
Generation of Leishmania Hybrids by Whole Genomic DNA Transformation

Generation of Leishmania Hybrids by Whole Genomic DNA Transformation

  • Adriano C. Coelho, 
  • Philippe Leprohon, 
  • Marc Ouellette
  • Published: September 20, 2012
  • DOI: 10.1371/journal.pntd.0001817


Genetic exchange is a powerful tool to study gene function in microorganisms. Here, we tested the feasibility of generating Leishmania hybrids by electroporating genomic DNA of donor cells into recipient Leishmania parasites. The donor DNA was marked with a drug resistance marker facilitating the selection of DNA transfer into the recipient cells. The transferred DNA was integrated exclusively at homologous locus and was as large as 45 kb. The independent generation of L. infantum hybrids with L. major sequences was possible for several chromosomal regions. Interfering with the mismatch repair machinery by inactivating the MSH2 gene enabled an increased efficiency of recombination between divergent sequences, hence favouring the selection of hybrids between species. Hybrids were shown to acquire the phenotype derived from the donor cells, as demonstrated for the transfer of drug resistance genes from L. major into L. infantum. The described method is a first step allowing the generation of in vitro hybrids for testing gene functions in a natural genomic context in the parasite Leishmania.

Author Summary

Leishmania spp. are pathogenic protozoa characterized by a substantial diversity in pathogenesis and virulence despite their considerable synteny at the genome level. The existence of genetic exchange was recently proven experimentally in the sand fly vector where hybrid parasites were isolated and generated. Here, we show the feasibility of generating Leishmania hybrids by electroporating genomic DNA of donor cells into recipient Leishmania parasites. This methodology was made possible by introducing a drug resistance marker in the donor Leishmania cells that could be used for selecting recombinant recipient parasites. Integrations of exogenous DNA fragments as large as 45 kb were possible for several chromosomal regions and took place at homologous loci in recipient Leishmania strains. Our observations are the first step for the generation of in vitro hybrids for assessing gene function under natural genomic contexts and this technology may be applicable to other pathogens.


Leishmaniasis is a complex of diseases caused by parasites of the genus Leishmania for which there is an estimated 12 million people infected in tropical and subtropical areas of the world [1]. The clinical manifestations of the disease are often correlated with the infecting Leishmania species and range from self-healing cutaneous sores (cutaneous leishmaniasis) to deadly visceral pathologies (visceral leishmaniasis) [1]. The Leishmania genomes are characterized by a high degree of gene synteny and contain a surprisingly low number of species-specific genes relative to clinical diversity [2], [3]. While Leishmania parasites are usually considered as diploid, recent evidence revealed a sizable variation in chromosome copy numbers between species [3], [4]. Hence, the tropism of leishmaniasis is likely to come from a combination of species-specific genes identified to date [2], [5] and from differences in gene copy number and expression between species [6], [7].

The occurrence of a sexual cycle for Leishmania has long been debated but the abundance of hybrid parasites described in nature [8][10] suggested that the exchange of genetic material can occur in the field. These observations received experimental confirmations where genetic crosses were made between Leishmania strains in the sand fly vector [11][13]. While powerful, achieving the generation of hybrid parasites in vitro would bring a distinct advantage for studying the contribution of genetic loci to the expression of particular phenotypic traits. Since its inception in the early 90's, gene transformation by electroporation has changed the field of parasitology, enabling constant progress in reverse genetic tools. However, these tools allow functional studies mostly at the level of single genes, at least in the natural genomic context [14]. Also, highly homologous sequences are required between the donor and recipient DNAs for successful recombination in Leishmania [15], which prevent, in general, the use of single constructs for inactivating the same genes in different species. Cross-species gene replacement was nonetheless described once in L. donovani [16]. Given the frequency of hybrid parasites in the field and their importance in shaping Leishmania population's heterogeneity, we assessed the possibility of generating cross-species recombinants in vitro by heterologous genomic DNA (gDNA) transfection. We describe a knock-in protocol based on whole genome transformation (WGT) that will be useful for studying the role of species-specific genomic loci and of nucleotide polymorphisms pertaining to the biology of Leishmania. We show that genomic regions up to 45 kb can be selectively transferred between Leishmania species and that inactivating the mismatch repair gene MSH2 can further facilitate the recovery of cross-species hybrids.


Cell lines, culture conditions and transfections

L. major Friedlin, L. infantum JPCM5 and L. infantum (MHOM/MA/67/ITMAP-263) promastigotes were grown at 25°C in SDM-79 medium supplemented with 10% heat inactivated fetal bovine serum and 10 µg/ml hemin. Transfectants were selected with 300 µg/ml of hygromycin (HYG); 1,500 µg/ml of paromomycin (PM); 100 µg/ml of blasticidin (BLA); 120 µg/ml of puromycin (PUR); or 40 µg/ml of neomycin (NEO). Electroporation was done in 2-mm cuvette using 400 µl of cells (1×108 of parasites) resuspended in HEPES-NaCl buffer [17] at 500 µF, 450 V (2.25 kV/cm) as previously described [18]. Transfection efficiency was evaluated by transfecting 1×108 parasites with 20 µg of gDNA or 5 µg of linear digested DNA, taking into account the number of colonies obtained and the number of parasites transfected. Following electroporation, parasites were grown in drug-free media overnight and then plated on SDM-agar (1% Noble Agar, Nunc.) containing the appropriate drug using the same concentration as in liquid SDM-79 medium. Colonies were counted from SDM-agar plates after growing 10 to 14 days at 25°C and the transformation efficiencies expressed per 10 µg of DNA.

The L. major Friedlin MF80.3 mutant was selected from a cloned parental population using a stepwise selection until they were resistant to 80 µM of miltefosine (MF) [19]. Miltefosine (MF) was purchased from Cayman Chemical (Ann Harbor, USA) and trivalent antimony (SbIII) was purchased from Sigma (Saint Louis, USA). N-methyl-N′-nitro-N-nitrosoniguanidine (MNNG) was purchased from Sigma (Saint Louis, USA) and was dissolved in 100% DMSO. Growth curves were obtained by measuring absorbance at 600 nm as previously described [20].

DNA manipulations

Total DNA was isolated using DNAzol reagent (Invitrogen) as recommended by the manufacturer. For quantitative Southern blots, the genomic DNA was digested with appropriate restriction enzymes and migrated in 0.8% agarose gels. Southern blots, hybridizations and washes were performed following standard protocols [21].

For every gene inactivation cassette, two pairs of primers were used to amplify regions of 500–600 bp upstream and downstream of the target gene. These DNAs were then fused to the NEO, HYG or BLA genes by overlap extension PCR [22], [23]. After electroporation, the integration of the inactivation cassette was confirmed by PCR and Southern blots. The inactivation of the gene pyridoxal kinase (LmjF30.1250) in L. major was previously described [19]. The pSP72-αBLAα-LRP plasmid was generated by cloning the Leucine Rich Repeat Protein (LRP) gene amplified from L. major with primer F-LRP (5′ GCG GATATCGCTGTTGGTGTTCGTGTCGTC) and Primer R-LRP (5′ GCG ATCGATCAGAGGCGGAGTGGGCTGTCC) into EcoRV and ClaI restriction sites of the pSP72-αBLAα- vector. The pSP-αPURα-MSH2 plasmid was generated by cloning the MSH2 gene amplified from L. infantum with primer F-MSH2 (5′ CGCTCTAGACGCACATGCACCTACGCACG) and Primer R-MSH2 (5′ CGCTCTAGACAAACAAGGATAGCGAGAAG) into the single XbaI restriction site of the psp72-αPURα vector. All the primers used for these constructs are listed in Table S1.

The pulse field gel electrophoresis was performed as previously described [24]. Briefly, we prepared low-melting point agarose blocks containing Leishmania parasites resuspended in HEPES buffer at a cell density of 1×108 parasites/ml. Parasites were lysed by incubating the blocks in lysis buffer (0.5 M EDTA [pH 9.5]; 1% SLS; 50 mg/ml of proteinase K). Chromosomes were resolved by a BioRad (Hercules, California, USA) contour-clamped homogeneous electric field (CHEF) mapper at a constant temperature of 14°C. Saccharomyces cerevisiae chromosomes were used as molecular weight markers. Chromosomes were revealed by ethidium bromide staining.

DNA amplification and sequencing

Multilocus sequencing analyses were performed with Leishmania hybrids by amplifying the genes located in the vicinity of the integrated selection marker using primers specific for genomic regions conserved between L. major and L. infantum. Primers were designed with Primer3 [25] and are listed in Table S2. PCR products were amplified using Phusion High Fidelity DNA polymerase (New England Biolabs, Inc.) and sequenced by conventional Sanger sequencing. Sequences were analyzed with the Lasergene software (DNASTAR, Inc.) and compared to the L. major and L. infantum sequences available at GeneDB (

Whole genome sequencing and analysis

Genomic DNAs were prepared from mid-log phase cultures of L. infantum 263 transfected with gDNA derived from L. major MF80.3ΔLmjF13.1540::NEO/LmjF13.1540 and from the clone 1 of L. infantum JPCM5 transfected with gDNA derived from L. major LmΔLRP::NEO/LRP as previously described [26]. Their sequences were determined by Illumina HiSeq1000 101-nucleotides paired-end reads which assembled into 4849 and 2774 contigs of at least 500 nucleotides for the L. infantum 263 and L. infantum JPCM5 hybrids, respectively. Sequence reads from each hybrid were aligned to the reference genome L. infantum JPCM5 [2] available at TriTrypDB (version 4.0) [27] using the software bwa (bwa aln, version 0.5.9) with default parameters [28]. The maximum number of mismatches was 4, the seed length was 32 and 2 mismatches were allowed within the seed. The detection of single nucleotide polymorphisms (SNPs) was performed using samtools (version 0.1.18), bcftools (distributed with samtools) and (distributed with samtools) [29], with a minimum of three reads to call a potential variation prior to further analysis. The sequence data are available at the EMBL European Nucleotide Archive (, accession number ERP001431 (samples ERS138995 and ERS138996 corresponding to the L. infantum 263 hybrid transfected with gDNA derived from LmMF80.3ΔLmjF13.1540::NEO/LmjF13.1540 and the L. infantum JPCM5 hybrid transfected with LmΔLRP::NEO/LRP gDNA, respectively). Several python (version 2.4.3) scripts and bash (version 3.2) scripts were created to further analyze the data. The quality assessment software samstat (v1.08) was used to generate quality reports [30].


Donor line generations

Our work was carried out with L. major and L. infantum, two species respectively responsible for cutaneous and visceral leishmaniasis that have an estimated 20–100 million years of divergence [31], [32]. Our strategy for selecting hybrid parasites was to introduce selectable markers (usually the NEO gene) into specific L. major genes, to electroporate total gDNA extracted from these recombinant parasites into recipient cells and to recover recombinant hybrids thriving under selection pressure. The first locus that was studied encodes for a leucine rich repeat protein (LRP) on chromosome 34 (LmjF34.0550) that we showed to be involved in resistance to antimonials [33], the chemotherapeutic mainstay against Leishmania. We generated mutants haploid for LRP by inserting NEO cassettes made to target either the LRP gene of L. major Friedlin (LmjF34.0550) or L. infantum strain 263 (LinJ34_V3.0570) (Figure 1), giving rise to the LmΔLRP::NEO/LRP and Li263ΔLRP::NEO/LRP haploid lines, respectively (Figure 1B, 1D, lanes 2). We also successfully obtained LRP null mutants for both species (LmΔLRP::NEO/NEO and Li263ΔLRP::NEO/NEO) by loss of heterozygosity [34] after one round of allelic inactivation and higher drug selection (Figure 1B, 1D, lanes 3). Consistent with the role of LRP in antimonial resistance, the LmΔLRP::NEO/NEO and Li263ΔLRP::NEO/NEO mutants were more sensitive to antimonials (Figure 1 and data not shown). We also generated haploid mutants for genes present on chromosome 1 (LmjF01.0315), 5 (LmjF05.0610), 13 (LmjF13. 1540) and 30 (LmjF30.1250) of L. major Friedlin. With the exception of the L. major LmΔPK::NEO/PK mutant haploid for LmjF30.1250 (pyridoxal kinase gene) that has already been published [19], all other single NEO disruptions were generated for this study and molecular evidence for the haploid mutants can be found in Figure S1.

Figure 1. Targeted replacement of the L. major and L. infantum LRP gene.

Schematic drawing of the LRP locus with SalI sites of L. major and L. infantum (A, C). (B) Southern blot analysis of L. major Friedlin genomic DNA digested with SalI and hybridized with a 3′ UTR probe of LRP gene (a ~500 bp fragment just downstream the stop codon of LRP gene) (upper panel) and then with a LRP PCR amplified gene fragment of ~500 bp (bottom panel). (D) Southern blot analysis of L. infantum 263 genomic DNA digested with SalI and hybridized with a 3′ UTR probe of LRP gene (a ~500 bp fragment just downstream the stop codon of LRP gene) (upper panel) and then with the LRP PCR specific fragment (bottom panel). Molecular weight is indicated on the left. Lane 1, Leishmania WT cells; Lane 2, Leishmania SKO cells (LRP/NEO); 3, Leishmania DKO cells (NEO/NEO) at the LRP locus obtained by loss of heterozygosity. (E, F) SbIII susceptibilities of L. major and L. infantum LRP mutants and hybrid parasites. The EC50 values were determined by culturing promastigotes parasites in the presence of increasing concentrations of SbIII. The average of three independent experiments is shown with a statistical significance observed by Student's t-test (p<0.05) (*).


Generation of parasite hybrids

Whole genome transformation (WGT) has proven useful when working with naturally transformable microorganisms [35], [36] and electroporation was tested for rendering Leishmania cells competent to receive total gDNAs from other Leishmania strains. We first electroporated total gDNA derived from L. infantum Li263ΔLRP::NEO/LRP into wild-type (WT) L. infantum 263 recipients cells and recovered recombinant clones resistant to paromomycin, a drug for which NEO bestows resistance. The NEO marker integrated at the appropriate locus in most clones (Table 1), as determined by Southern blot analysis of digested DNA (data not shown) but also of chromosome sized blots since a NEO probe hybridized to chromosome 34 in recombinant clones but not in the initial L. infantum 263 WT cells (Figure 2A, lanes 1 and 2). Similar results were obtained for L. major Friedlin, where electroporation of gDNA derived from L. major LmΔLRP::NEO/LRP single disruptant into L. major Friedlin WT parasites led to transfectants growing in the presence of paromomycin (data not shown). Again, the NEO gene integrated properly at chromosome 34 in the recovered recombinants, as determined by Southern blot analysis of chromosome sized blots (data not shown). We also succeeded in electroporating total gDNA derived from L. infantum Li263ΔLRP::NEO/LRP into L. infantum JPCM5 WT recipients and isolated recombinants which have integrated the NEO marker at the level of chromosome 34 (Figure 2A, compare lanes 5 and 6). The latter results indicated that gDNAs electroporated in Leishmania can integrate at homologous loci, at least in the same strains or species.

Figure 2. Whole genome transformation in Leishmania and cross-species hybrid formation.

Genomic DNAs derived from LRP haploid mutants of L. infantum 263 (Li263ΔLRP::NEO/LRP) or L. major Friedlin (LmΔLRP::NEO/LRP) were used to transfect L. infantum 263 or L. infantum JPCM5 (WT) parasites. (A) Chromosomes were separated by CHEF, transferred, and hybridized with probes specific for the NEO gene or for LmjF34.0540 gene located just upstream of the LRP gene on chromosome 34. The 2,000 kb chromosome 34 is indicated by an arrow on the right. Lane 1, L. infantum 263 WT; Lanes 2–4, L. infantum 263 transfected with Li263ΔLRP::NEO/LRP gDNA (2); LmΔLRP::NEO/LRP gDNA (3–4); Lane 5, L. infantum JPCM5 WT; Lanes 6–7, L. infantum JPCM5 transfected with Li263ΔLRP::NEO/LRP gDNA or with LmΔLRP::NEO/LRP gDNA, respectively. (B) Schematic map of the genomic region encompassing the LRP gene of L. infantum JPCM5 (black boxes) and L. major Friedlin (white boxes). Hybrids with one allele of L. major and one allele of L. infantum are shown in gray. The genomic regions exchanged in the hybrids were mapped by sequencing individual amplified genes using primers amplifying both L. major and L. infantum genes (Tables S3, S4, S5) located in the vicinity of the integrated NEO marker. The sequence of the hybrid JPCM5 (1) was also obtained by next generation sequencing. The extent of the genomic DNA exchanged is indicated after sequence analysis. In the JPCM5 clone 1 hybrid, both L. infantum alleles were replaced by L. major.


Table 1. Summary of generation of Leishmania hybrids using different gDNA.


We then tested whether we could cross the species barrier and electroporated total gDNA derived from L. major LmΔLRP::NEO/LRP into either L. infantum 263 or JPCM5 WT cells. This indeed seemed to have occurred since a NEO marker was found to have integrated at the proper chromosome in both L. infantum strains (Figure 2A, lanes 3 and 7). This is significant as the construct used for inactivating the targeted allele is species-specific but the use of gDNAs allowed crossing the species barrier. The integration of the NEO marker into the homologous locus did not occur in all transfectant clones however, as the smear obtained in PFGE blots for one L. infantum 263 transfectant suggested a circularization of a NEO containing DNA fragments (Figure 2A, lane 4). This was indeed confirmed by the recovery of circular episomes from this transfectant by alkaline lysis (data not shown). In most transformation experiments the majority of clones had donor DNA integrated but episomal DNA was also observed in other clones (Table 1). While L. major and L. infantum are highly syntenic [2], there are nonetheless differences between homologous genes at the nucleotide level (mean 90% genome identity) and we capitalized on these natural single nucleotide polymorphisms (SNPs) to measure the extent of exchanged DNA between both species. By targeted sequencing of genomic regions located upstream and downstream of the NEO gene in one hybrid clone of L. infantum 263 and two hybrid clones of L. infantum JPCM5, we could infer that DNA fragments ranging from 20 kb to 40 kb were exchanged at the LRP locus between L. major and L. infantum (Figure 2B). For example, when we sequenced the LmjF34.0540 gene (LinJ34_V3.0560) in the 263 hybrid clone 1 we found an hybrid sequence with one allele with L. major and one allele with L. infantum sequences (Table S3). Sequencing of PCR fragments was done similarly with genes upstream and downstream of LinJ34_V3.0560 to find the first genes (LinJ34_V3.0530 and LinJ34_V3.0630) upstream and downstream NEO with exclusively L. infantum sequences. The genes in between were hybrids between L. infantum and L. major (Table S3). In this specific hybrid transfectant, the contiguous DNA transferred was estimated to be at least 40 kb. We used a similar strategy of multilocus sequencing to characterize the extent of DNA exchange in the hybrids JPCM5 clone 1 (Table S4) and clone 2 (Table S5). Interestingly, both L. infantum alleles were replaced by the L. major sequences in the JPCM5 clone 1 hybrid parasite, most probably by loss of heterozigocity (Figure 2B and Table S4). We also performed paired-ends next generation sequencing of the whole genome of the L. infantum JPCM5 hybrid clone 1. Sequence analysis revealed a single stretch of 1055 SNPs (381 within coding sequences) derived from L. major that spanned positions 212,950 to 234,918 (48 SNPs/kb). In contrast, only 131 SNPs were detected for the rest of the 1.8 Mb sequence of chromosome 34 upstream and downstream of the integrated L. major DNA fragment (0.07 SNP/kb). Most importantly, analysis of the sequenced genome revealed that no other genomic fragments derived from L. major Friedlin were co-transferred elsewhere in the genome (Figure 2B, hybrid JPCM5 (1)). Thus, targeted sequencing confirmed that we could generate L. infantum hybrid parasites containing up to 40 kb of contiguous L. major Friedlin sequence and whole genome sequencing confirmed this and also informed that no other DNAs inserted elsewhere in the genome. The integration was stable and maintained in the absence of selective pressure (not shown). Importantly, hybrids acquired the phenotype of the donor cells since every L. infantum 263 or L. infantum JPCM5 hybrid clones with a LRP/NEO integrated DNA had an increased sensitivity to SbIII (Figure 1F and data not shown).

The ability to select for the integration of NEO-marked gDNA from L. major into L. infantum recipients was not unique to the LRP locus. We recently inactivated one allele of the pyridoxal kinase gene in L. major (LmjF30.1250) [19] and the electroporation of gDNA derived from this haploid mutant (LmΔPK::NEO/PK) into L. infantum 263 and JPCM5 WT cells allowed recovering hybrid transfectants thriving under paromomycin pressure. Hybridization of chromosome sized blots confirmed the proper integration at the level of chromosome 30 (Figure 3A) and targeted sequencing of individual genes upstream and downstream of the NEO marker in both L. infantum hybrid strains (Tables S6 and S7) estimated that DNA fragments of 12 and 18 kb derived from L. major Friedlin had been exchanged at the PK locus of both L. infantum strains (Figure 3D). In the L. infantum 263 recipient, we observed both integration at the level of the chromosomal locus and a circular amplicon (Figure 3A, lane 2).

Figure 3. Generation of L. infantum hybrids.

Genomic DNAs derived from L. major Friedlin NEO recombinants were electroporated into L. infantum. Chromosomes of putative hybrids were separated by pulsed-field gel electrophoresis. (A) L. infantum 263 and JPCM5 wild-type cells (lanes 1, 3) were transformed with gDNA derived from LmΔPK::NEO/PK (LmjF30.1250) (lanes 2, 4). The hybridization of chromosome sized blots with probes derived from the NEO (left panel) or LmjF30.1255 (right panel) genes confirmed the proper integration of L. major DNA in L. infantum PK locus. (B) L. infantum JPCM5 and 263 WT cells (lanes 1, 3) were transfected with LmΔLmjF01.0315::NEO/LmjF01.0315 gDNA (lanes 2, 4). The hybridization of chromosome sized blots with probes derived from the NEO (left panel) or LmjF01.0310 (right panel) genes confirmed the proper integration of L. major DNA in L. infantum. (C) Generation of hybrids into L. infantum 263 MSH2 null mutants. The hybridization of chromosome sized blots with probes specific for the NEO gene (upper panel) confirmed the proper integration of L. major-derived DNA at the level of targeted chromosomes in L. infantum. Hybridizing the same blots with a probe specific for MSH2 (middle panel) confirmed the MSH2-null mutant status of the L. infantum recipients while PTR1 hybridization served as a loading control. L. infantum 263 wild-type parasites transfected with gDNA derived from L. major LmΔLRP::NEO/NEO (lane 1); L. infantum Li263ΔMSH2::HYG/BLA transfected with gDNA derived from L. major LmΔLRP::NEO/NEO (lanes 2 and 3) or L. major LmΔLmjF05.0610::NEO/LmjF05.0610 (lane 4). Schematic map of the genomic region encompassing the PK (D), the LmjF01.0315/LinJ01_V3.0315 (E), and LRP (F) genes of L. infantum JPCM5 (black boxes) or L. major Friedlin (white boxes) and hybrid regions with one allele derived from L. major and one allele from L. infantum (grey boxes) as determined by multilocus PCR sequencing (Tables S6, S7, S8, S9, S10).


To test the generality of hybrid formation, we generated haploid L. major Friedlin mutants for the LmjF01.0315 (LmΔLmjF01.0315::NEO/LmjF01.0315) or LmjF05.0610 (LmΔLmjF05.0610::NEO/LmjF05.0610) genes (Figure S1), both coding for proteins of unknown function. Electroporating L. infantum 263 WT cells with gDNA derived from LmΔ01.0315::NEO/LmjF01.0315 yielded paromomycin-resistant hybrids that had properly integrated the NEO gene at the level of chromosome 1 (Figure 3B, lane 4). Using our targeted DNA sequencing approach of individual genes around the NEO marker (Table S8), we could estimate that a 40 kb contiguous L. major DNA fragment replaced the L. infantum sequence in one allele (Figure 3E). Two bands were observed when hybridizing with the probe specific to chromosome 1 (Figure 3B), but this is probably related to the size polymorphism already reported for this chromosome [37]. It is hence probable that the NEO marker integrated in the chromosome with higher molecular weight (Figure 3B, lane 4). The integration of the NEO marker did not occur in the chromosome 1 of L. infantum JPCM5 however, as the smear obtained in PFGE blots for this transfectant indicated a circularization of the NEO cassette (Figure 3B, lane 2). However, the same L. infantum cells transfected with gDNA from LmΔLmjF05.0610::NEO/LmjF05.0610 failed to lead to any transfectants (Figure 4F). This suggested that hybrid formation differed between genomic loci targeted by WGT.

Figure 4. The inactivation of MSH2 increases the frequency of generation of cross-species hybrids.

(A) Schematic map of the wild-type and inactivated MSH2 alleles of L. infantum. (B) Southern blot analysis of gDNA derived from L. infantum WT (Lane 1), L. infantum MSH2 haploid mutant (Lane 2) and L. infantum MSH2 null mutant (Lane 3) digested with SacI and hybridized with a probe specific for the 3′ UTR of MSH2 (upper panel). The absence of MSH2 gene was confirmed by PCR using a pair of internal primers of the gene (middle panel); and primers for the amplification of LinJ34_V3.0540 were used as control (lower panel). Molecular weight is indicated on the left of the blot. (C–F) The number of recombinant clones obtained from 1×108 L. infantum 263 WT parasites (black bars), L. infantum Li263ΔMSH2::HYG:BLA (grey bars) and L. infantum Li263ΔMSH2::HYG:BLA complemented in trans for MSH2 (white bars) transfected with a linear LinJ28_V3.0330:NEO DNA PCR fragment amplified from L. infantum (C), a linear LmjF30.1250:NEO (PK) DNA PCR fragment amplified from L. major (D), gDNA derived from L. major Friedlin LmΔLRP::NEO/NEO (E), or gDNA derived from L. major Friedlin LmΔLmjF05.0610::NEO/LmjF05.0610 (F). The average of at least 3 experiments is indicated and the number of colonies is indicated per 10 µg of DNA.


Improving recipient cells

The efficiency of generation of hybrids containing up to 40 kb of sequences from another species was found to be low. Indeed, while the efficiency of transfection for NEO disruption PCR constructs targeting single genes was calculated to be 1×10−7, this was decreased about 10 fold when transfecting whole gDNA (Table 1). The lack of integration observed for some gDNAs, for example the gDNA derived from L. major LmΔLmjF05.0610::NEO/LmjF05.0610 into L. infantum (Figure 4F), could be due to several reasons but it could possibly occur if recombination between non identical DNAs was made more permissive. We first assessed whether overexpressing the RAD-51 recombinase gene (LinJ28_V3.0580) in L. infantum parasites [38] could increase recombination efficiency and lead more easily to hybrids but this has not been the case (results not shown). We then assessed whether the generation of hybrids with heterologous DNA would be more efficient in cells impaired for the mismatch repair (MMR) machinery since it was showed to prevent recombination between divergent sequences [39], [40]. In the related trypanosomatid parasite Trypanosoma brucei, the inactivation of the MMR gene MSH2 increased the efficiency of recombination between mismatched DNAs [41]. L. infantum has a single MSH2 gene (LinJ33_V3.0420) and we generated a L. infantum 263 MSH2 null-mutant (Li263ΔMSH2::HYG/BLA) by two successive rounds of allelic inactivation using HYG and BLA inactivation cassettes (Figure 4A) conferring resistance to hygromycin and blasticidin, respectively. The inactivation of MSH2 in Li263ΔMSH2::HYG/BLA was confirmed by Southern blot analysis of restricted DNA and by PCR using specific MSH2 primers (Figure 4B). A MSH2 chromosomal null mutant complemented in trans for MSH2 was also generated by transfecting Li263ΔMSH2::HYG/BLA with the rescue plasmid pSP72αPURα-MSH2 (data not shown).

Impairing with the MMR machinery is usually associated with an increased tolerance to N-methyl-N′-nitro-N-nitrosoniguanidine (MNNG), an alkylating agent that interferes with the proper replication of DNA by methylating the O6 position of guanine. While the L. infantum MSH2-deficient line had no significant growth difference in comparison to wild-type cells, we observed a small but significant increase in resistance to MNNG (Figure S2). Interestingly, the MSH2 null mutant was more proficient in recombination for small heterologous linear DNA fragments (Figure 4D) but not for those using homologous fragments (Figure 4C). Most importantly, the inactivation of MSH2 in L. infantum also allowed recovering a higher number of recombinants following electroporation with cross-species gDNA derived from L. major LmΔLRP::NEO/LRP (Figure 4E). By sequencing PCR fragments for genes upstream and downstream of NEO (Tables S9 and S10), we could determine that fragments of 35–45 kb were transferred in two independent clones of the L. infantum MSH2 null mutant hybrids (Figure 3F). Transfection in the MSH2 null mutant also allowed recovering recombinants when transfecting with gDNAs that otherwise did not led to hybrids with WT recipients. Indeed, while we could never recover paromomycin-resistant transfectants when transforming L. infantum 263 WT parasites with gDNA extracted from a L. major Friedlin line inactivated for one allele of the LmjF05.0610 gene (LmΔLmjF05.0610::NEO/LmjF05.0610) (Figure S1), the transformation of the L. infantum MSH2 null mutants consistently yielded recombinant parasites (Figure 4F). The hybridization of chromosome sized blots confirmed that the NEO gene integrated in the proper chromosome for every aforementioned WGTs (Figure 3C).

Application of whole genome transformation to study the role of a point mutation in drug resistance

The described procedure could prove very useful for applications regarding the role of genomic loci or SNPs in conferring a particular phenotypic trait like virulence or drug resistance. In Leishmania, the miltefosine transporter (MT) is a phospholipid flippase located at the plasma membrane of the parasite [42]. Point mutations in MT are correlated to resistance to MF [19], [42], a drug used for the treatment of antimonial-resistant infections in endemic regions [1]. We previously showed that the L. major Friedlin LmjF-MF80.3 miltefosine resistant mutant has a three nucleotide deletion (M547del) on both alleles of its MT gene (LmjF13.1530) [19]. The inactivating role of the mutations was inferred from transfection of episomal copies of the MT gene. In order to reconstruct MF resistance by WGT of LmjF-MF80.3 gDNA, one allele of the LmjF13.1540 gene located immediately downstream of MT on chromosome 13 was replaced by the NEO marker in LmjF-MF80.3, giving rise to the LmMF80.3ΔLmjF13.1540::NEO/LmjF13.1540 mutant (Figure S1C). The LmjF13.1540 gene codes for a protein of unknown function and its inactivation did not alter the MF resistance levels of LmjF-MF80.3 (data not shown). The transfection of L. infantum 263 WT parasites with gDNA derived from LmMF80.3ΔLmjF13.1540::NEO/LmjF13.1540 yielded paromomycin-resistant recombinants that integrated the NEO marker on the same chromosome as the MT gene (chromosome 13) (Figure 5A). Multi-locus PCR sequencing of the L. infantum recombinant (Table S11) estimated the size of the exchanged DNA to approximately 25 kb (Figure 5B). Furthermore, degenerate primers allowing the amplification of MT from both L. major (LmjF13.1530) and L. infantum (LinJ13_V3.1590) were used to amplify the MT locus in one representative L. infantum hybrid and the cloning of these amplified MT fragments into the pGEM-T-easy plasmid revealed a allele frequency of 60/40% for L. infantum WT/LmjF-MF80.3 among E. coli clones (Figure 5C). The L. infantum 263 hybrid thus integrated the M547del mutation from LmjF-MF80.3 on one of its MT allele while maintaining the other allele unaltered. This was confirmed by paired-ends next generation sequencing of the whole genome of this hybrid parasite, which further revealed that no other genomic fragment from LmMF80.3ΔLmjF13.1540::NEO/LmjF13.1540 integrated elsewhere in the genome. Whole genome sequencing revealed a single stretch of 29,2 kb with 541 SNPs (301 within coding sequences) derived from L. major that spanned positions 596,277 to 625,504 (19 SNPs/kb) on one allele of chromosome 13 that were transferred to L. infantum 263. In contrast only 35 SNPs were detected for the rest of the 645 kb sequence of chromosome 13 upstream and downstream the integrated L. major DNA fragment (0.05 SNP/kb).

Figure 5. Cross species functional phenotypic transfer.

(A) L. infantum 263 WT parasites were transfected with total gDNA derived from L. major Friedlin LmMF80.3ΔLmjF13.1540::NEO/LmjF13.1540 (Figure S1C). Chromosome sized blots were hybridized with probes specific for the LmjF13.1520 gene (left panel), located just upstream of the MT gene on chromosome 13, or for the NEO marker (right panel). Lane 1, L. infantum 263 WT; Lane 2, L. infantum hybrid for L. major LmMF80.3 gDNA at its MT locus. (B) Schematic map of the genomic region encompassing the MT gene of L. infantum JPCM5 (black boxes), L. major Friedlin MF80.3 (white boxes), and the hybrid region (grey boxes). The genomic regions exchanged in the L. infantum 263 hybrid were mapped by sequencing the genes located in the vicinity of the integrated NEO marker (Table S11) and by whole genome short reads next generation sequencing. (C) Sequence of the MT genes of L. major Friedlin (LmjF13.1530), L. major Friedlin MF80.3 [19] and L. infantum JPCM5 WT (LinJ13_V3.1590) respectively. The MT gene from L. infantum hybrids was amplified and cloned into the pGEM-T-easy vector. The analysis 10 independent E. coli clones identified L. infantum WT and L. major MF80.3 alleles in similar proportions indicating that the L. infantum hybrid is heterozygous at its MT locus. The asterisk (*) indicates the deletion of three nucleotides (M547del) present in L. major Friedlin MF80.3 [19] and sequence in red are polymorphisms between L. major and L. infantum. (D) L. infantum 263 WT parasites (Δ) and L. infantum 263 hybrid for LmMF80.3ΔLmjF13.1540::NEO/LmjF13.1540 at their MT locus (▴) were grown in increasing concentrations of miltefosine and their EC50 values determined. The mean of three independent experiments is indicated. A statistical significance was observed by Student's t-test (p<0.05).


Most importantly, and as a proof-of-principle of our facile strategy to introduce knock-ins in Leishmania, an increased resistance to MF was specifically observed for the L. infantum hybrid that acquired the M547del from LmjF-MF80.3 at their MT locus (Figure 5D).


Homologous gene targeting is a powerful reverse genetic approach allowing to test the functions of specific gene products in trypanosomatid parasites like Leishmania [14]. However, available tools only allow performing studies at the level of genes or small DNA fragments and do not allow investigating the role of large genomic loci or of easy assessment of specific point mutations in a natural genomic context. The most critical parameters for successful homologous recombination in Leishmania are the degree of homology and the length of homologous sequences between the donor and recipient DNAs [15]. While gene content and synteny is highly conserved between species of Leishmania, the high degree of variations observed at the level of nucleotide sequences [2], [3] usually preclude the use of unique DNA constructs for targeting homologous loci between species (Figures 4D, 4F). Genetic exchange among natural populations of Leishmania has long been suspected [10], [43] and recently received experimental confirmation [11], with some hybrids even reported to acquire increased fitness or transmission potential [44]. In rare cases are these hybrids crossing the species barrier but natural hybrids between L. major and L. infantum have been described [10].

In this study, we describe a protocol based on WGT that enables the transfer of large DNA fragments between strains and species of Leishmania. Integrations occurred at different genomic loci on distinct chromosomes in recipient cells and up to 45 kb of heterologous gDNA was exchanged between species. Such size limitation could be due to several factors like breakage of the high molecular weight DNA during transformation or structural variations in the genome of recipient cells that would disrupt the progress of recombination. This contrasts with the genome-wide heterozygosity that seems to be happening for hybrids generated in the sand fly vector either in a natural context [10] or in experimental settings [11][13]. Notwithstanding, genetic crosses performed in the sand fly vector normally only delimits phenotypic traits to loci covering tens of genes and our approach should thus reveal a valuable complement for narrowing down the list of candidates. Targeted sequencing analyses indicated that recombination events took place between and within orthologous genes in hybrid recombinants, which is consistent with the extensive synteny of Leishmania genomes [2]. Interestingly, we noticed that in the two events where the whole genomes of hybrids were sequenced those recombination events occurred in regions of highest homology (recombination sites were in regions of 95% identities while the average region was 90% identical).

The presence of a selection marker on either one or two alleles in the donor gDNAs did not affect the efficiency of transformation (results not shown) but the rates of targeting were different depending on the donor and recipient strains of Leishmania. Indeed, our results are consistent with the degree of divergence at the nucleotide level between Leishmania species [2], [45] since we were unable to obtain L. major or L. infantum hybrids when using donor gDNAs derived from two independent L. (V.) braziliensis lines having a NEO marker integrated at distinct genomic locations,(result not shown). This correlates with the recombination events described in natural populations of Leishmania, which mainly implicates closely related species like L. major/L. infantum [10], L. panamensis/L. braziliensis or L. panamensis/L. guyanensis [46][48]. We focused our transformation experiments with L. infantum as the recipient cell of heterologous DNA. We succeeded once in creating a L. major hybrid with L. infantum DNA (results not shown) but this was more difficult and transformation of other L. infantum gDNA donors in L. infantum never led to L. major transformants being either integrated or episomal (data not shown). This may relate to the ten-fold lower efficiency of transformation of L. major [49], [50] and one might thus be successful at obtaining L. major recombinant hybrids by improving transfection efficiencies.

While we were able to recover recombinants for most of the genomic loci tested, some chromosomal locations were nonetheless targeted less efficiently. The MMR machinery plays a critical role in maintaining genetic stability by correcting for base mismatches that can arise through replication errors or chemical damage [51] and also influences the frequency of homologous recombination between divergent sequences [41], [52]. Interestingly, interfering with the MMR machinery in Leishmania increased the number of hybrid clones for these loci less amenable to hybrid formation, probably by dimming the barriers for recombination between mismatched DNA (Figure 4). We also found a background of transfectants maintaining the selection marker as part of extrachromosomal amplicons for most loci (Figure 2A, lane 4; Figure 3B, lane 2, Table 1). The hybridization of chromosome-sized blots from several independent hybrid clones indicated that the relative abundance of chromosomal targeting and episomal maintenance of the selection marker varied depending on the donor gDNAs but in the majority of clones, the DNA was integrated (Table 1). Extrachromosomal circles can be generated by homologous recombination between repeated genomic sequences in Leishmania [53], [54]. It is thus likely that these circles were generated by recombination between repeated sequences present on large DNA fragments including the NEO marker. Extrachromosomal circles were not stable and were lost in the absence of selective pressure (not shown).

Whole genome transformation in naturally competent bacteria was shown to lead to the acquisition of several distinct donor DNA segments that optimally replace up to 3% of the genome of recipient cells [35]. This is in contrast to the unique integration events observed in the genome of Leishmania hybrids (Figure 2B, Figure 5B), for which homologous recombination were restricted to genomic loci surrounding the selection marker as shown by whole genome sequencing. It may be possible to further increase the efficiency of recombination by manipulating the expression of recombination enzymes and more loci could be targeted by the use of additional selection markers in the same cell. On the other hand, this controlled recombination prevents the likelihood of phenotypic artefacts due to surrogate DNA exchange events. The method presented here is now allowing the in vitro generation of hybrid parasites allowing for testing for gene functions in a natural genomic context. This technique of hybrid formation has also the potential to be useful for other microbial pathogens.

Supporting Information

Figure S1.

Targeted replacement of the L. major Friedlin genes. SKO parasites for the genes LmjF01.0315 and LmjF05.0610 were generated in L. major Friedlin WT parasites (A and B respectively) while the gene LmjF13.1540 was inactivated by NEO in the mutant MF80.3 of L. major Friedlin parasites (C). (A) Schematic drawing of the LmjF01.0315 locus with SacI sites of L. major and the respective Southern blot analysis hybridized with a 5′ UTR probe (a ~500 bp fragment just downstream the start codon of the gene). (B) Schematic drawing of the LmjF05.0610 locus with SacI sites of L. major and the respective Southern blot analysis hybridized with a 5′ UTR probe (a ~500 bp fragment just upstream the start codon of the gene) L. major Friedlin (wild-type) (1) and its respective SKO:NEO (2). (C) Schematic drawing of the LmjF13.1540 locus with PstI sites of L. major MF80.3 and the respective Southern blot analysis hybridized with a 5′ UTR probe (a ~500 bp fragment just upstream the start codon of the gene). L. major Friedlin MF80.3 (1) and its respective SKO:NEO (2).



Figure S2.

MSH2 knockout cells grow similarly to wild-type cells but have increased alkylation tolerance. (A) Growth of promastigotes in vitro. Parasites were inoculated at 2×105 cells/ml and then they were counted every 24 hours. The mean of three independent experiments are indicated. L. infantum 263 wild-type parasite (Δ), double replacement clone (Li263ΔMSH2::HYG:BLA) (•) and double replacement clone complemented with MSH2 gene (Li263ΔMSH2::HYG:BLA) [pSP72αPURα-MSH2] (▪). (B) Promastigotes parasites were grown in increased concentrations of MNNG (Nmethyl-N′-nitro-N-nitrosoniguanidine) and the EC50 values were determined after 72 hours of growth. The mean of three independent experiments are indicated with a statistical significance observed by Student's t-test (p<0.05) (*).



Table S1.

Primers used for generation of Leishmania genes Knockout and cloning of MSH2 gene.



Table S2.

Loci analyzed by multilocus sequencing typing. Primers forward and reverse were used for both DNA amplification and sequencing.



Table S3.

Loci analyzed by multilocus sequencing typing genes. Primers forward and reverse were used for both DNA amplification and sequencing (Table S2). The natural polymorphisms between L. major and L. infantum enabled mapping the size of exchanged DNA by sequencing. The SNPs found in the hybrid 263 (1) of Figure 2 are listed by their respective position in the gene.



Table S4.

Loci analyzed by multilocus sequencing typing genes. Primers forward and reverse were used for both DNA amplification and sequencing (Table S2). The natural polymorphisms between L. major and L. infantum enabled mapping the size of exchanged DNA by sequencing. The SNPs found in the hybrid JPCM5 (1) of Figure 2 are listed by their respective position in the gene.



Table S5.

Loci analyzed by multilocus sequencing typing genes. Primers forward and reverse were used for both DNA amplification and sequencing (Table S2). The natural polymorphisms between L. major and L. infantum enabled mapping the size of exchanged DNA by sequencing. The SNPs found in the hybrid JPCM5 (2) of Figure 2 are listed by their respective position in the gene.



Table S6.

Loci analyzed by multilocus sequencing typing genes. Primers forward and reverse were used for both DNA amplification and sequencing (Table S2). The natural polymorphisms between L. major and L. infantum enabled mapping the size of exchanged DNA by sequencing. The SNPs found in the hybrid L. infantum 263 of Figure 3D are listed by their respective position in the gene.



Table S7.

Loci analyzed by multilocus sequencing typing genes. Primers forward and reverse were used for both DNA amplification and sequencing (Table S2). The natural polymorphisms between L. major and L. infantum enabled mapping the size of exchanged DNA by sequencing. The SNPs found in the hybrid L. infantum JPCM5 of Figure 3D are listed by their respective position in the gene.



Table S8.

Loci analyzed by multilocus sequencing typing genes. Primers forward and reverse were used for both DNA amplification and sequencing (Table S2). The natural polymorphisms between L. major and L. infantum enabled mapping the size of exchanged DNA by sequencing. The SNPs found in the hybrid L. infantum 263 of Figure 3E are listed by their respective position in the gene.



Table S9.

Loci analyzed by multilocus sequencing typing genes. Primers forward and reverse were used for both DNA amplification and sequencing (Table S2). The natural polymorphisms between L. major and L. infantum enabled mapping the size of exchanged DNA by sequencing. The SNPs found in the hybrid 263 (2) of Figure 3F are listed by their respective position in the gene.



Table S10.

Loci analyzed by multilocus sequencing typing genes. Primers forward and reverse were used for both DNA amplification and sequencing (Table S2). The natural polymorphisms between L. major and L. infantum enabled mapping the size of exchanged DNA by sequencing. The SNPs found in the hybrid 263 (3) of Figure 3F are listed by their respective position in the gene.



Table S11.

Loci analyzed by multilocus sequencing typing genes. Primers forward and reverse were used for both DNA amplification and sequencing (Table S2). The natural polymorphisms between L. major and L. infantum enabled mapping the size of exchanged DNA by sequencing. The SNPs found in the hybrid L. infantum 263 of Figure 5 are listed by their respective position in the gene.




We thank Sébastien Boisvert for helping in bioinformatics analysis and Dr. Don Morrisson, University of Chicago, for discussions on WGT approaches. M.O. was a Burroughs Wellcome Fund Scholar in Molecular Parasitology and holds the Canada Research Chair in Antimicrobial Resistance.

Author Contributions

Conceived and designed the experiments: ACC MO. Performed the experiments: ACC. Analyzed the data: ACC PL. Contributed reagents/materials/analysis tools: PL. Wrote the paper: ACC PL MO.


  1. 1. Murray HW, Berman JD, Davies CR, Saravia NG (2005) Advances in leishmaniasis. Lancet 366: 1561–1577. doi: 10.1016/s0140-6736(05)67629-5
  2. 2. Peacock CS, Seeger K, Harris D, Murphy L, Ruiz JC, et al. (2007) Comparative genomic analysis of three Leishmania species that cause diverse human disease. Nat Genet 39: 839–847. doi: 10.1038/ng2053
  3. 3. Rogers MB, Hilley JD, Dickens NJ, Wilkes J, Bates PA, et al. (2011) Chromosome and gene copy number variation allow major structural change between species and strains of Leishmania. Genome Res 21: 2129–2142. doi: 10.1101/gr.122945.111
  4. 4. Sterkers Y, Lachaud L, Crobu L, Bastien P, Pages M (2011) FISH analysis reveals aneuploidy and continual generation of chromosomal mosaicism in Leishmania major. Cell Microbiol 13: 274–283. doi: 10.1111/j.1462-5822.2010.01534.x
  5. 5. Zhang WW, Mendez S, Ghosh A, Myler P, Ivens A, et al. (2003) Comparison of the A2 gene locus in Leishmania donovani and Leishmania major and its control over cutaneous infection. J Biol Chem 278: 35508–35515. doi: 10.1074/jbc.m305030200
  6. 6. Rochette A, Raymond F, Ubeda JM, Smith M, Messier N, et al. (2008) Genome-wide gene expression profiling analysis of Leishmania major and Leishmania infantum developmental stages reveals substantial differences between the two species. BMC Genomics 9: 255. doi: 10.1186/1471-2164-9-255
  7. 7. Cohen-Freue G, Holzer TR, Forney JD, McMaster WR (2007) Global gene expression in Leishmania. Int J Parasitol 37: 1077–1086. doi: 10.1016/j.ijpara.2007.04.011
  8. 8. Banuls AL, Hide M, Tibayrenc M (2002) Evolutionary genetics and molecular diagnosis of Leishmania species. Trans R Soc Trop Med Hyg 96 Suppl 1S9–13. doi: 10.1016/s0035-9203(02)90045-3
  9. 9. Lukes J, Mauricio IL, Schonian G, Dujardin JC, Soteriadou K, et al. (2007) Evolutionary and geographical history of the Leishmania donovani complex with a revision of current taxonomy. Proc Natl Acad Sci U S A 104: 9375–9380. doi: 10.1073/pnas.0703678104
  10. 10. Ravel C, Cortes S, Pratlong F, Morio F, Dedet JP, et al. (2006) First report of genetic hybrids between two very divergent Leishmania species: Leishmania infantum and Leishmania major. Int J Parasitol 36: 1383–1388. doi: 10.1016/j.ijpara.2006.06.019
  11. 11. Akopyants NS, Kimblin N, Secundino N, Patrick R, Peters N, et al. (2009) Demonstration of genetic exchange during cyclical development of Leishmania in the sand fly vector. Science 324: 265–268. doi: 10.1126/science.1169464
  12. 12. Sadlova J, Yeo M, Seblova V, Lewis MD, Mauricio I, et al. (2011) Visualisation of Leishmania donovani fluorescent hybrids during early stage development in the sand fly vector. PLoS One 6: e19851. doi: 10.1371/journal.pone.0019851
  13. 13. Miles MA, Yeo M, Mauricio IL (2009) Genetics. Leishmania exploit sex. Science 324: 187–189. doi: 10.1126/science.1172789
  14. 14. Beverley SM (2003) Protozomics: trypanosomatid parasite genetics comes of age. Nat Rev Genet 4: 11–19. doi: 10.1038/nrg980
  15. 15. Papadopoulou B, Dumas C (1997) Parameters controlling the rate of gene targeting frequency in the protozoan parasite Leishmania. Nucleic Acids Res 25: 4278–4286. doi: 10.1093/nar/25.21.4278
  16. 16. Krobitsch S, Clos J (2000) Cross-species homologous recombination in Leishmania donovani reveals the sites of integration. Mol Biochem Parasitol 107: 123–128. doi: 10.1016/s0166-6851(00)00180-8
  17. 17. Laban A, Tobin JF, Curotto de Lafaille MA, Wirth DF (1990) Stable expression of the bacterial neor gene in Leishmania enriettii. Nature 343: 572–574. doi: 10.1038/343572a0
  18. 18. Papadopoulou B, Roy G, Ouellette M (1992) A novel antifolate resistance gene on the amplified H circle of Leishmania. Embo J 11: 3601–3608.
  19. 19. Coelho AC, Boisvert S, Mukherjee A, Leprohon P, Corbeil J, et al. (2012) Multiple Mutations in Heterogeneous Miltefosine-Resistant Leishmania major Population as Determined by Whole Genome Sequencing. PLoS Negl Trop Dis 6: e1512. doi: 10.1371/journal.pntd.0001512
  20. 20. Ouellette M, Fase-Fowler F, Borst P (1990) The amplified H circle of methotrexate-resistant Leishmania tarentolae contains a novel P-glycoprotein gene. Embo J 9: 1027–1033.
  21. 21. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: a Laboratory Manual. New York: Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
  22. 22. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: 61–68. doi: 10.1016/0378-1119(89)90359-4
  23. 23. Moreira W, Leblanc E, Ouellette M (2009) The role of reduced pterins in resistance to reactive oxygen and nitrogen intermediates in the protozoan parasite Leishmania. Free Radic Biol Med 46: 367–375. doi: 10.1016/j.freeradbiomed.2008.10.034
  24. 24. Grondin K, Papadopoulou B, Ouellette M (1993) Homologous recombination between direct repeat sequences yields P-glycoprotein containing amplicons in arsenite resistant Leishmania. Nucleic Acids Res 21: 1895–1901. doi: 10.1093/nar/21.8.1895
  25. 25. Koressaar T, Remm M (2007) Enhancements and modifications of primer design program Primer3. Bioinformatics 23: 1289–1291. doi: 10.1093/bioinformatics/btm091
  26. 26. Raymond F, Boisvert S, Roy G, Ritt JF, Legare D, et al. (2011) Genome sequencing of the lizard parasite Leishmania tarentolae reveals loss of genes associated to the intracellular stage of human pathogenic species. Nucleic Acids Res doi: 10.1093/nar/gkr834
  27. 27. Aslett M, Aurrecoechea C, Berriman M, Brestelli J, Brunk BP, et al. (2010) TriTrypDB: a functional genomic resource for the Trypanosomatidae. Nucleic Acids Res 38: D457–462. doi: 10.1093/nar/gkp851
  28. 28. Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25: 1754–1760. doi: 10.1093/bioinformatics/btp324
  29. 29. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, et al. (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25: 2078–2079. doi: 10.1093/bioinformatics/btp352
  30. 30. Lassmann T, Hayashizaki Y, Daub CO (2011) SAMStat: monitoring biases in next generation sequencing data. Bioinformatics 27: 130–131. doi: 10.1093/bioinformatics/btq614
  31. 31. Kerr SF (2006) Molecular trees of trypanosomes incongruent with fossil records of hosts. Mem Inst Oswaldo Cruz 101: 25–30. doi: 10.1590/s0074-02762006000100006
  32. 32. Momen H, Cupolillo E (2000) Speculations on the origin and evolution of the genus Leishmania. Mem Inst Oswaldo Cruz 95: 583–588. doi: 10.1590/s0074-02762000000400023
  33. 33. Genest PA, Haimeur A, Legare D, Sereno D, Roy G, et al. (2008) A protein of the leucine-rich repeats (LRRs) superfamily is implicated in antimony resistance in Leishmania infantum amastigotes. Mol Biochem Parasitol 158: 95–99. doi: 10.1016/j.molbiopara.2007.11.008
  34. 34. Gueiros-Filho FJ, Beverley SM (1996) Selection against the dihydrofolate reductase-thymidylate synthase (DHFR-TS) locus as a probe of genetic alterations in Leishmania major. Mol Cell Biol 16: 5655–5663.
  35. 35. Mell JC, Shumilina S, Hall IM, Redfield RJ (2011) Transformation of natural genetic variation into haemophilus influenzae genomes. PLoS Pathog 7: e1002151. doi: 10.1371/journal.ppat.1002151
  36. 36. Billal DS, Feng J, Leprohon P, Legare D, Ouellette M (2011) Whole genome analysis of linezolid resistance in Streptococcus pneumoniae reveals resistance and compensatory mutations. BMC Genomics 12: 512. doi: 10.1186/1471-2164-12-512
  37. 37. Bishop RP, Miles MA (1987) Chromosome size polymorphisms of Leishmania donovani. Mol Biochem Parasitol 24: 263–272. doi: 10.1016/0166-6851(87)90158-7
  38. 38. Genois MM, Mukherjee A, Ubeda JM, Buisson R, Paquet ER, et al. (2012) Interactions between BRCA2 and RAD51 for promoting homologous recombination in Leishmania infantum (in press). Nucleic Acids Res doi: 10.1093/nar/gks306
  39. 39. Paques F, Haber JE (1999) Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol Mol Biol Rev 63: 349–404.
  40. 40. Negritto MT, Wu X, Kuo T, Chu S, Bailis AM (1997) Influence of DNA sequence identity on efficiency of targeted gene replacement. Mol Cell Biol 17: 278–286.
  41. 41. Barnes RL, McCulloch R (2007) Trypanosoma brucei homologous recombination is dependent on substrate length and homology, though displays a differential dependence on mismatch repair as substrate length decreases. Nucleic Acids Res 35: 3478–3493. doi: 10.1093/nar/gkm249
  42. 42. Perez-Victoria FJ, Gamarro F, Ouellette M, Castanys S (2003) Functional cloning of the miltefosine transporter. A novel P-type phospholipid translocase from Leishmania involved in drug resistance. J Biol Chem 278: 49965–49971. doi: 10.1074/jbc.m308352200
  43. 43. Rougeron V, De Meeus T, Hide M, Waleckx E, Bermudez H, et al. (2009) Extreme inbreeding in Leishmania braziliensis. Proc Natl Acad Sci U S A 106: 10224–10229. doi: 10.1073/pnas.0904420106
  44. 44. Volf P, Benkova I, Myskova J, Sadlova J, Campino L, et al. (2007) Increased transmission potential of Leishmania major/Leishmania infantum hybrids. Int J Parasitol 37: 589–593. doi: 10.1016/j.ijpara.2007.02.002
  45. 45. El-Sayed NM, Myler PJ, Blandin G, Berriman M, Crabtree J, et al. (2005) Comparative genomics of trypanosomatid parasitic protozoa. Science 309: 404–409. doi: 10.1126/science.1112181
  46. 46. Banuls AL, Guerrini F, Le Pont F, Barrera C, Espinel I, et al. (1997) Evidence for hybridization by multilocus enzyme electrophoresis and random amplified polymorphic DNA between Leishmania braziliensis and Leishmania panamensis/guyanensis in Ecuador. J Eukaryot Microbiol 44: 408–411. doi: 10.1111/j.1550-7408.1997.tb05716.x
  47. 47. Belli AA, Miles MA, Kelly JM (1994) A putative Leishmania panamensis/Leishmania braziliensis hybrid is a causative agent of human cutaneous leishmaniasis in Nicaragua. Parasitology 109(Pt 4):435–442. doi: 10.1017/s0031182000080689
  48. 48. Dujardin JC, Banuls AL, Llanos-Cuentas A, Alvarez E, DeDoncker S, et al. (1995) Putative Leishmania hybrids in the Eastern Andean valley of Huanuco, Peru. Acta Trop 59: 293–307. doi: 10.1016/0001-706x(95)00094-u
  49. 49. Lye LF, Owens K, Shi H, Murta SM, Vieira AC, et al. (2010) Retention and loss of RNA interference pathways in trypanosomatid protozoans. PLoS Pathog 6: e1001161. doi: 10.1371/journal.ppat.1001161
  50. 50. Robinson KA, Beverley SM (2003) Improvements in transfection efficiency and tests of RNA interference (RNAi) approaches in the protozoan parasite Leishmania. Mol Biochem Parasitol 128: 217–228. doi: 10.1016/s0166-6851(03)00079-3
  51. 51. Schofield MJ, Hsieh P (2003) DNA mismatch repair: molecular mechanisms and biological function. Annu Rev Microbiol 57: 579–608. doi: 10.1146/annurev.micro.57.030502.090847
  52. 52. Bell JS, Harvey TI, Sims AM, McCulloch R (2004) Characterization of components of the mismatch repair machinery in Trypanosoma brucei. Mol Microbiol 51: 159–173. doi: 10.1046/j.1365-2958.2003.03804.x
  53. 53. Beverley SM (1991) Gene amplification in Leishmania. Annu Rev Microbiol 45: 417–444. doi: 10.1146/annurev.mi.45.100191.002221
  54. 54. Borst P, Ouellette M (1995) New mechanisms of drug resistance in parasitic protozoa. Annu Rev Microbiol 49: 427–460. doi: 10.1146/annurev.mi.49.100195.002235