JFD and CD conceived and designed the experiments. JFD, BK, NP, RMTG, SMCR, KG, MP, AA, GFS, JD, ESCK, HS, PS, MIdMCP, and WKR performed the experiments. JFD, EMN, and CD analyzed the data. BK, RMTG, SMCR, GFS, JD, ESCK, HS, PS, MIdMCP, and WKR contributed materials. JFD and CD wrote the paper.
The authors have declared that no competing interests exist.
Detection and quantification of hepatitis C virus (HCV) RNA is integral to diagnostic and therapeutic regimens. All molecular assays target the viral 5′-noncoding region (5′-NCR), and all show genotype-dependent variation of sensitivities and viral load results. Non-western HCV genotypes have been under-represented in evaluation studies. An alternative diagnostic target region within the HCV genome could facilitate a new generation of assays.
In this study we determined by de novo sequencing that the 3′-X-tail element, characterized significantly later than the rest of the genome, is highly conserved across genotypes. To prove its clinical utility as a molecular diagnostic target, a prototype qualitative and quantitative test was developed and evaluated multicentrically on a large and complete panel of 725 clinical plasma samples, covering HCV genotypes 1–6, from four continents (Germany, UK, Brazil, South Africa, Singapore). To our knowledge, this is the most diversified and comprehensive panel of clinical and genotype specimens used in HCV nucleic acid testing (NAT) validation to date. The lower limit of detection (LOD) was 18.4 IU/ml (95% confidence interval, 15.3–24.1 IU/ml), suggesting applicability in donor blood screening. The upper LOD exceeded 10−9 IU/ml, facilitating viral load monitoring within a wide dynamic range. In 598 genotyped samples, quantified by Bayer VERSANT 3.0 branched DNA (bDNA), X-tail-based viral loads were highly concordant with bDNA for all genotypes. Correlation coefficients between bDNA and X-tail NAT, for genotypes 1–6, were: 0.92, 0.85, 0.95, 0.91, 0.95, and 0.96, respectively; X-tail-based viral loads deviated by more than 0.5 log10 from 5′-NCR-based viral loads in only 12% of samples (maximum deviation, 0.85 log10). The successful introduction of X-tail NAT in a Brazilian laboratory confirmed the practical stability and robustness of the X-tail-based protocol. The assay was implemented at low reaction costs (US$8.70 per sample), short turnover times (2.5 h for up to 96 samples), and without technical difficulties.
This study indicates a way to fundamentally improve HCV viral load monitoring and infection screening. Our prototype assay can serve as a template for a new generation of viral load assays. Additionally, to our knowledge this study provides the first open protocol to permit industry-grade HCV detection and quantification in resource-limited settings.
Christian Drosten and colleagues develop, validate, and make openly available a prototype hepatitis C virus assay based on the conserved 3' X-tail element, with potential for clinical use in developing countries.
About 3% of the world's population (170 million people) harbor long-term (chronic) infections with the hepatitis C virus (HCV) and about 3–4 million people are newly infected with this virus every year. HCV—a leading cause of chronic hepatitis (inflammation of the liver)—is spread through contact with the blood of an infected person. Globally, the main routes of transmission are the use of unscreened blood for transfusions and the reuse of inadequately sterilized medical instruments, including needles. In affluent countries, where donated blood is routinely screened for the presence of HCV, most transmission is through needle sharing among drug users. The risk of sexual and mother-to-child transmission of HCV is low. Although HCV infection occasionally causes an acute (short-lived) illness characterized by tiredness and jaundice (yellow eyes and skin), most newly infected people progress to a symptom-free, chronic infection that can eventually cause liver cirrhosis (scarring) and liver cancer. HCV infections can be treated with a combination of two drugs called interferon and ribavirin, but these drugs are expensive and are ineffective in many patients.
An effective way to limit the global spread of HCV might be to introduce routine screening of the blood that is used for transfusions in developing countries. In developed countries, HCV screening of blood donors use expensive, commercial “RT-PCR” assays to detect small amounts of HCV ribonucleic acid (RNA; HCV stores the information it needs to replicate itself—its genome—as a sequence of “ribonucleotides”). All the current HCV assays, which can also quantify the amount of viral RNA in the blood (the viral load) during treatment, detect a target sequence in the viral genome called the 5′-noncoding region (5′-NCR). However, there are several different HCV “genotypes” (strains). These genotypes vary in their geographical distribution and, even though the 5′-NCR sequence is very similar (highly conserved) in the common genotypes (HCV genotypes 1–6), the existing assays do not detect all the variants equally well. This shortcoming, together with their high cost, means that 5′-NCR RT-PCR assays are not ideal for use in many developing countries. In this study, the researchers identify an alternative diagnostic target sequence in the HCV genome—the 3′-X-tail element—and ask whether this sequence can be used to develop a new generation of tests for HCV infection that might be more appropriate for use in developing countries.
The researchers determined the RNA sequence of the 3′-X-tail element in reference samples of the major HCV genotypes and showed that this region of the HCV genome is as highly conserved as the 5′-NCR. They then developed a prototype X-tail RT-PCR assay and tested its ability to detect small amounts of HCV and to measure viral load in genotype reference samples and in a large panel of HCV-infected blood samples collected in Germany, the UK, Brazil, South Africa, and Singapore. The new assay detected low levels of HCV RNA in all of the genotype reference samples and was also able to quantify high RNA concentrations. The viral load estimates it provided for the clinical samples agreed well with those obtained using a commercial assay irrespective of the sample's HCV genotype. Finally, the X-tail RT-PCR assay gave similar results to a standard assay at a fraction of the cost when used to measure viral loads in a Brazilian laboratory in an independent group of 127 patient samples collected in Brazil.
These findings suggest that the HCV 3′-X-tail element could provide an alternative target for screening blood samples for HCV infection and for monitoring viral loads during treatment, irrespective of HCV genotype. In addition, they suggest that X-tail RT-PCR assays may be stable and robust enough for use in laboratories in emerging countries. Overall, these findings should stimulate the development of a new generation of clinical HCV assays that, because the protocol used in the X-tail assay is freely available, could improve blood safety in developing countries by providing a cheap and effective alternative to existing proprietary HCV assays.
Please access these Web sites via the online version of this summary at
The World Health Organization has a fact sheet about
The US Centers for Disease Control and Prevention provides information on
The US National Institute of Diabetes and Digestive and Kidney Diseases provides basic information on
The MedlinePlus Encyclopedia has a page on
Hepatitis C virus (HCV) is one of the leading causes of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma [
Unfortunately, the design of both commercial and in-house tests for HCV suffers from properties of the viral 5′-noncoding region (5′-NCR). This region is thought to be the most conserved portion of the HCV genome [
Due to notorious problems with the 5′-NCR, a different target region would be beneficial. However, viral genes downstream of the 5′-NCR are not useful as diagnostic targets because of their nucleotide variability [
The World Health Organization (WHO) international standard reagent 96/798 was obtained from National Institute for Biological Standards and Control, (Hertfordshire, UK) [
For validation of the assay, a total of 725 human plasma samples (one sample per patient) were studied. Of these, 598 were obtained from routine clinical testing in Germany, UK, South Africa, Singapore, and Brazil (
Reactions of 50 μl contained 20 μl of RNA extract, 5× reaction buffer (Qiagen One-step RT-PCR kit), 200 μM of each dNTP, 200 nM of primer XTF5 (GTGGCTCCATCTTAGCCCTAGT), 300 nM of primer HCMgR2 (TGCGGCTCACGGACCTTT), 100 nM of HCV-specific probe HCVMGB2 (FAM-CACGGCTAGCTGTG-Black Hole Quencher 2/Minor grove binder), 100 nM of Internal Control-probe YFPY (VIC-ATCGTTCGTTGAGCGATTAGCAG-Black Hole Quencher 1), and 2 μl of Enzyme Mix. Thermal cycling was done on Applied Biosystems 7700 or 7500 SDS instruments under the following conditions: 55 °C, 10 min; 95 °C, 15 min; 45 cycles at 94 °C, 10 s and 58 °C, 15 s.
Statistical analyses were performed with the SPSS 13 (SPSS). Alignments were generated using BioEdit (
A STARD diagram and checklist are included in
Sequences determined in this study have been submitted to GenBank (
In order to examine the conservedness of the X-tail region, a nucleic acid sequence alignment was generated that contained all X-tail sequences stored in the LANL and euHCV databases as of January 2007. These databases comprised sequences classified as genotypes 1, 2, and 3. Sets of sequencing primers for the ultimate 3′-end of the genome were identified, and the X-tail was sequenced from reference plasma samples of HCV genotypes 1–6. Together with one outlier sequence taken from the initial characterization study on the X-tail [
Top panel: schematic representation of the HCV reference genome H77 as given in the 2008 LANL database.
Bottom panel: Percent nucleotide identity along the 5′-NCR and the X-tail, as calculated by a sliding window analysis with VectorNTI software. Window size was 2 nucleotides. The alignment used for the sliding window analysis contained the complete HCV genotype reference panel (
The complete 3′-UTR alignment was evaluated as a target for real-time PCR design. Since primer design software was not able to identify suitable candidate oligonucleotides, in a first approach five forward primers, five reverse primers, and two probes were selected upon inspection of the alignment. All of the 50 resulting real-time PCR sets were tested experimentally for reaction efficiency. However, even after selection of the most effective oligonucleotides and optimization of reaction conditions, the lower limit of detection (LOD) did not fall below 150 IU/ml (see
RNA secondary structures of both the X-tail and the 5′-NCR were modeled at PCR primer annealing conditions (58 °C and 50 mM ion concentration) using MFOLD [
Secondary structure of the HCV 5′-NCR (A) and the 3′-X-tail (B) of HCV 1a reference genome H77 as predicted by MFOLD [
(A) Binding sites of oligonucleotides used by the Roche Amplicor assay are shown in red (sense primer KY80, hybridization probe KY150, antisense primer KY78). Nucleotide variability at these binding sites is shown in
(B) Outer lines in red identify the hybridization sites of oligonucleotides used in initial X-tail RT-PCR set, yielding limited sensitivity (forward primer F5, TaqMan probe P1, reverse primer R7). Interior lines in green identify the final X-tail prototype assay (forward primer F5, reverse primer R2, probe MGB2). Nucleotide variability at these sites is shown in
Consequently, the antisense primer and probe binding sites were moved further upstream into the amplicon. Out of several new candidate primers and probes, an oligonucleotide combination was determined that provided very high amplification efficiency (final assay oligonucleotides as shown in the Materials and Methods section). These primers and probe were directly adjacent, without unoccupied nucleotides between them. Very few nucleotide mismatches occurred with any of the sequences taken from GenBank or determined from reference plasma (see
To assess the diagnostic applicability of the X-tail, this PCR set was developed into a clinical-grade prototype assay. The input RNA volume was maximized to 20 μl in a 50-μl assay volume, and the chemistry was adjusted for use with a semi-automated nucleic acids extraction. In order to detect PCR inhibition, a competitive internal control was incorporated. It was amplified by the same primers as the diagnostic target but was detected by a probe of different sequence composition and different fluorescent labeling. To enhance assay stability, control RNA was formulated to be nuclease resistant and added at working concentration to all reactions at the lysis buffer stage. As a reference standard for viral loads, a noninfectious and stable copy of the HCV 1a X-tail was cloned in an armored RNA phage (refer to
Before evaluation of its technical and clinical performance, the specificity of the assay for HCV was confirmed on cell culture supernatants or sera containing the following
A common technical specification for the sensitivity of NAT is the 95% LOD, i.e., the concentration down to which >95% of iterative tests will detect virus. 95% LODs for the X-tail-based prototype assay were determined for each individual genotype by parallel limiting dilution testing as described in
Lower LOD by HCV Genotype
Genotypes and numbers of samples (
Next, the upper quantification limit was evaluated, i.e., the maximal RNA concentration that can be measured without technical bias contributed by the system. This is relevant because HCV patients may show extraordinarily high viral loads. Synthetic Armored RNA standards exceeding clinically observed viral loads (1,890,000, 18,900,000, and 189,000,000 IU/ml) were tested. The determined quantities did not deviate from those expected by dilution factor (unpublished data).
Intra-assay coefficient of variation (CV) at 7,245,000 IU/ml of HCV RNA was 5.76% with a standard deviation (SD) of 0.03 log10. Inter-assay CVs ranged from 6.11 to 18.42% (SDs, 0.03–0.09 log10) at 1,890–189,000 IU/ml (refer to
To evaluate the utility of the X-tail in viral load monitoring, the prototype assay was compared against bDNA. The latter was chosen as a clinical gold standard because it represented a well-established assay that is more robust against genotype bias than other clinical assays [
Genotypes are indicated below the
Because correlation analysis only included samples that were positive in both tests, it did not reflect overall clinical sensitivity. A comparison of qualitative detection rates is shown in
Detection of HCV by X-Tail RT-PCR Versus bDNA
A total of 15 samples had viral loads above the upper cut-off of bDNA, requiring predilution and repetition of the bDNA assay. All of them were quantifiable by X-tail RT-PCR upon first testing.
Affordable viral load monitoring would be desirable in resource-limited settings with high HCV prevalence. To evaluate whether the X-tail prototype assay would provide adequate stability and quality in comparison to 5′-NCR-based assays, it was implemented in a diagnostic center involved in the Brazilian HCV treatment program. Protocols, controls, and standards for X-tail NAT were provided to the laboratory in Brazil. All other reagents were purchased locally. Plasma samples from 127 patients were tested by bDNA and X-tail NAT. The correlation coefficient between viral loads obtained with both assays was 0.97 (
127 samples were measured in a Brazilian HIV-1 viral load monitoring centre by Bayer VERSANT 3.0 HCV bDNA assay and by X-tail in-house PCR. (A) Correlation of viral loads between X-tail RT-PCR (
(B) Quantitative differences. The box shows the median and interquartile range (box length). The whiskers represent an extension of the 25th or 75th percentiles by 1.5 times the interquartile range. Datum points beyond the whisker range are considered as outliers and marked as asterisks.
In this study we have identified a new diagnostic target region in the HCV genome. A prototype RT-PCR assay based on the HCV X-tail proved to be highly sensitive (18.4 IU/ml, 95% probit probability), robust against genotype variation, and highly precise in virus quantification. The assay was efficiently implemented and projected to be highly cost efficient in an emerging country setting. These data may assist in translating state-of-the art diagnostic technology to less affluent settings.
The X-tail region of the HCV genome has been known for several years [
To circumvent the limitations that the 5′-NCR presents in diagnostics, we have established the HCV X-tail as a target for molecular detection and quantification. Initially we could not be sure about its utility for several reasons implied by its biological functions. A possible limitation could have been its position at the end of the genome and beyond the poly-U tract, making the X-tail prone to nuclease degradation. Moreover, due to its functions as a 3′-element it could have been associated strongly with viral or cellular proteins. Although we could not investigate these issues in our study, we are confident about its diagnostic utility from the clinical part of our study, showing that X-tail-based viral loads were highly concordant with results from bDNA testing. bDNA was chosen as a gold standard because it uses multiple probes along the 5′-NCR and initial core region and has proven to be the most robust viral load test compared to other assays [
In resource-limited settings our prototype assay could be used instead of more costly proprietary assays in HCV treatment and testing. It is not patented, has a simple and accessible formulation (refer to the bench protocol and instructions for requesting controls in
Approximate Pricing of HCV Viral Load Assays, US Dollars, without Taxes
Finally, HCV is an important issue for blood safety in emerging countries. Again, Brazil provides an example representative of many other emerging countries. An urgent federal decree in 2003 demanded the general testing of donated blood for HCV by NAT [
We previously demonstrated the feasibility of in-house testing of blood donors for HCV by NAT methods [
(29 KB DOC)
(29 KB DOC)
(31 KB DOC)
(27 KB DOC)
(11 KB PDF)
(18 KB PDF)
(696 KB DOC)
(86 KB PDF)
We are grateful to technical staff at the involved institutions.
branched DNA
hepatitis C virus
international units
Los Alamos National Laboratory
limit of detection
nucleic acid testing
noncoding region
reverse transcriptase PCR
standard deviation
X-tail real-time RT-PCR assay