PLoS ONEplosplosonePLoS ONE1932-6203Public Library of ScienceSan Francisco, USAPONE-D-10-0181310.1371/journal.pone.0016850Research ArticleBiologyBiochemistryLipidsFatty acidsLipid metabolismEnzymesBiotechnologyMicrobiologyBacteriologyBacterial biochemistryApplied microbiologyMolecular cell biologyCell adhesionMedicineInfectious diseasesBacterial diseasesMycobacteriumInfectious DiseasesMicrobiologyBiotechnologyCell BiologyBiochemistryDiversity in Functional Organization of Class I and Class II Biotin
Protein LigaseClass I and II BPLsPurushothamanSudha1AnnamalaiKarthikeyan1TyagiAnil K.3SuroliaAvadhesha12*Molecular Biophysics Unit, Indian Institute of
Science, Bangalore, IndiaNational Institute of Immunology, Aruna Asaf
Ali Marg, New Delhi, IndiaDepartment of Biochemistry, University of
Delhi South Campus, New Delhi, IndiaCardonaPere-JoanEditorFundació Institut Germans Trias i Pujol, Universitat
Autònoma de Barcelona CibeRES, Spain* E-mail: surolia@nii.res.in
Conceived and designed the experiments: SP AS. Performed the experiments: SP
AT. Analyzed the data: SP AS AT. Contributed reagents/materials/analysis
tools: AS. Wrote the manuscript: SP AS.
The authors have declared that no competing interests exist.
201133201163e16850298201016120112011Purushothaman et alThis is an open-access article distributed
under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the
original author and source are credited.
The cell envelope of Mycobacterium tuberculosis
(M.tuberculosis) is composed of a variety of lipids
including mycolic acids, sulpholipids, lipoarabinomannans, etc., which impart
rigidity crucial for its survival and pathogenesis. Acyl CoA carboxylase (ACC)
provides malonyl-CoA and methylmalonyl-CoA, committed precursors for fatty acid
and essential for mycolic acid synthesis respectively. Biotin Protein Ligase
(BPL/BirA) activates apo-biotin carboxyl carrier protein (BCCP) by biotinylating
it to an active holo-BCCP. A minimal peptide (Schatz), an efficient substrate
for Escherichia coli BirA, failed to serve as substrate for
M. tuberculosis Biotin Protein Ligase
(MtBPL). MtBPL specifically biotinylates
homologous BCCP domain, MtBCCP87, but not
EcBCCP87. This is a unique feature of
MtBPL as EcBirA lacks such a stringent
substrate specificity. This feature is also reflected in the lack of
self/promiscuous biotinylation by MtBPL. The N-terminus/HTH
domain of EcBirA has the self-biotinable lysine residue that is
inhibited in the presence of Schatz peptide, a peptide designed to act as a
universal acceptor for EcBirA. This suggests that when biotin
is limiting, EcBirA preferentially catalyzes, biotinylation of
BCCP over self-biotinylation. R118G mutant of EcBirA showed
enhanced self and promiscuous biotinylation but its homologue, R69A
MtBPL did not exhibit these properties. The catalytic
domain of MtBPL was characterized further by limited
proteolysis. Holo-MtBPL is protected from proteolysis by
biotinyl-5′ AMP, an intermediate of MtBPL catalyzed
reaction. In contrast, apo-MtBPL is completely digested by
trypsin within 20 min of co-incubation. Substrate selectivity and inability to
promote self biotinylation are exquisite features of MtBPL and
are a consequence of the unique molecular mechanism of an enzyme adapted for the
high turnover of fatty acid biosynthesis.
This work was supported by Centre of Excellence grant from the Department of
Biotechnology (DBT), Government of India to A.S. and by another Department of
Science & Technology (DST), Government of India grant to A.S. A.S. is also a
J.C. Bose Fellow of the Government of India. The funders had no role in study
design, data collection and analysis, decision to publish, or preparation of the
manuscript.Introduction
Mycobacterium tuberculosis has become resistant to most drugs. The
cell wall, composed of almost 60% lipids that are long chain, branched fatty
acids, is highly hydrophobic and hence refractory to several components of human
defense system. It also provides an effective permeability barrier against several
anti-mycobacterial agents [1]–[3]. The rich diversity of lipids present in M.
tuberculosis is reflected at the genomic level by a large repertoire of
genes for lipid biosynthesis. M. tuberculosis, for example, has
∼300 enzymes involved in lipid synthesis while E. coli has only
about 50 [4]–[7].
Biotin-dependent enzymes are involved in carboxylation and decarboxylation reactions.
Acyl CoA carboxylases (ACC) catalyze biotin-dependent carboxylation of nascent
molecules such as acetyl-CoA, propionyl-CoA etc. These carboxylases are
multi-subunit, multi-domain proteins consisting of α and β subunits.
M. tuberculosis has three copies of α-subunits which are
composed of a N-terminus biotin carboxylase (BC) and a C-terminus biotin carboxyl
carrier protein (BCCP). All biotinyl domains so far reported have a target lysine at
−35th residue from C-terminus for biotinylation [8]. Hence, a protein
composed of C-terminus 87 amino acids of acc is an efficient
substrate for Biotin Protein ligase [8]. The β-subunit has carboxyl transferase (CT) activity
[8]. Biotinylation
of BCCP is catalyzed by Biotin Protein Ligase (BPL) which promotes an amide linkage
between the carboxyl group of biotin and the ε-amino group of a specific lysine
residue nestled within a conserved ‘AMKM’ sequence of BCCP.
Biotinylation converts inactive apo-BCCP to functional holo-BCCP that participates
in the transcarboxylation reaction [9], [10]. Thus, BCCP has two
functions - mechanistic by serving as carboxyl carrier
in overall carboxylation reaction and structural, by
swinging carboxybiotin to the carboxyl transferase component of ACC. BC carboxylates
the ureido nitrogen atom of biotin covalently bound to BCCP which moves
{CO2}-biotin to the active site of carboxyl transferase (CT), for the
transfer of a carboxyl group to acetyl or propionyl CoA [11], [12]. The entire sequence of
carboxylation reaction and the key role played by BCCP is schematically represented
in Figure 1.
10.1371/journal.pone.0016850.g001
Schematic outline of the functional cycle of the BCCP subunit of acetyl
CoA carboxylase.
The BCCP is involved in three homologous protein-protein interactions with
the Biotin Protein Ligase (BPL), Biotin carboxylase (BC) and Carboxyl
transferase (CT).
In spite of a highly conserved function, BCCPs display unique features for their
respective biotinylating enzymes. In solution, apo-BCCP (E. coli,
Pyrococcus horikoshii) is a flattened β- barrel structure
comprising of two four-stranded β sheets [12], [13]. In most BCCPs, the
biotinable lysine is nestled within the conserved tetrapeptide ‘AMKM’
sequence in an exposed β-turn of BCCP domain. However, in Sulfolobus
tokodaii, the canonical lysine residue within the sequence
‘AMKS’ was not biotinylated by EcBirA [14], [15]. In
Aquifex aeolicus (AaBPL), the target lysine is
within the ‘ALKV’ sequence [16]. BCCP of M.
tuberculosis (MtBCCP) is part of a multi-domain
enzyme, biotin carboxylase and this probably alters its dynamics with the cognate
enzyme, MtBPL.
MtBPL belongs to class I BPLs which lack a DNA binding domain at
their N-termini unlike the class II BPLs (e.g. EcBirA) hence are
devoid of repressor function exhibited by class II BPLs [17]–[19]. Our previous study showed
that the two enzymes differ in several ways from structural organization to ligand
interactions [20]. EcBirA can biotinylate BCCPs of other
species. MtBPL as shown in this study, in contrast, to
EcBirA exhibits exquisite substrate specificity. The
differences in their activities are correlated here with their intrinsic metabolic
functions.
ResultsProtein purification
It has been reported that the C-terminus domain of BCCP (apo-BCCP87),
does not self-associate and was a good substrate for biotinylation reaction
[11],
[12].
Hence EcBCCP87 and
MtBCCP87 expressed in pET28a were used for
avidin blot assays. The BCCP was purified by Ni-NTA column chromatography. The
apo form was separated from the holo form using a Mono Q column pre-equilibrated
with 10 mM Tris-HCl buffer (pH- 8.0) prior to the elution of the protein with a
salt gradient (0–100% 10 mM Tris-HCl pH-8.0, 1 M NaCl). Fractions
containing apo-BCCP were checked on avidin blot, pooled and dialyzed against 10
mM Tris-HCl pH 8.0, 50 mM KCl, 2.5 mM MgCl2 (standard buffer). Thus
∼95% of the purified
MtBCCP87/EcBCCP87was
found to be in their apo form. The biotinylation reaction was found to be
dependent on Mg2+, ATP and biotin. BCCP and BPL were dialyzed
against the standard buffer prior to use.
For self-biotinylation assays, BL21 containing EcBirA construct
was grown in M9 media supplemented with 2% glucose for 5 h and induced
for 3 h to prevent endogenous self-biotinylation. The eluted protein was
dialyzed, concentrated and dialyzed against standard buffer.
Domain architecture of Biotin protein ligase
The domain structure of MtBPL and EcBirA was
obtained from pfam (Figure
2) [21].
The different domains of BPL are:
10.1371/journal.pone.0016850.g002
Domain architecture of Class I and II BPLs.
The domains were designed from pfam results. MtBPL
belongs to Class I and EcBirA belongs to Class II
family of BPLs.
HTH
The helix-turn helix domain.
BPL_LipA_ LipB
This family includes biotin protein ligase, lipoate-protein ligase A and
B.
BPL C
The C-terminus domain has a SH3-like barrel fold, the function of which is
unknown. BPL family is a member of clan TRB
(Transcriptional repressor beta-barrel domain).This beta-barrel domain is
found at the C-terminus of a variety of transcriptional repressor proteins.
As shown in the Figure
2, Biotin Protein Ligase of M.tuberculosis lacks the
N-terminus HTH domain and hence does not function as a repressor.
Substrate specificity of MtBPL
The molecular behavior of MtBPL and EcBirA are
different due to the presence of an additional repressor function in
EcBirA. It has been documented that EcBirA
biotinylates BCCPs from other species except the one from S.
tokadii[15]. In fact,
EcBirA efficiently biotinylated the synthetic biotinable
minimal peptide of sequence ‘GLNDIFEAQKIEWH’ (Schatz peptide) which
is known to be a good substrate for BPLs (Figure 3b). In contrast,
MtBPL failed to biotinylate Schatz peptide (Figure 3a). Subsequently, we
investigated the ability of MtBPL and EcBirA
to cross biotinylate EcBCCP87 and
MtBCCP87. BCCPs (5 µM) were incubated with
500 µM biotin, 3 mM ATP, 100 nM EcBirA or
MtBPL for 30 min at 37°C. EcBirA
efficiently biotinylated both the BCCPs but MtBPL selectively
biotinylated its cognate substrate (MtBCCP87) alone
and failed to biotinylate EcBCCP87 (Figure 3c).
10.1371/journal.pone.0016850.g003
Biotinylation by MtBPL or
EcBirA.
(a) Mass spectrum of Schatz peptide incubated with 500 µM biotin, 3
mM ATP and 100 nM MtBPL or EcBirA in
standard buffer. (b) Mass spectrum of Schatz peptide incubated with 500
µM biotin, 3 mM ATP and 100 nM EcBirA in standard
buffer. (c) Avidin blot of biotinylation of BCCP catalyzed by BPL. The
reaction was carried in standard buffer (10 mM Tris-HCl pH-8.0, 50 mM
KCl, 2.5 mM MgCl2) containing 3 mM ATP, 500 µM biotin,
2.5 mM MgCl2, 0.1 mM dithiothreitol, and 100 nM BPL and 5
µM BCCP87 for 30 min at 37°C. The reaction mixture
was then resolved on a 10% SDS PAGE and transferred to
nitrocellulose membrane. The membrane was then incubated with
streptavidin HRP for 1 h at room temperature and developed with
AEC/H2O2 (1) marker; (2)
EcBCCP87+MtBPL; (3)
MtBCCP87+MtBPL; (4)
EcBCCP87+EcBirA;
(5)
MtBCCP87+EcBirA.
Self-biotinylation of EcBirA
When substrate specificity of BPLs was explored, at higher enzyme concentration,
a protein with molecular weight corresponding to EcBirA was
detected on avidin blot indicating that EcBirA undergoes
self-biotinylation. This is consistent with the report of Choi-Rhee et
al[22].
Therefore, we investigated if MtBPL was capable of
self-biotinylation like its counterpart in E. coli. MtBPL or
EcBirA (250–2000 nM) were subjected to biotinylation
reaction for 1 h in the absence of BCCP. The biotinylation mixture was resolved
on 12% SDS-PAGE, transferred onto nitrocellulose membrane and detected by
streptavidin HRP. The control, EcBirA was self-biotinylated at
concentration as low as 500 nM (Fig S1). In contrast, MtBPL
did not undergo self-biotinylation even at 2000 nM (Lane 2–6, Fig S1).
Hence, our focus was to study the implications of the lack of self-
biotinylation in MtBPL.
EcBirA has an additional N-terminus HTH domain which contributes
to the repressor function of the protein (Figure 2). Earlier reports suggested that
truncated EcBirA (Δ1–34) was enzymatically active but
did not undergo self-biotinylation [22]. This suggested that the
N-terminus probably carries the biotinable residues. So, the N-terminus domain
(1–65 amino acids) was independently cloned in pGEX4T-1. The fused GST-HTH
domain of EcBirA (pGEN1) was subjected to biotinylation using
enzymatic concentration of 100 nM
MtBPL/EcBirA. The fused protein was
biotinylated by full length EcBirA (Figure 4). The control GST protein was not
biotinylated by EcBirA. This confirms that the self-biotinable
lysine is within the N-terminus/HTH domain of EcBirA. It also
suggests that the catalytic and self biotinable domain require no physical
contiguity for the covalent modification. Hence, this construct was used to
investigate if the lack of self biotinylation in MtBPL was
because (i) MtBPL lacks the N-terminus domain or (ii) the
enzyme was deficient in promoting self-biotinylation. MtBPL
failed to biotinylate HTH–GST fusion protein (pGEN1) but
EcBirA efficiently biotinylated the fusion protein. This
suggests that the mere presence of self - biotinable residue does not confer
MtBPL an ability to self biotinylate. Furthermore,
non-specific proteins such as BSA was biotinylated by EcBirA
but not by MtBPL (Fig S2). This clearly reinstates that
MtBPL does not catalyze indiscriminate biotinylation. Thus,
the inability of MtBPL to undergo self-biotinylation could be
attributed to two factors: absence of an HTH domain and
a stringent catalytic specificity of the enzyme. (Figure 4).
10.1371/journal.pone.0016850.g004
Biotinylation of GST-HTH domain by EcBirA or
MtBPL.
5 µM fusion protein was incubated with 500 µM biotin, 3 mM
ATP, 100 nM EcBirA in standard buffer for 1 h. The
sample was then resolved on 10% SDS-PAGE and transferred to
nitrocellulose membrane and the biotinylated protein was detected by
streptavidin HRP and H2O2. (1) marker ; (2)
GST-HTH fusion protein (pGEN1)+100 nM EcBirA; (3)
GST-HTH fusion protein (pGEN1)+50 nM EcBirA (4)
GST – HTH fusion protein+100 nM MtBPL.
Competitive inhibition of self - biotinylation by Schatz peptide
The intermediate molecule, bio-5′AMP, appears to play a central role in
several processes. We investigated if bio-5′AMP was preferentially used
for self-biotinylation of HTH domain or biotinylation of biotin acceptor
molecule. For this, self-biotinylation of EcBirA was performed
in the presence of saturated concentration of Schatz peptide or
BCCP87 (5 µM). EcBirA failed to undergo
self-biotinylation or promote biotinylation of heterologous HTH (pGEN1) domain
in the presence of excess biotin acceptor molecule such as Schatz peptide (Figure 5). Indeed, the
bio-5′AMP synthesized was used for biotinylation of biotin acceptor
molecules, Schatz peptide and BCCP, rather than for self-biotinylation. Also to
confirm that the covalently modified self-biotinylated EcBirA
was dialyzed to remove unbound biotin and ATP and then incubated with Schatz
peptide. The covalently modified self-biotinylated EcBirA
failed to endogenously biotinylate Schatz peptide. However, the addition of
biotin and ATP to previously self-biotinylated EcBirA led to
the conversion of apo-Schatz peptide to biotinylated form (Fig
S3).
10.1371/journal.pone.0016850.g005
Competitive inhibition of GST-HTH protein and EcBirA
in the presence of excess amount of Schatz peptide.
GST-HTH (5 µM) was incubated with biotin, ATP and 100 nM
EcBirA or EcBirA (2 µM) was
incubated with biotin, ATP in the presence/absence of Schatz peptide for
1 h at 37°C. The biotinylated proteins were detected by streptavidin
HRP. (1) Protein marker; (2) GST-HTH protein; (3) GST-HTH+Schatz
peptide; (4) EcBirA; (5)
EcBirA+Schatz peptide.
Mutation analysis
Choi-Rhee et al have shown that the affinity of R118G mutant of
EcBirA for biotin decreased by ∼100 fold and the
self-biotinylation increased several fold [22]. However, for the
homologous R69A mutant of MtBPL the binding constant for biotin
was nearly the same as that observed for the wild type protein (data not shown)
. Also, the R69A mutant of MtBPL did not undergo
self-botinylation (Lane 12, Figure S1). This highlights the differences
in the structural and functional organization of EcBirA and
MtBPL.
Limited proteolysis
Purified MtBPL was subjected to proteolytic digestion with
protease trypsin for 20 min and the products were analyzed on 12% SDS
PAGE in order to define the domain boundaries within the enzyme. The enzyme was
subjected to limited proteolysis in the presence and absence of biotin and
MgATP. Trypsin generated two fragments, one of about ∼8.2 kDa and the other
of ∼21 kDa as determined by N-terminus sequencing and SDS-PAGE (Figure 6a, b). The ∼8.2
kDa has an N terminus His-tag which was identified by its reactivity with the
anti-His antibody. Also, the ∼8.2 kDa fragment was susceptible to further
proteolysis. The N-terminus sequencing of these products revealed the cleavage
occurred between Arg-72 and Gly-73 for trypsin. Since these cleavage points are
located around the conserved biotin binding site (GRGRHGR),
MtBPL was subjected to proteolytic digestion in the presence of
saturating amounts of the substrates, biotin and ATP as well as both of them
together. Incubation with ATP did not alter the cleavage by trypsin with
83% of the protein being digested. Incubation with biotin did reduce the
proteolysis with nearly 40% of the protein intact. However, incubation of
MtBPL with both biotin and ATP completely protected nearly
all the protein from proteolytic digestion by trypsin. This was also observed
when the protein was pre-incubated with chemically synthesized bio-5′AMP.
In fact the intermediate molecule, biotinyl-5′AMP protected the protein
from proteolytic digestion for over 24 h. Thus, when biotin and ATP were
pre-incubated with the enzyme, biotinyl-5′AMP was synthesized and this
intermediate molecule protected the protein from proteolysis by binding to the
active site of the enzyme. MtBPL was incubated with saturating
amounts of biotin and non-hydrolyzable ATP analogue AMPpNpp and then treated
with trypsin. The protein showed reduced protection against the protease as the
non-hydrolyzable ATP analog failed to synthesize biotinyl-5′AMP. Taken
together, these results suggest that the binding of the substrates and/or the
formation of the intermediate, biotinyl-5′AMP, protects BPL from protease
cleavage.
10.1371/journal.pone.0016850.g006
Limited proteolysis of MtBPL by trypsin.
MtBPL (10 µM) was incubated with trypsin at 1;100
concentration for 30 min . The digested samples were resolved on a
10% SDS PAGE and the pattern observed by Coomassie blue stain..
The enzyme was pre-incubated with the substrates for 30 min prior to
proteolysis by trypsin. Molecular weight marker (2) BPL, no trypsin (3)
BPL (4) BPL+ATP (5) BPL+biotin (6) BPL+biotin+ATP
(7) BPL+biotin+non-hydrolyzable AMP pNPP (8)
BPL+bio-5′AMP. (b) The percentage of digestion during a
period of 2 h. MtBPL was pre-incubated with substrates
500 µM biotin, 3 mM ATP, biotin+ATP, 10 µM
bio-5′AMP for 30 min and then subjected to proteolysis by
incubating with trypsin for 20 min.
Discussion
Acetyl CoA carboxylase of M. tuberculosis belongs to the class of
heteromeric ACCases which are multi-domain, multi-subunit enzyme.
The subunit assembly of accA3 and accD6 complex in
association with ε- subunits has been studied in detail [8]. The BCCP domain of heavier α
(accA) subunit interacts with three distinct heterologous
proteins; BCCP-BC, BCCP-CT and BCCP-BPL. Considering the complexity of the cell wall
of M. tuberculosis, it is not surprising that the pathogen has so
many of these enzymes with biotinyl domains.
BCCP is a key player in carboxylation and transcarboxylation reactions which shuttles
carboxyl group from BC to CT of ACC to initiate fatty acid elongation. As a prelude
to carboxylation of biotin to transcarboxylation of acyl-CoA, BPLs must selectively
interact with BCCP. Relating structure to function of a protein that participates in
multiple interactions is fraught with difficulties [23], [24]. From the crystal structures of
PhBCCP and EcBCCP, it was evident that target
lysine is located at the type 1 β- turn [11], [25]. In most
post-translational modifications, the primary structure surrounding target residue
is critical. But from the biotinylation results of this study it is apparent that
while the motif is necessary it is not enough for biotinylation. Indeed failure of
MtBPL to biotinylate EcBCCP87 is
consistent with this argument. Hence, specific conformational feature(s) around the
motif are necessary for biotinylation of the acceptor domain.
We reported earlier that BCCP domain of accA1 was efficiently
biotinylated and hence probably participates in the acetyl CoA carboxylase activity
[20].
M. tuberculosis has three BCCP domains each one belonging to a
biotin carboxylase paralog. Our interest was to study the specificity of
MtBPL for the reactive biotinable lysine residue(s). This was
of interest especially considering that EcBirA could biotinlate
BCCP from S. cerevisiae. Our study clearly defines the substrate
specificity of MtBPL. The gram positive protein ligase could not
biotinylate Schatz peptide or EcBCCP at all the conditions tested.
In contrast, EcBirA could biotinylate Schatz peptide and also
MtBCCP showing broad substrate specificity. Association of BirA
–BCCP is complex and in E. coli, a
cysteine residue in the conserved hydrophobic patch (LCIV) of β4-β5 turn
promotes dimerization of apo-EcBCCP. On biotinylation, the cysteine
residue is buried contributing to monomerization of holo-EcBCCP
[12]. However,
PhBCCP and MtBCCP lack this crucial cysteine
residue. The C-terminus of BPL undergoes relatively large conformational changes to
accommodate BCCP [13]. The BCCP domains from different species have varied
structural organization to interact with their homolgous enzyme(s) [26], [27]. Display of a
stringent specificity for its substrate is probably very critical for
MtBPL due to the presence of different paralogs of BCCPs
(accA1, accA2, accA3) in its
genome.
While Choi Rhee et al showed that R118G mutant of
EcBirA promotes self- biotinylation and also biotinylates BSA,
we show that wild type EcBirA itself at higher concentration of ATP
and biotin exhibited self-biotinylation. It also promoted promiscuous biotinylation
of BSA. In contrast, MtBPL did not undergo self- biotinylation nor
promote appreciable promiscuous biotinylation of BSA (Fig S1, S2, and S3).
Certain BPLs have a flexible active site domain that accommodates different
substrates. Though EcBirA and MtBPL share
considerable sequence homology they differ in their activities in a fundamental
manner. A profound difference between EcBirA and
MtBPL is self-biotinylation exhibited by the former enzyme. The
N-terminus domain (HTH domain) of EcBirA is the site of self-
biotinylation. Δ1–34 EcBirA failed to undergo
self-biotinylation [22]. Also, biotinylation of heterologus pGEN1 (1–65
amino acid N-terminus domain of EcBirA) confirmed that HTH domain
had the self- biotinable lysine residue. As mentioned earlier,
MtBPL failed to undergo self-biotinylation probably because it
lacks the HTH (repressor) domain. Sequence analysis showed that
EcBirA, PhBPL and AaBPL have
18, 25 and 16 lysine residues compared to
just 2 residues in MtBPL. The two lysine residues of
MtBPL are within the conserved ‘KWPND’ and
‘KIAGLEV’motifs and are probably part of the active site. The invariant
lysine within the KIAGLEV plays an essential catalytic role during synthesis of
bio-5′AMP and the KWPND shares the motif with streptavidin. Thus, the lack of
self-biotinylation in MtBPL is due to the absence of a biotinable
lysine residues. The specific lysine residues involved in the self-biotinylation of
the HTH domain are currently under investigation in our laboratory. In biotinylation
of BCCP, an electrostatic interaction between negative phosphate group of
bio-5′AMP and positively charged lysine of BCCP are key elements. The
uncharged lysine in BCCP is deprotonated by aspartate residues of
EcBirA which promotes a nucleophilic attack on the
electrophilic carbonyl group of bio-5′AMP leading to covalent modification
[27]. It is
possible that a similar mechanism promotes self-biotinylation of HTH domain of
EcBirA. However, the self-biotinable residues in BPLs may not
have sufficient accessibility and reactivity for accepting biotin and hence require
longer incubation which perhaps accounts for a lag period of 1 h.
Intermolecular interaction of BPL and BCCP probably allows for
a snug fit which in turn promotes a fast and efficient covalent modification of the
acceptor target lysine in BCCPs. On the other hand intramolecular
folding of BPL initiated by bio-5′AMP may impart steric hindrance which
probably restrains orientation of the adenylate towards the self-biotinable
lysine.
Intramolecular folding in EcBirA enables deprotonation of
self-biotinable/promiscuous biotinable lysine residue leading to its covalent
modification. However, the transition state of MtBPL probably
selects the specific acceptor molecule which in turn explains its stringent
specificity for its cognate BCCP. Studies reported show that MtBPL
differs from EcBirA and probably other BPLs in many additional
ways; (a) MtBPL is a monomer in both its apo and holo forms and has
relatively lower affinity for biotin and bio-5′AMP (b) In
EcBirA, self-biotinylation was enhanced in R118G mutant which
releases bio-5′AMP leading to increased self-biotinylation of the mutant
protein. The R69A mutant of MtBPL failed to undergo self-
biotinylation suggesting that the proclivity of the enzyme for biotinylation was
different from that of EcBirA. The R69A MtBPL has
similar affinity for biotin as that of wild type in contrast to R118G
EcBirA which exhibited reduced affinity for biotin.
Self-biotinylation of EcBirA occurs only in the absence of a biotin
acceptor molecule. This is of relevance to the repressor function of
EcBirA which occurs only in the absence of biotin acceptor
molecule. Limited proteolysis study further reveals that the folding of the ligases
are different. Our studies show that MtBPL is cleaved at the
N-terminus (72–73 amino acids) whereas EcBirA is known to be
cleaved at the C-terminus (217–218 amino acids) [28]. MtBPL exhibit
restricted cleavage in the presence of substrate suggesting that scissile site
interacts with the substrate. While the biotin binding site is constituted by the
conserved ‘GRGRHGR’ in both the BPLs but binding of
biotin/bio-5′AMP promotes conformational change in EcBirA
[28], [29].
Self-biotinylation is intrinsic to the catalytic function of the given BPL as
availability of the self biotinable domain of EcBirA (pGEN1) does
not promote promiscuous biotinylation by MtBPL. In support,
AaBPL which lacks the HTH domain undergoes self-biotinylation
at higher enzyme concentration (>500 nM) as observed with EcBirA
[30], [31]. In
MtBPL, the lack of self-biotinylation is due to both substrate
stringency of the enzyme and also due to the lack of a target lysine residue. The
absence of self-biotinylation in MtBPL is probably a desirable
feature to facilitate the high demands of fatty acid biosynthesis in M.
tuberculosis. However, in other biotin protein ligases with or without
the HTH domain, self-biotinylation is seen to take place.
Proposed rationale for the diverse functional organization of BPLsMtBPL
We reported earlier that MtBPL in spite of lower affinity
for biotin had Km similar to that of
EcBirA [20]. Deletion of
N-terminus domain of EcBirA decreases binding affinity of
the enzyme by ∼100 fold [29]. This suggests that
higher binding constant of EcBirA for biotin may be
directed towards covalent modification of HTH domain. In
MtBPL, fatty acid synthesis plays central role for its cell
wall synthesis. As this is a rate limiting step, the enzyme avoids
self/promiscuous biotinylation to conserve biotin, a scarce co-factor whose
biosynthesis itself is an extremely slow process. This is due to the low
turn over of BioB and its degradation under low iron
concentration [32], [33]. Additionally, uncoupling biotinylation and
repressor functions would favor fatty acid biosynthesis [34].
Hence, the mycobacterium cell probably reserves all the biotin at its
disposal for biotinylation of acc to meet the demands of
cell wall biosynthesis (Figure
7a).
10.1371/journal.pone.0016850.g007
A schematic illustration proposing the mechanism of biotin
utilization and their physiological significance.
(a) Intrinsic metabolic functions of MtBPL (b)
Intrinsic metabolic functions of EcBirA and their
physiologic significance.
E. coli
The intermediate molecule, bio-5′AMP can be utilized for any of the
three function: biotinylation of BCCP, self-biotinylation or as a
co-repressor depending on the cellular demands (Figure 7b).
At high BCCP concentration, low bio-5′AMP [+]
mediates biotinylation of biotin acceptor molecule.
At low BCCP concentration and moderate bio-5′AMP
[++] , when the cell does not require biotin for
biotinylation reaction, bio-5′AMP [++]
probably needs to functions as a co-repressor of biotin biosynthetic
pathway and repress synthesis of biotin. However, this would be
favored only if E.coli does not require immediate
fatty acid biosynthesis to operate. But the bacterium during the
transition, probably requires additional time to decide whether it
wants to block the biotin biosynthetic pathway. Under such a
situation, in the absence of BCCP, the bio-5′AMP is directed
towards self-biotinylation. This prevents the bio-5′AMP to be
utilized as a co-repressor of biotin biosynthetic pathway. The self-
biotinylated EcBirA is enzymatically active to
participate in the biotinylation of BCCP. This is primarily because
transcription activation or repression has to be modulated according
to the cellular requirements [34]
However, when the concentration of bio-5′AMP
[+++] is abundant it functions as a
co-repressor and shuts the biotin biosynthetic pathway.
Our results support the proposed hypothesis as self- biotinylation is
competitively inhibited by biotin acceptor molecule which is is increased in
the presence of operator sequence of biotin biosynthetic pathway [18].
The preferred order of bio-5′AMP utilization by EcBirA
is:Thus the evolutionary process has devised different
mechanism in EcBirA and MtBPL commensurate
with the functional requirement of the organism. The biotin repressor
function is separated from enzyme function in MtBPL as
lipid biosynthesis is very critical in M. tuberculosis. As
the repressor function is not coupled to the enzyme function the enzyme does
not promote self-biotinylation. However, in E. coli during
the evolutionary process, the enzyme has probably compromised its substrate
specificity and has also acquired self as well as promiscuous
biotinylation.
Yao et al[35], [36] suggested
that though functionality and overall folding of biotinyl domains are
conserved through evolution, the detailed structures of BPL-BCCP binding
interface may vary among different species. The substrate stringency of
MtBPL may add to its ability to regulate the acyl CoA
carboxylases in M. tuberculosis.
In conclusion, our studies with MtBPL show that
biotinylation process is not dependent merely on recognition of a target
residue but involves an intricate play between the biotinyl acceptor (BCCP)
and its cognate ligase. MtBPL plays an active role in
substrate selection which occurs by an integration of an intricate series of
events involved in BPL-BCCP interaction and biotin demands of the cell. The
stringency exhibited by MtBPL makes it a suitable target
for the development of anti-mycobacterials and vaccine.
Materials and MethodsProtein methods
M. tuberculosis BPL ( Rv3279c) was cloned into pET28a at
NdeI/HindIII sites and the protein purified as described by Purushothaman
et al[20].
Mutant R69A was generated by site- directed mutagenesis and cloned into
NdeI/HindIII sites and sequence analyzed. The procedure used for the
purification of the mutant protein was identical to that of its wild type
counter-part wild type [20]. EcBirA and (Δ1–65)
EcBirA. M. tuberculosis has three
acetyl-/-propionyl coenzymeA carboxylase α subunit accA1
(Rv2501c), accA2
(Rv0973c), accA3 (Rv3285c),
and a putative acetyl CoA carboxylase subunit BCCP TB7.3
(Rv3221c) and six β subunit, accD
genes [7], [8]. All biotinyl
domains so far reported have target lysine at −35th residue
from C-terminus for biotinylation. Hence, we cloned the C-terminus 87 amino acid
residues of accA1 as the substrate for MtBPL.
MtBCCP87and EcBCCP87
were cloned into pET28a. The PCR primers used for amplification reaction are
listed in Table 1.
10.1371/journal.pone.0016850.t001
List of primers used.
Name
Sequence
MtBCCP87 fwd
5′-
GGAATTCCATATGCACCTGCGCGAGGCCGAGGA-3′
MtBCCP87 rev
5′-
CCCAAGCTTCTAGTCCTTGATCCTCGCCAGTACC-3′
EcBCCP87fwd
5′-GGAATCCATGATGGAAGCGCCAGCAGCAGCGGAAATC-3′
EcBCCP87rev
5′-CGCCTCGAGCTCGATGACGACCAGCGGCTCGTCAAATTC-3′
EcBirA fwd
5′-
GGAATTCCATATGATGAAGGATAACACCGTGCCACTGAAA-3′
EcBirA rev
5′-
CCAAGCTTTTATTTTTCTGCACTACGCAGGGATATTTCACC-3′
TrEcBirA fwd
5′
-GGAATTCCATATGCAGTTACTTAATGCTAAACAG-3′
TrEcBirA rev
5′-
CCCAAGCTTTTATTTTTCTGCACTACGC -3′
R69A MtBPL fwd
5′ –
ATCGCCGAGCATCAGACCGCTGGGCGGGGGCCCATGGC
-3′
R69A MtBPL rev
5′-
TCGGGCAGTGGCCGCCCAGCCGCGGCCATGGGCCCCCCG
-3′
For self-biotinylation studies, BL21 expressing EcBirA was grown
in M9 minimal media supplemented with 2% glucose for 4 h and then induced
with 100 µM IPTG for 3 h. This was carried out to prevent autologous
self-biotinylation.
Schatz minimal peptide
A minimal peptide, Schatz peptide, which is efficiently biotinylated by
EcBirA GLNDIFEAQKIEWH (Genscript, USA) [37], was used
for some of the experiments (37). The peptide (5 µM) was incubated with
100 nM of EcBirA/MtBPL, biotin (500 µM),
ATP (3 mM) for 1 h at 37°C in standard buffer and the biotinylation was
detected by MALDI-TOF.
Matrix-assisted laser desorption time of flight mass spectrometry
The molecular weight of Schatz and holo-Schatz peptides were determined by
MALDI-TOF MS using a Ultraflex TOF/TOF , (Bruker Daltonics Germany) equipped
with a N2 Laser, 337 nm, 50 Hz operating in the 25 KvA reflector mode. Samples
were dialyzed against water and l µl of sample was mixed with equal volume
of matrix solution on a stainless steel plate and air-dried prior to analysis.
The matrix solution used was α-cyano-4-hydroxycinnamic acid in 50%
acetonitrile, 0.1% (v/v) trifluoroacetic acid. Mixture of appropriate
standards was used for calibration and Schatz and holo-Schatz peptide analytes
were analyzed as described above and calibration was performed using the known
protonated molecular ion (MH1).
Fast Protein Liquid Chromatography
A reaction mixture of MtBPL (20 µM), biotin (500
µM), ATP (3 mM) , MgCl2 (2.5 mM), and
MtBCCP156 (20 µM) were incubated for 30
min at 37°C and then 200 µl of the reaction mixture was loaded onto
Superdex S200 (GE, Healthcare) and eluted at a flow rate of 0.2 ml/min and the
eluted samples were monitored at 280 nm. The gel filtration column was
calibrated with alcohol dehydrogenase, BSA, ovalbumin, carbonic anhydrase and
chymotrypsin and lysozyme. Also, purified MtBCCP156
was loaded on to the column to determine the oligomeric status of
apo-MtBCCP156.
Biotinylation assay
Biotin acceptor molecule (BCCP or Schatz peptide) were incubated with 500
µM biotin, 3 mM ATP, 2.5 mM MgCl2 and 100 nM
MtBPL or EcBirA in standard buffer for 1 h
at 37°C. The biotinylated proteins were detected by avidin blot and mass
spectrometry..
Self-biotinylation reaction
To determine self-biotinylation, different concentration of
EcBirA/MtBPL were incubated with 3 mM
(ATP), biotin (500 µM) in standard buffer for 1 h at 37°C. The
biotinylated protein was then detected by streptavidin blot.
Avidin blot
Biotinylated proteins were resolved on 10% SDS-PAGE and transferred to
nitrocellulose membranes. The non-specific sites were blocked with 5%
skim milk in Phosphate buffered saline +0.1% Tween20, pH-7.4,
(PBS-T) and incubated with streptavidin-HRP (Sigma) at 1∶2000 dilution for
1 h at room temperature. The membrane was washed 5× with PBS-T and
2× with PBS and detected by 3-amino-9- ethylcarbazole
(AEC)/H2O2.
Limited proteolysis
MtBPL (5 µM) was incubated with trypsin (1∶200)
dilution and incubated at 37°C for 20 min. The enzyme was pre-incubated with
biotin (500 µM) and ATP (3 mM) at 37°C for 30 min prior to trypsin
digestion. After protease treatment, the sample solubilizing dye was added to
the protein , boiled and loaded on to a 10% SDS-PAGE. The resolved
proteins were scanned and percentage of proteolysis determined. The digested
product was sequenced from the N-terminus on an Applied Biosystems Precise 491
CLC Protein Sequencer.
Supporting Information
Self-biotinylation of EcBirA, MtBPL and
R69A MtBPL mutant by avidin blot.
MtBPL/EcBirA (250–2000 nM)/R69A
(2000 nM) were incubated with 3 mM ATP and 500 µM biotin in standard
buffer (10 mM Tris- HCl pH-8.0, 50 mM KCl, 2,5 mM MgCl2 ) for 1 h
at 37°C. The reaction mixture was resolved on a 10% SDS PAGE and
transferred to nitrocellulose membrane. The membrane was then incubated with
streptavidin HRP for 1 h at room temperature and developed with
AEC/H2O2. (1) marker; (2–6) 250–2000
nM of MtBPL; (7–11) 250–2000 nM of
EcBirA; (12) 2000 nM of R69A MtBPL.
See also Figure S2.
(TIF)
Promiscuous biotinylation property of EcBirA and
MtBPL by avidin blot. BSA (2 µM) were incubated
with 3 mM ATP, 500 µM biotin and 100 nM BPL in standard buffer (10 mM
Tris-HCl pH-8.0, 50 mM KCl, 2.5 mM MgCl2) for 2 h at 37°C.
The reaction mixture was then resolved on a 10% SDS PAGE and
transferred to nitrocellulose membrane. The membrane was then incubated with
streptavidin HRP for 1 h at room temperature and developed with
AEC/H2O2. (1) marker (2) BSA+400 nM
MtBPL; (3–5) BSA+200, 300, 400 nM of
EcBirA.
(TIF)
Catalytic activity of self-biotinylated EcBirA .
Self-biotinylated EcBirA was dialyzed to remove free
biotin/ATP. The enzyme was then used to transfer biotin to Schatz peptide in
the absence or presence of endogenous biotin and ATP. (a) Mass spectrum of
Schatz peptide incubated with self-biotinylated EcBirA in
standard buffer. (b) Mass spectrum of Schatz peptide incubated with
self-bitoinylated EcBirA incubated with endogenous 500
µM biotin, 3 mM ATP and in standard buffer.
(TIF)
ReferencesChatterjeeD1997The mycobacterial cell wall : structure, biosynthesis and sites
of drug action.1579588GoudeRParishT2008The genetics of cell wall biosynthesis in Mycobacterium
tuberculosis.3299313DolinPJRaviglioneCKochinA1994Global tuberculosis incidence and mortality during
1990–2000.72213220BloomBRMurray CJ1992Tuberculosis: commentary on a re-emergent killer.25710551064BrennanPJ2009Approaches to developing new drugs against
tuberculosis.89329330ColeSTAlzariPM2007Towards new tuberculosis drugs.3513211324OrmeIMMcMurrayDNBelisleJT2001Tuberculosis vaccine development: recent
progress.19115118OhT-JDanielJKimH-JSirakovaTDKolattukudyPE2006Identification and characterization of Rv3281 as a novel subunit
of a biotin-dependent acyl-CoA carboxylase in Mycobacterium
tuberculosis H37Rv.28138993908Chapman-SmithACronanJEJr1999The enzymatic biotinylation of proteins: a post-translational
modification of exceptional specificity.24359363Chapman-SmithACronanJEJr1999Molecular biology of biotin attachment to
proteins.1292S477S484SAthappillyFKHendricksonWA1995Structure of the biotinyl domain of acetyl- coenzyme A
carboxylase determined by MAD phasing.1514071419CronanJEJr2001The biotinyl domain of Escherichia coli
acetyl-CoA carboxylase. Evidence that the “thumb” structure is
essential and that the domain functions as a dimer.2763735537364BagautdinovBKuroishiCSugaharaMKunishimaN2005Crystal structures of biotin protein Ligase from
Pyrococcus horikoshii OT3 and its complexes: structural
basis of biotin activation.353322333LiY-QSuedaSKondoHKawarabayasiY2006A unique biotin carboxyl carrier protein in archaeon
Sulfolobus tokodaii.58015361540SuedaSLiY-QKondoHKawarabayasiY2006Substrate specificity of archaeon Sulfolobus
tokodaii biotin protein ligase.344155159ClarkeDJCoulsonJBaillieRCampopianoDJ2003Biotinylation in the hyperthermophile Aquifex
aeolicus.27012771287BeckettD2009Biotin sensing at the molecular level.139167170AbbottJBeckettD1993Cooperative binding of the Escherichia coli
repressor of biotin biosynthesis to the biotin operator
sequence.3296499656Streaker EDBeckettD2006The biotin regulatory system: kinetic control of a
transcriptional switch.4564176425PurushothamanSGuptaGSrivastavaRGanga RamuVSuroliaA2008Ligand specificity of group I biotin protein ligase of
Mycobacterium tuberculosis.3e2320FinnRDMistryJTateJCoggillPHegerA2010The Pfam protein families database.38D211222Choi-RheeESchulmanHCronanJE2004Promiscuous protein biotinylation by Escherichia
coli biotin protein ligase.1330433050PatelMSKorotchkinaLG2006Regulation of the pyruvate dehydrogenase complex.34217222PatelMSRocheTE1990Molecular biology and biochemistry of pyruvate dehydrogenase
complexes.432243233BagautdinovBMatsuuraYBagautdinovaSKunishimaN2008Protein biotinylation visualized by a complex structure of biotin
protein ligase with a substrate.2831473914750Chapman-SmithAForbesBEWallaceJCCronanJEJr1997Covalent modification of an exposed surface turn alters the
global conformation of the biotin carrier domain of Escherichia
coli acetyl-CoA carboxylase.2722601726022RobertsELShuNHowardMJBroadhurstRWChapman-SmithA1999Solution structures of apo and holo biotinyl domains from acetyl
coenzyme A carboxylase of Escherichia coli determined by
triple-resonance nuclear magnetic resonance spectroscopy.3850455053XuYBeckettD1996Evidence for interdomain interaction in the Escherichia
coli repressor of biotin biosynthesis from studies of an
N-terminal domain deletion mutant.3517831792WagenführKPieperSMackeldanzPLinscheidMKrügerDH2007Structural Domains in the Type III Restriction Endonuclease
EcoP15I: Characterization by limited proteolysis, mass spectrometry and
insertional, mutagenesis.36693102TronCMMcNaeIWNutleyMClarkeDJCooperA2009Structural and functional studies of the biotin protein ligase
from Aquifex aeolicus reveal a critical role for a
conserved residue in target specificity.387129146XuYNenortasEBeckettD1995Evidence for distinct ligand bound conformational states of the
multi functional E.coli repressor of biotin
biosynthesis.341662416631Streit WREntchevaP2003Biotin in microbes, the genes involved in its biosynthesis, its
biochemical role and perspectives for biotechnological
production.612131ReydaMRDippoldRDotsonMEJarrettJT2008Loss of iron-sulfur clusters from biotin synthase as a result of
catalysis promotes unfolding and degradation.4713241KodadekTSikderDNalleyK2006Keeping transcriptional activators under control.127261264YaoXWeiDSodenCJrSummersMFBeckettD1997Structure of the carboxy-terminal fragment of the apo-biotin
carboxyl carrier subunit of Escherichia coli acetyl-CoA
carboxylase.361508915100YaoXSodenCJrSummersMFBeckettD1999Comparison of the backbone dynamics of the apo- and
holo-carboxy-terminal domain of the biotin carboxyl carrier subunit of
Escherichia coli acetyl-CoA
carboxylase.8307317BeckettDKovalevaESchatzPJ1999A minimal peptide substrate in biotin holoenzyme
synthetase-catalyzed biotinylation.8921929