Advertisement
  • Loading metrics

Rapid Treponema pallidum Clearance from Blood and Ulcer Samples following Single Dose Benzathine Penicillin Treatment of Early Syphilis

Rapid Treponema pallidum Clearance from Blood and Ulcer Samples following Single Dose Benzathine Penicillin Treatment of Early Syphilis

  • Craig Tipple, 
  • Rachael Jones, 
  • Myra McClure, 
  • Graham Taylor
PLOS
x

Abstract

Currently, the efficacy of syphilis treatment is measured with anti-lipid antibody tests. These can take months to indicate cure and, as a result, syphilis treatment trials require long periods of follow-up. The causative organism, Treponema pallidum (T. pallidum), is detectable in the infectious lesions of early syphilis using DNA amplification. Bacteraemia can likewise be identified, typically in more active disease. We hypothesise that bacterial clearance from blood and ulcers will predict early the standard serology-measured treatment response and have developed a qPCR assay that could monitor this clearance directly in patients with infectious syphilis. Patients with early syphilis were given an intramuscular dose of benzathine penicillin. To investigate the appropriate sampling timeframe samples of blood and ulcer exudate were collected intensively for T. pallidum DNA (tpp047 gene) and RNA (16S rRNA) quantification. Sampling ended when two consecutive PCRs were negative. Four males were recruited. The mean peak level of T. pallidum DNA was 1626 copies/ml whole blood and the mean clearance half-life was 5.7 hours (std. dev. 0.53). The mean peak of 16S rRNA was 8879 copies/ml whole blood with a clearance half-life of 3.9 hours (std. dev. 0.84). From an ulcer, pre-treatment, 67,400 T. pallidum DNA copies and 7.08x107 16S rRNA copies were detected per absorbance strip and the clearance half-lives were 3.2 and 4.1 hours, respectively. Overall, T. pallidum nucleic acids were not detected in any sample collected more than 56 hours (range 20–56) after treatment. All patients achieved serologic cure. In patients with active early syphilis, measuring T. pallidum levels in blood and ulcer exudate may be a useful measure of treatment success in therapeutic trials. These laboratory findings need confirmation on a larger scale and in patients receiving different therapies.

Author Summary

Syphilis is an infection that is spread both sexually and from mother-to-child. Worldwide, it affects an estimated 11 million people each year. Treatment is available, but relies heavily on penicillin and may not be as effective where the infection involves the brain or nervous system. Clinical trials are needed to assess new treatments, but proving that people are cured with current tests can take months. We developed a new test to measure the success of treatment for the early stage of syphilis. We then used it in four patients and found that the syphilis bacteria were cleared from the blood and ulcer samples collected by 56 hours. All four patients were followed up with normal tests and found to have been cured. Our new test is the first to show the speed of bacterial clearance after treatment and we plan to use it in clinical trials of new treatments. Our data may also mean that patients with syphilis are unable to pass on the infection three days after treatment, but this also needs proving on a larger scale.

Introduction

Syphilis is a multi-stage disease caused by the spirochete Treponema pallidum subspecies pallidum (T. pallidum) which is transmitted both sexually and from mother-to-child [1]. From the late 1990s, the United Kingdom recorded large (ten-fold or more) increases in diagnosed cases during epidemics characterised by male-to-male transmission and high rates of HIV-1 co-infection (currently 64% in the UK) [1, 2]. Globally, the disease has remained prevalent with an estimated incidence of 10.6 million cases each year [3]. This resurgence, and the need to reduce mother-to-child transmission, has renewed interest in improved testing and treatment strategies. The aim of the current study was to develop a novel way of safely investigating syphilis treatments by directly measuring bacterial clearance following treatment.

The diagnosis of syphilis relies on serological tests; direct visualisation by dark ground microscopy (DGM) or PCR detection in infectious lesions [4]. Following direct contact with an infected lesion, T. pallidum invades at the point of entry to produce the chancre of primary syphilis and disseminates widely through the blood-stream and lymphatics, leading to the multi-system secondary stage [5]. The infection is subject to significant but incomplete immune clearance during the early stages and, if untreated, passes into an asymptomatic latent phase [6]. Monitoring treatment can be achieved clinically, by observing the resolution of symptoms and signs, and serologically by measuring a two-dilution (four-fold) fall in the titre of anti-cardiolipin tests, namely the venereal disease research laboratory (VDRL) or rapid plasma reagin (RPR) assays [7]. The requisite fall in RPR titre may not be observed for several months as seen in a recent treatment study where a fifth of the (HIV-1 uninfected) patients were termed ‘serofast’ at six months [8]. This creates uncertainty about the adequacy of treatment, especially as only a small proportion (13%) of these patients responded (serologically) to re-treatment with benzathine penicillin [9].

In recent years, PCR has increasingly replaced culture for the identification of pathogens. Quantitative PCR (qPCR) is commonly used to quantify viruses, such as HIV-1 and Hepatitis C in order to monitor treatment response. The quantification of bacteraemia by PCR not widely reported, but has been described for Streptococcus pneumoniae, Neisseria meningitidis, methicillin-resistant Staphylococcus aureus (MRSA), and Acinetobacter baumannii [1013]. It was suggested for these infections that bacterial load is associated with disease severity and that the rate of clearance may predict clinical outcome. A recent meta-analysis of 46 studies found the sensitivity of T. pallidum PCR to be highest in primary genital or anal chancres (78.4%, 95% CI 68.2%–86.0%). In blood, the highest sensitivities found were for congenital (83.0%, CI 55.0%–95.2%) and secondary (52.2%, CI 37.3%–66.7%) disease [14]. For syphilis too, then, bacteraemia may be associated with disease activity. Quantitative measurement of T. pallidum in whole blood established a range of 195 to 1954 polA gene copies/ml in one cross-sectional study of secondary disease, and a mean of 516 tpp047 copies/ml whole blood in another [15, 16]. Until now, serial measurements following treatment have not been made, thus a potential correlation between bacterial clearance and serologic cure was unknown.

Using qPCR, we measured T. pallidum bacterial load in blood and ulcer exudate samples from four patients with early syphilis both before and up to 150 hours after treatment with single-dose parenteral penicillin. We compared the rate of bacterial clearance with clinical outcome and standard serological follow-up.

Methods

Patients and samples

Patients with a microbiologically confirmed diagnosis of primary or secondary syphilis were invited to participate. Primary disease was defined as a genital, or peri-anal chancre in which T. pallidum was identified by DGM. Secondary disease was diagnosed in patients with consistent symptoms and signs in the context of a positive enzyme immuno-assay (EIA) result and a RPR titre of greater than one in eight.

Following informed consent, subjects were admitted to an in-patient facility and invited to donate 4 ml whole blood, of which 3 ml were collected into a Tempus RNA preservation tube (Life Technologies, UK), and 1 ml into EDTA. Each patient then received 2.4 megaunits of benzathine penicillin by intramuscular injection. Subsequently, blood samples were drawn, as above, two and six hours post-penicillin administration, then four-hourly for 48 hours (11 samples); six-hourly for 24 hours (four samples) and, finally, 12-hourly for up to four days (maximum eight samples). Samples were placed on dry ice immediately following collection and were processed in batches of up to eight. For the first patient, samples were collected at all time-points. Subsequently, the duration of sample collection was informed by T. pallidum clearance and ceased when two consecutive samples were negative by qPCR. Ulcer exudate was collected with a filter paper Snostrip. First, the ulcer was abraded with sterile gauze and saline. Next, exudate from the ulcer margin was absorbed up to the notch of the strip, the tip removed with a sterile blade and placed into 1.3ml of RNAlater solution (Ambion, UK).

Following discharge, patients were invited to attend for RPR testing at one, three and six months post-treatment. Serological cure was defined as a two-dilution (four-fold) reduction in RPR titre.

Ethical approval for the study was obtained from the NRES Committee South East Coast (Brighton and Sussex) (ref. 11/LO/0358). Informed, written consent was obtained from all study participants.

Laboratory methods

Within 24 hours of collection, T. pallidum DNA was extracted from 500μl aliquots of whole blood. Aliquots were added to 500μl of lysis buffer (20mM TrisHcl, pH 8.0; 0.2M EDTA; 1%SDS) and incubated with 100μl of Proteinase K (Qiagen) for three hours at 65°C. Following extraction with a proprietary extraction method (QiAmp, Qiagen, Crawley, UK), DNA was purified by ethanol precipitation and resuspended in 60μl of elution buffer (Qiagen). RNA was extracted from blood in Tempus tubes according to the manufacturer’s protocol and resuspended in 100μl of the supplied elution solution. Positive and negative extraction controls were included with each batch. DNA and RNA from Snostrip samples were extracted in a single procedure with an ‘all-prep mini kit’ (Qiagen). Snostrips in RNAlater were centrifuged at 14,000g and 4°C for 30 minutes and the upper 1.1ml of RNA later discarded. The remaining 200μl were added to 600μl or buffer RLT (Qiagen) which contained 0.143M beta-mercaptoethanol. Following homogenization with a Qiashredder column (Qiagen) the resultant DNA/RNA mixture was separated and extracted according to the manufacturer’s protocol. RNA and DNA were eluted into 60μl and 100μl of RNAse-free water, respectively.

T. pallidum DNA quantification was achieved with qPCR using the CFX real-time system (Biorad) to detect amplification of the tpp047 gene, which encodes a conserved 47 kDa outer membrane protein. Each reaction contained 12.5μl 2x Quantitect PCR mix (Qiagen); 0.4μM of the primers TP1 (5-CGAGGAATACAAGATTACGAACG-3) and TP2 (5-ACGTGCAGAAAAACTATCCTCAG) and 0.2μM of the hydrolysis probe TP_P (FAM-CGGCCTCGCTCAGAGATGAGC-TAMRA). Primer specificity had been assessed previously [15]. Cycling conditions consisted of 15 minutes at 95°C then 44 cycles of 95°C for 15 seconds and 80 seconds at 60°C. Quantification was achieved using an ‘in-run’ plasmid standard of a 1:10 dilution series from 105 to ten copies per reaction of the tpp047 target sequence. RNA quantification was performed in a single-step RT-qPCR. Each 25μl reaction contained 1μl enzyme mix (reverse transcriptase and taq polymerase) (Qiagen); 0·4mM DNTP mix; 5μl reaction buffer; 0.6μM of the primers 16S_F (CTCTTTTGGACGTAGGTCTTTGAG) and 16S_R (TCACCCTCTCAGGTCGGATA), and 0.2μM of the hydrolysis probe 16S_P3 (FAM-CGGCCTCGCTCAGAGATGAGC-TAMRA). Cycling conditions began with 50°C for 30 minutes, followed by 95°C for 15 minutes then 44 cycles of 95°C for 15 seconds and 60°C for 90 seconds. Absolute RNA quantification was achieved with a 1:10 dilution series of T. pallidum 16S rRNA produced using T7 polymerase on the recombinant plasmid containing the target sequence. For both DNA and RNA quantification, samples were analysed in triplicate and two no-template (water) controls were included in each experiment.

Results were analysed using SPSS v19. Statistical analysis is limited to descriptive statistics and a two-tailed student’s t-test.

Results

Assay performance

The T. pallidum qPCR was found to have an analytical sensitivity of at least ten tpp047 copies/reaction. The mean inter and intra-assay coefficients of variation (for the detection of 104 tpp047 copies/μl) were 2.35% (std. dev. 0·63) and 0·66% (std. dev. 0·17), respectively. The quantification standard curve was 103% efficient with an average of 3.17 cycles between each 1:10 dilution. The RT-qPCR could detect a minimum of 23 16S rRNA copies/reaction with an inter-assay variation coefficient (for the detection of 2.3x104 copies) of 3.05% (std. dev. 0.87) and intra-assay variation of 0.34% (std. dev 0.09). The 16S rRNA absolute quantification standard curve was 87.7% efficient with an average of 3.66 cycles between each 1:10 dilution.

To compare the kinetics of T. pallidum DNA and rRNA clearance, two parameters were calculated. The first, time to clearance, was the time elapsed between administration of treatment and the point half way between the first of the consecutively negative time-point and the last detectable time-point. The second, clearance half-life, was based on the exponential decay equation: N(t) is the quantity remaining after a time t; N0 is the initial quantity, and t1/2 is the half-life of the decaying quantity. By measuring the coefficient of variation (R2) for an exponential regression line, the rate of nucleic acid clearance in both ulcer and blood samples was found to be exponential, thus half-life was an appropriate measure of clearance.

T. pallidum quantification

Three of four patients recruited were found to have detectable T. pallidum bacteraemia pre-treatment and it was possible to document changes in the bacterial load over time. The fourth patient recruited was bacteraemic at time points four, six, eight and nine (between six and 30 hours post-treatment), but initially negative and was excluded from analyses. Baseline characteristics for all patients are presented in Table 1.

Samples from patients STS1, STS2, and STS3 showed similar patterns of T. pallidum nucleic acid clearance from blood following treatment (Table 2 and Fig. 1). The mean peak tpp047 level, which occurred two to ten hours post-treatment, was 1626 copies/ml whole blood (std. dev. 652). Peak 16S rRNA levels (8879 copies/ml whole blood, std. dev. 11109) were detected at similar time-points. While the peak of tpp047 DNA was similar for all three patients, that of 16S rRNA for patient STS3 was ten-fold higher than for STS1 and STS2. Following peak bacteraemia, both RNA and DNA levels fell quickly, with neither detectable in any patient after 56 hours. The mean time to tpp047 DNA clearance was 34 hours (std. dev. 8) and 29 hours (std. dev. 23.86) for 16S rRNA. The 16S rRNA time to clearance measured for patient STS3 was 56 hours, as a result of low-level (35 copies/ml) 16S rRNA detection at 56 hours following two negative samples at 42 and 46 hours. This 16S rRNA amplification at 56 hours was observed in two of three technical replicates during two separate experiments. Furthermore, both the negative Tempus™ extraction control and the two no-template PCR negative controls were negative. The mean half-life of T. pallidum tpp047 DNA clearance from blood was determined to be 5.68 hours (std. dev 0.53) and was significantly longer than the 3.89 hours (std. dev. 0.84) calculated for 16S rRNA (p = 0.035, two-tailed t-test).

thumbnail
Fig 1. Three patients with microbiologically confirmed early syphilis were treated with a 2.4 megaunit dose of benzathine penicillin at time zero.

Panels A to C represent DNA clearance for three patients and Panels D to F depict RNA clearance for the same patients. Error bars represent 95% confidence intervals.

https://doi.org/10.1371/journal.pntd.0003492.g001

In order to exclude the possibility of a late recrudescence in bacterial load, blood from patient STS1 was sampled for both DNA and RNA quantification until 150 hours post-treatment. Neither was detectable following initial clearance at 32 (RNA) and 40 (DNA) hours.

Patient STS3 presented with a DGM positive genital ulcer and samples were collected concurrently with each blood sample. Table 2 and Fig. 2 demonstrate an initial ulcer tpp047 load of 34,000 DNA copies/strip, which peaked (67,400 DNA copies/strip) at 14 hours and remained high until 26 hours, thereafter decreasing rapidly. At 50 hours following treatment, tpp047 DNA was no longer detectable. The decay of tpp047 DNA fitted an exponential regression line (R2 = 0.878) and the clearance half-life was 3.2 hours. The quantity of 16S rRNA followed a similar pattern, although this peaked earlier, at two hours post-treatment, and higher, at a level 1000 times greater than for DNA (7.08x107 copies/strip). After 40 hours, the level fell exponentially (R2 = 0.839) to become undetectable by 56 hours. Clearance half-life was 4.1 hours.

thumbnail
Fig 2. A patient presenting with a DGM positive penile ulcer (primary syphilis) was administered a 2.4 megaunit dose of benzathine penicillin at time zero.

Ulcer samples for T. pallidum DNA and RNA quantification were collected pre-treatment and then four hourly for 56 hours. Panel A. presents DNA (tpp047) decay and Panel B. shows 16S rRNA decay.

https://doi.org/10.1371/journal.pntd.0003492.g002

The clearance of both DNA and 16S rRNA was measured both to improve T. pallidum detection (the 16S ribosomal RNA target was predicted to be present at 5000–10000 copies per organism) and to compare clearance, predicted to be shorter for RNA which is inherently less stable [17]. The half-life of T. pallidum DNA clearance was found to be significantly longer than 16S rRNA (5.7 hours versus 3.9 hours, p = 0·035).

Patient progress and follow-up

Patients STS1, STS2 and STS3 all developed an inflammatory Jarisch-Herxheimer reaction (JHR) eight to 12 hours after penicillin administration. This included a worsening of rash for patients STS1 and STS2 over a one-to-two day period. At one month, clinical signs and symptoms had resolved in all three patients and serological results were consistent with cure (Table 3). This serological response was maintained at three and six months.

Discussion

We present the development of a qPCR assay for quantifying T. pallidum in clinical samples and some early observations from a small, uncontrolled clinical study of patients with early syphilis treated with Benzathine penicillin, which highlights the potential clinical application of the assay.

Confirming adequate treatment for syphilis with serological tests can be slow (up to 12 months) and problematic due to the non-specific nature of serum RPR testing [7, 8]. Using serial sampling and novel qPCR assays, we have demonstrated clearance of T. pallidum nucleic acids from blood and ulcer exudate within 56 hours of treatment with benzathine penicillin in four patients. We have also described the kinetics of this response and found the half-life for blood clearance of T. pallidum to be 5.7 hours for DNA and 3.9 hours for RNA. For an ulcer, bacterial DNA and RNA clearance half-lives were 3.2 and 4.1 hours, respectively. All patients were cured by their treatment, showing both a clinical and serologic response.

Syphilis disease activity varies through the course of the infection giving rise to early (symptomatic) and late (asymptomatic) clinical stages. The secondary stage, characterised by systemic disease (rash, hepatitis, neurologic involvement) is arguably the most active and is the stage during which patients are most likely to be bacteraemic [14, 18]. Blood bacterial load has been measured by qPCR in a number of infections and correlated with disease activity. In patients with meningococcal disease, the level of bacteraemia at admission was significantly higher in individuals with severe disease and in those who died [11] and in MRSA bacteraemia where mecA DNA levels were significantly higher in non-survivors compared with survivors [12]. When the bacterial load of Acinetobacter baumannii in critical care patients was followed longitudinally, a slower rate of clearance was associated with increased mortality. Moreover, the use of appropriate antibiotics resulted in quicker bacterial clearance [13]. The sensitivity of T. pallidum PCR in blood is too low for it to be a reliable diagnostic test, especially in primary and latent disease. However, our data suggest that in selected patients with active early disease it may prove a useful marker of disease activity. Moreover, in the context of a clinical study of early syphilis treatment, qPCR may also conceivably be used to monitor bacterial clearance and quickly identify potential treatment failure.

The primary chancre of syphilis develops at the site of initial infection following bacterial division and invasion and, as such, has a high bacterial load. PCR detection of T. pallidum in these lesions is now established as a diagnostic tool for the disease. The chancre is also the most likely source of bacteria for onward transmission of the disease, thus the period of infectiousness following treatment is of interest. In the current study DNA and RNA from an ulcer were undetectable 50 and 56 hours following treatment, respectively. If proven in a larger clinical study, this may be of use for counseling patients regarding abstinence following syphilis treatment.

To our knowledge, there is no previous description of T. pallidum qPCR detection in animal or human samples to measure treatment response following therapy. The intensity of monitoring in this study enabled the observed rapid bacterial clearance to be measured accurately and serologic follow-up of patients was robust enabling a potential association between bacterial clearance and serologic cure to be identified. At present, our demonstration of bacterial clearance is limited to the study of four patients and requires confirmation on a much larger scale to become clinically useable. Moreover, whilst the clearance of bacterial DNA was measured, it is unknown whether the DNA detected was from living or dead organisms. As T. pallidum is non-culturable, Rabbit Infectivity Testing (RIT), where test animals are injected with clinical material in order to propagate and identify T. pallidum, could have been used to assess persistence following treatment [19, 20]. This approach would, however, have required the sacrifice of a large number of animals. A final limitation is that all four patients in the current study received benzathine penicillin treatment. Whilst this was deliberate, in order to define the precise moment of treatment, we acknowledge that bacterial clearance time following treatment with oral antibiotics may be different.

In recent clinical trials of syphilis treatments, enrolled patients waited for a minimum of six months following the administration of the trial drug before cure (defined as a four-fold reduction in RPR titre) was diagnosed [21, 22]. The investigation of new syphilis treatments is much needed, but to leave patients potentially untreated for six months while waiting for a serologic response is far from ideal. We hypothesise that for patients with early stage syphilis, which is PCR-positive at baseline, a clearance half-life of less than six hours or absence of bacterial nucleic acids at three days indicates bacterial clearance and is potentially a new measure of treatment success. In order to prove this, a larger observational study of syphilis treatment response is required. This proposed study would require both HIV-1 uninfected and uninfected patients with untreated primary, secondary and early latent syphilis. We propose that five sample time-points based on these preliminary data (pre-treatment, 12, 24, 56 and 72 hours post-treatment) should be used to compare bacterial clearance following treatment with both parenteral penicillin and oral antibiotics, such as doxycycline. Bacterial clearance would be correlated with serologic and clinical cure.

Author Contributions

Conceived and designed the experiments: CT GT. Performed the experiments: CT. Analyzed the data: CT GT MMC. Contributed reagents/materials/analysis tools: CT GT MMC. Wrote the paper: CT GT RJ MMC. Coordinated study authorisation, regulation and recruitment at a second clinical site: RJ.

References

  1. 1. Health Protection Agency UK (2009) Syphilis and lymphogranuloma venereum: resurgent sexually transmitted infections in the UK. Available: http://webarchive.nationalarchives.gov.uk/20140714084352/http://www.hpa.org.uk/webc/HPAwebFile/HPAweb_C/1245581513523. Accessed 2 January 2015.
  2. 2. Golden M, Marra C, Holmes KK. (2003) Update on syphilis: resurgence of an old problem. JAMA 290:1510–4. pmid:13129993
  3. 3. World Health Organisation. (2011) Prevalence and incidence of selected sexually transmitted infections. Geneva, Switzerland: WHO Press.
  4. 4. Ratnam S. The laboratory diagnosis of syphilis. (2005) Can J Infect Dis Med Microbiol 16:45–51. pmid:18159528
  5. 5. Lafond RE, Lukehart SA. Biological basis for syphilis. (2006) Clin Microbiol Rev 19:29–49. pmid:16418521
  6. 6. Salazar JC, Hazlett KR, Radolf JD. (2002) The immune response to infection with Treponema pallidum, the stealth pathogen. Microbes Infect 4:1133–40. pmid:12361913
  7. 7. Kingston M, French P, Goh B, Goold P, Higgins S et al. (2008) UK national guidelines on the management of syphilis. Int J STD AIDS 19:729–40. pmid:18931264
  8. 8. Seña AC, Wolff M, Martin DH, Behets F, Van Damme K et al. (2011) Predictors of serological cure and serofast state after treatment in HIV-negative persons with early syphilis. Clin Infect Dis 53:1092–9. pmid:21998287
  9. 9. Seña AC, Wolff M, Behets F, Van Damme K,Martin DH et al. (2013) Response to therapy following retreatment of serofast early syphilis patients with benzathine penicillin. Clin Infect Dis. 56:420–2. pmid:23118269
  10. 10. Carrol ED, Guiver M, Nkhoma S, Mankhambo LA, Marsh J et al. (2007) High pneumococcal DNA loads are associated with mortality in Malawian children with invasive pneumococcal disease. Pediatr Infect Dis J 26:416–22. pmid:17468652
  11. 11. Hackett SJ, Guiver M, Marsh J, Sills JA,Thomson AP et al. (2002) Meningococcal bacterial DNA load at presentation correlates with disease severity. Arch Dis Child. 86:44–6. pmid:11806883
  12. 12. Ho YC, Chang SC, Lin SR, Wang WK. (2009) High levels of mecA DNA detected by a quantitative real-time PCR assay are associated with mortality in patients with methicillin-resistant Staphylococcus aureus bacteremia. J Clin Microbiol 47:1443–51. pmid:19279177
  13. 13. Chuang YC, Chang SC, Wang WK. (2012) Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia. Crit Care Med 40:2273–80. pmid:22809902
  14. 14. Gayet-Ageron A, Lautenschlager S, Ninet B, Perneger TV, Combescure C. (2013) Sensitivity, specificity and likelihood ratios of PCR in the diagnosis of syphilis: a systematic review and meta-analysis. Sex Transm Infect 89:251–6. pmid:23024223
  15. 15. Cruz A, Pillay A, Zuluaga A, Ramirez L, Duque J et al. (2010) Secondary syphilis in cali, Colombia: new concepts in disease pathogenesis. PLoS Negl Trop Dis. 4:e690. pmid:20502522
  16. 16. Tipple C, Hanna MO, Hill S, Daniel J,Goldmeier D et al. (2011) Getting the measure of syphilis: qPCR to better understand early infection. Sex Transm Infect. 87:479–85. pmid:21752804
  17. 17. Centurion-Lara A, Castro C, Shaffer J, Van Voorhis W, Marra C et al. (1997) Detection of Treponema pallidum by a sensitive reverse transcriptase PCR. J Clin Microbiol 35:1348–52. pmid:9163442
  18. 18. Baughn RE, Musher DM. (2005) Secondary syphilitic lesions. Clin Microbiol Rev 18:205–16. pmid:15653827
  19. 19. Orle K, Gates C, Martin D, Body B, Weiss J. (1996) Simultaneous PCR detection of Haemophilus ducreyi, Treponema pallidum, and herpes simplex virus types 1 and 2 from genital ulcers. J Clin Microbiol 34:49–54. pmid:8748271
  20. 20. Yogeswari L, Chacko CW. (1971) Persistence of T. pallidum and its significance in penicillin-treated seropositive late syphilis. Br J Vener Dis 47:339–47. pmid:4107894
  21. 21. Rolfs RT, Joesoef MR, Hendershot EF, Rompalo AM, Augenbraun MH et al. (1997) A randomized trial of enhanced therapy for early syphilis in patients with and without human immunodeficiency virus infection. The Syphilis and HIV Study Group. N Engl J Med 337:307–14. pmid:9235493
  22. 22. Riedner G, Rusizoka M, Todd J, Maboko L, Hoelscher M et al. (2005) Single-dose azithromycin versus penicillin G benzathine for the treatment of early syphilis. N Engl J Med 353:1236–44. pmid:16177249