norway in 1983
Rentmeister
A mouse model,
Inherited polyneuropathy in Greyhound dogs may have an earlier clinical onset (three to nine months) compared to both the AMPN cases of this study (three to 19 months, median: 13.5 months) and in previous studies (seven to 19 months)
We conclude that the G>T substitution is almost certainly the mutation that causes AMPN.
Since the same mutation is found in affected Alaskan Malamutes from Denmark, Norway, Sweden, Finland and USA, it must have arisen years ago in a common founder. It is therefore reasonable to believe that the same mutation has also caused AMPN in the first Alaskan Malamutes diagnosed by Moe and Bjerkås
All samples were collected by veterinarians from privately owned dogs with consent from the dog owners and in accordance with the institutional guidelines for animal welfare and ethics. No ethics committee approval was required as the study was conducted in cooperation with veterinarians at small animal clinics and all diagnostic procedures would have been carried out anyway.
A total of 102 Alaskan Malamute dogs from Denmark, Norway, Sweden, Finland and the USA known to be either healthy (control), obligate carriers or diagnosed with AMPN were included in the study. Control dogs and obligate carriers were checked by veterinarians in the research group. None of those dogs displayed any neurological gait deficits. Affected dogs (n = 22) had a clinical presentation in accordance with AMPN, as described in the results section (clinical characterization). Electrophysiology testing, performed in 16 affected dogs, was consistent with polyneuropathy. In addition, in the majority of the cases the diagnosis was confirmed by histopathology on nerve- and muscle biopsies (n = 13) or post mortem samples of the same tissues (n = 1). Moreover, a panel of 201 DNA samples representing 38 different dog breeds (see
Another four Alaskan Malamutes (two from Norway, two from the USA) were presented to veterinarians in the research group for neurological problems, but were excluded from this study. They were all diagnosed with diseases other than AMPN, explaining their neurological signs (cauda equina syndrome, cervical cord lesion, diabetes and inflammatory polyneuropathy respectively) but were genotyped anyway.
Biopsies (cranial tibial muscle and fibular nerve) were collected under general anesthesia or in conjunction with euthanasia using an open biopsy procedure. Unfixed muscles were shipped under refrigeration by an express service to a specialized laboratory. Following receipt of tissues, unfixed muscles were flash frozen in isopentane pre-cooled in liquid nitrogen and stored at −80°C until further processed. Following cryosectioning, a standard panel of histochemical stains and reactions including fiber typing was performed on each muscle
EDTA stabilized blood samples were collected from 297 of the dogs. DNA was extracted using a salt precipitation method
Each of the 15 exons were PCR amplified one by one in one affected and one healthy dog as described previously
After euthanasia of two Belgian Shepard dogs (not affected with polyneuropathy), brain tissue was sampled and snap frozen in liquid nitrogen. RNA was isolated using Qiagen RNeasy Lipid Mini kit (Qiagen, GmbH, Hilden, Germany) following the manufacturer’s recommendations. cDNAs were synthesized from 1 µg of total RNA using ImProm-II™ Reverse Transcription System (Promega, Madison, Wisconsin, USA) and a mixture of random hexamers: oligodT in a ratio of 3∶1, according to the manufacturer’s recommendations.
For amplification of the
Two sequencing reactions, one for each primer, were made for all PCR products using Big Dye® Terminator v3.1 Cycle Sequencing Kit, Applied Biosystems (Foster City, California, USA) following the manufacturer’s instructions. The sequencing products were purified using Millipore™ Montage SEQ96 Sequencing Reaction Cleanup Kit (Billerica, Middlesex County, Massachusetts, USA) according to the manufacturer’s instructions. Sequencing was performed using ABI PRISM® 3130 Genetic Analyzer, Applied Biosystems (Foster City, California, USA).
For the sequence assembly, analysis, SNP detection and translation of the cDNA sequence, DNASTAR Lasergene® SeqMan Pro™ (Madison, Wisconsin, USA) was used. PolyPhen-2
For genotyping of the remaining dogs, a TaqMan assay was designed by Applied Biosystems (Foster City, California, USA) using the following sequence: ACCCAGATGTATTCTTGCCCTACTTGTGCCTCTTCTCTCTCTCCCCTGCCTGTTCTCCAGACAAAACCTGCTACAACCCCCTCTTCAACTCTGAGGACATGCAGGAGATCACACAGCACTTCGCCGTCTGCCATGTGGATGCCCCTG(G/T)CCAGCAGGACGGCGCTGCCTCCTTCCCTGTGGGGTAAGACCCGGAGCCTTGTCCCCAGGAGGGGGACAAGAAAGCCACGCGGGTGGACTGGGGGTGGGGGGTGCGAAGGCAGGCATCACACTGAGT Genotyping was performed according to the manufacturer’s instructions.
(DOC)
Special thanks to Minna Jakobsen for technical assistance and to Mette Juul Jacobsen for assistance with the sequence analysis. We are also grateful to all dog owners, breeders, national Alaskan Malamute breed clubs and veterinarians who have contributed with information and samples.