Advertisement
  • Loading metrics

MGA, L3MBTL2 and E2F6 determine genomic binding of the non-canonical Polycomb repressive complex PRC1.6

  • Bastian Stielow,

    Roles Data curation, Formal analysis, Investigation, Validation, Visualization, Writing – review & editing

    Affiliation Institute of Molecular Biology and Tumor Research (IMT), Philipps-University of Marburg, Marburg, Germany

  • Florian Finkernagel,

    Roles Data curation, Formal analysis, Software, Validation, Visualization, Writing – review & editing

    Affiliation Institute of Molecular Biology and Tumor Research (IMT), Philipps-University of Marburg, Marburg, Germany

  • Thorsten Stiewe,

    Roles Resources

    Affiliation Genomics Core Facility, Center for Tumor Biology and Immunology (ZTI), Philipps-University of Marburg, Marburg, Germany

  • Andrea Nist,

    Roles Investigation

    Affiliation Genomics Core Facility, Center for Tumor Biology and Immunology (ZTI), Philipps-University of Marburg, Marburg, Germany

    ORCID http://orcid.org/0000-0002-7524-6801

  • Guntram Suske

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Project administration, Supervision, Visualization, Writing – original draft, Writing – review & editing

    Suske@imt.uni-marburg.de

    Affiliation Institute of Molecular Biology and Tumor Research (IMT), Philipps-University of Marburg, Marburg, Germany

    ORCID http://orcid.org/0000-0002-4807-0513

MGA, L3MBTL2 and E2F6 determine genomic binding of the non-canonical Polycomb repressive complex PRC1.6

  • Bastian Stielow, 
  • Florian Finkernagel, 
  • Thorsten Stiewe, 
  • Andrea Nist, 
  • Guntram Suske
PLOS
x

Abstract

Diverse Polycomb repressive complexes 1 (PRC1) play essential roles in gene regulation, differentiation and development. Six major groups of PRC1 complexes that differ in their subunit composition have been identified in mammals. How the different PRC1 complexes are recruited to specific genomic sites is poorly understood. The Polycomb Ring finger protein PCGF6, the transcription factors MGA and E2F6, and the histone-binding protein L3MBTL2 are specific components of the non-canonical PRC1.6 complex. In this study, we have investigated their role in genomic targeting of PRC1.6. ChIP-seq analysis revealed colocalization of MGA, L3MBTL2, E2F6 and PCGF6 genome-wide. Ablation of MGA in a human cell line by CRISPR/Cas resulted in complete loss of PRC1.6 binding. Rescue experiments revealed that MGA recruits PRC1.6 to specific loci both by DNA binding-dependent and by DNA binding-independent mechanisms. Depletion of L3MBTL2 and E2F6 but not of PCGF6 resulted in differential, locus-specific loss of PRC1.6 binding illustrating that different subunits mediate PRC1.6 loading to distinct sets of promoters. Mga, L3mbtl2 and Pcgf6 colocalize also in mouse embryonic stem cells, where PRC1.6 has been linked to repression of germ cell-related genes. Our findings unveil strikingly different genomic recruitment mechanisms of the non-canonical PRC1.6 complex, which specify its cell type- and context-specific regulatory functions.

Author summary

Polycomb group proteins assemble in two major repressive multi-subunit complexes (PRC1 and PRC2), which play important roles in many physiological processes, including stem cell maintenance, differentiation, cell cycle control and cancer. In mammals, six different groups of PRC1 complexes exist (PRC1.1 to PRC1.6), which differ in their subunit composition. The mechanisms that target the different PRC1 complexes to specific genomic sites appear diverse and are poorly understood. In this study, we have investigated the genomic targeting mechanisms of the non-canonical PRC1.6 complex. In PRC1.6, the defining subunit PCGF6 is specifically associated with several proteins including the transcription factors MGA and E2F6, and the histone-binding protein L3MBTL2. We found that MGA is absolutely essential for targeting PRC1.6. MGA executes recruitment of PRC1.6 to its target sites through two distinct functions. On the one hand it acts as a sequence-specific DNA-binding factor; on the other hand it has a scaffolding function, which is independent of its DNA binding capacity. E2F6 and L3MBTL2 are also important in genomic targeting of PRC1.6 as they promote binding of PRC1.6 to different sets of genes associated with distinct functions. Our finding that different components specify loading of PRC1.6 to distinct sets of genes could establish a paradigm for other chromatin-associated complexes.

Introduction

Polycomb group (PcG) protein complexes play crucial roles in many physiological processes, including stem cell maintenance, differentiation, cell cycle control and cancer [14]. PcG complexes repress transcription through various mechanisms including changes in histone modification, polynucleosome compaction and direct interaction with the transcription machinery [1,5]. Two major complexes exist in mammals, the Polycomb repressive complexes 1 and 2 (PRC1 and PRC2), which differ in their enzymatic activity. PRC1 contains the E3 ligase RING1/2, which catalyzes ubiquitination of histone H2A at lysine 119 (H2AK119ub1), while PRC2 contains the methyltransferase EZH2 (Enhancer of Zeste Homolog 2) that catalyzes tri-methylation of histone H3 (H3K27me3). It has long been considered that H3K27me3 is required for PRC1 binding to chromatin. However, this view was challenged when it was found that a number of PRC1 complexes exist, which lack H3K27me3-binding CBX (Chromo Box) subunits [69].

Six major PRC1 complexes have been described and each contains a defining PCGF (Polycomb Group Ring Finger) subunit (PCGF1-6), the RING1/2 E3 ubiquitin ligase, RYBP/YAF2 (RING1 and YY1 binding protein/YY1 Associated Factor 2) or a CBX protein, and a unique set of associated proteins [7,8]. The canonical PCR1 complexes are PRC1.2, which contains PCGF2 (MEL-18), and PRC1.4, which contains PCGF4 (BMI1). They are recruited to chromatin by the H3K27me3 mark deposited by PRC2. By contrast, the non-canonical (ncPCR1s) PRC1.1, PRC1.3, PRC1.5 and PRC1.6 are targeted to chromatin by H3K27me3-independent mechanisms. Significantly, ncPRC1s are responsible for H2A ubiquitination (H2AK119ub1), which leads to recruitment of PRC2 and downstream H3K27me3 deposition [10].

Our knowledge of the targeting of ncPRC1 complexes to their genomic sites is limited. The PCGF1-containing PRC1.1 variant is recruited to non-methylated CpG islands via the histone methyltransferases Kdm2b (Lysine (K)-specific demethylase 2b), which binds to non-methylated CpG islands [6,9]. Recruitment of the PCGF3/5-containing ncPRC1s to the inactive X-chromosome is mediated by the Xist-RNA [11].

The subunit composition of the different ncPCR1s is specific and potentially revealing. While PRC1.6 (also known as E2F6-PRC1 and PCGF6-PRC1) is similar if not identical to L3MBTL2 (Lethal(3)Malignant Brain Tumor-Like 2)-containing complexes [12,13] and the E2F6 repression complex [14], it is specifically associated with several proteins that are not found in other ncPRC1s (Fig 1A), [7,15]. MGA (MAX Gene-Associated protein, also abbreviated as MGAP by UniProt) contains two DNA-binding domains, a T-box domain and a bHLH (basic helix-loop-helix) domain. MGA interacts with MAX (Myc-associated Factor X), and E2F6 interacts with DP-1 or DP-2 (transcription factor DP-1 or DP-2). Heterodimeric MGA/MAX binds E-boxes, and heterodimeric E2F6/DP-1/2 binds to E2F recognition sequences in vitro [1618]. L3MBTL2 contains four MBT domains that bind to mono- and di-methylated histone H3 and H4 tails in vitro [1921]. Full-length L3MBTL2 can also interact with histones independent of their lysine methylation state [12,20]. The association of PRC1.6 with the sequence-specific DNA binding proteins MGA/MAX and E2F6/DP1, and with the histone-interacting protein L3MBTL2 suggests that these proteins could play a role in locus-specific recruitment of PRC1.6. Crucially, this notion has not been addressed experimentally.

thumbnail
Fig 1. MGA, L3MBTL2, E2F6 and PCGF6 colocalize in 293 cells.

(A) Schematic representation of PRC1.6 core components. (B) Western blot analysis of MGA, L3MBTL2, E2F6 and PCGF6 expression in wild type 293 cells (wt) and in corresponding MGA-, L3MBTL2-, E2F6- and PCGF6-depleted cell clones (MGAko, L3MBTL2ko, E2F6ko and PCGF6ko). Re-probing for tubulin (TUB) controlled loading of extracts. (C) Venn diagrams showing the overlap of MGA, L3MBTL2, E2F6 and PCGF6 binding regions in HEK293 cells. The total number of high-confidence MGA, L3MBTL2, E2F6 and PCGF6 ChIP-seq peaks (≥30 tags, ≥3-fold enrichment over knockout control) and their overlap is shown. (D) A heat map view of the distribution of union MGA, L3MBTL2, E2F6 and PCGF6 peaks in HEK293 cells (n = 8342) at +/- 2 kb regions centred over the MGA peaks. (E) Representative genome browser screenshots of a 0.7 Mb region of chromosome 19 showing co-localization of MGA, L3MBTL2, E2F6 and PCGF6 at the CTC-232P5.1, RFX2, MLLT1 and KHSRP promoters. (F) Distribution of MGA, L3MBTL2, E2F6 and PCGF6 peaks relative to positions -2000 bp upstream to +2000 bp downstream of gene bodies. TSS, transcription start site; TES, transcription end site. (G) ChIP-qPCR analysis of MGA, L3MBTL2, E2F6 and PCGF6 binding to selected promoters. The region -2 kb upstream of the CDC7 promoter served as a negative control. Percent of input values represent the mean of at least three independent experiments +/- SD. (H) Sequence motifs enriched in PRC1.6 binding regions. Logos were obtained by running MEME-ChIP with 300 bp summits of the top 600 union MGA-L3MBTL2-E2F6-PCGF6 ChIP-seq peaks. The numbers next to the logos indicate the occurrence of the motifs, the statistical significance (E-value) and the transcription factors that bind to the motif. Right panel, local motif enrichment analysis (CentriMo) showing central enrichment of the MGA/MAX bHLH and the E2F6/DP1 binding motifs within the 300 bp peak regions. The NRF1 binding motif was not centrally enriched.

https://doi.org/10.1371/journal.pgen.1007193.g001

In mouse embryonic stem cell (ESC) an essential role for the corresponding PRC1.6 subunits in specification and proliferation has been demonstrated. Mga and Pcgf6 were identified as essential self-renewal genes in ESCs by a genome-wide RNAi screen [22]. A more recent knockout study revealed that Mga is essential for survival of mouse pluripotent cells during peri-implantation development and for growth of ESC cultures [23]. L3mbtl2-deficient ESCs retain characteristics of pluripotent cells but are severely impaired in proliferation [13]. Finally, the defining subunit of PRC1.6, Pcgf6, is expressed at high levels in mouse ES cells, where it is required for ESC identity [24,25]. The mechanism by which this occurs remains controversial. Two reports suggested a repressive function of Pcgf6 on mesodermal-specific [24] and on endodermal lineage genes [26], while Yang et al. suggested an PRC1.6-independent direct activator function of Pcgf6 on core ESC regulators such as Oct4, Sox2 and Nanog [25].

Here we describe the targeting mechanism of PRC1.6, an exemplar of the non-canonical PRC1 class, by detailing the role of MGA, L3MBTL2, E2F6 and PCGF6 in genomic binding site selection. We show that MGA, L3MBTL2, E2F6 and PCGF6 colocalize genome-wide in the context of PRC1.6. Taking advantage of CRISPR/Cas-mediated genetic ablation in HEK293 cells, we demonstrate that MGA is absolutely essential for binding of PRC1.6. By expression of MGA mutants in MGAko cells, we found that the bona fide T-box and bHLH DNA-binding domains of MGA mediate binding to a subset of loci but are dispensable for others. We further demonstrate that L2MBTL2 and E2F6 determine differential binding of PRC1.6 to distinct promoters. Finally, we demonstrate that Mga, L3mbtl2 and Pcgf6 colocalize also in mouse ESCs. In particular, we found enrichment at promoters of meiosis-and germ-line-specific genes that were shown to be de-repressed on Max-, L3mbtl2- or Pcgf6-depletion. Together, our findings unveil strikingly different genomic recruitment mechanisms for a non-canonical Polycomb repressive complex, which specify its cell type- and context-specific regulatory functions.

Results

Genomic colocalization of MGA, L3MBTL2, E2F6 and PCGF6 in HEK293 cells

To identify the genomic binding sites of PRC1.6 and to gain mechanistic insights into its targeting, we focused on the roles of MGA, L3MBTL2, E2F6 and PCGF6 as these factors are specific to PRC1.6 (Fig 1A) and were not found in other ncPRC1s. We established HEK293 cell clones in which each of these four proteins was depleted individually using the CRISPR/Cas9-sgRNA system (S1 Fig) as controls at key steps in the analysis. By Western blotting we confirmed successful depletion of MGA, L3MBTL2, E2F6 and PCGF6 in several clones (Fig 1B).

Next, we determined MGA, L3MBTL2, E2F6 and PCGF6 occupancy by ChIP-seq using chromatin of the corresponding knockout cell lines as a reference for peak selection. Thereby, we were able to remove a number of perfectly shaped false positive ChIP-seq signals (S2A Fig) from the classified lists of binding sites. We obtained different peak strengths and different numbers of peaks for the different factors (L3MBTL2 > E2F6 > MGA > PCGF6), possibly due to the different performance of the antibodies resulting in different ChIP efficiencies. Stringent filtering of uniquely mapped reads (≥30 tags and ≥3-fold enrichment over the corresponding knockout control) yielded lists of high-confidence binding sites for each factor.

Comparison of the MGA, L3MBTL2, E2F6 and PCGF6 data sets revealed a very high degree of overlap (Fig 1C and 1D) reflecting colocalization (Fig 1E). Consistent with the role of PRC1 in regulating gene expression, the large majority of these sites were located close to the 5´-end of annotated transcripts (Fig 1F). We also confirmed colocalization of MGA, L3MBTL2, E2F6 and PCGF6 to a set of selected target promoters by conventional ChIP-qPCR analysis (Fig 1G).

The overlap of the MGA, L3MBTL2, E2F6 and PCGF6 ChIP-seq peaks shown in Fig 1C also suggests the existence of some genomic sites bound by only one of the four factors. However, the majority of the potential factor-specific sites was removed when we compared filtered peaks with unfiltered MACS peaks (S2B–S2E Fig). Moreover, visual genome browser inspection of the remaining potential subunit-specific peaks indicated the shared presence of MGA, E2F6, L3MBTL2 and PCGF6 at all examined sites (S2B–S2E Fig). Hence, our ChIP-seq results indicate that all four factors bind to the same genomic loci in vivo. This conclusion is strongly supported by the complete absence of genomic L3MBTL2, E2F6 and PCGF6 binding events in MGA-depleted cells (see below).

A de novo sequence motif analysis of the top 600 ranked MGA, L3MBTL2, E2F6 and PCGF6 binding sites revealed centrally enriched motifs that match in vitro recognition sequences for MGA/MAX (the E-Box, CACGTG) [17] and for E2F6/DP1 (GCGGGAA) [18] (Fig 1H). The abundant occurrence of the E-box and the E2F6 binding motif indicated that both, MGA and E2F6, could be important for recruitment of PRC1.6 to its specific sites in chromatin.

MGA plays a crucial role in genomic targeting of PRC1.6

MGA and E2F6 are sequence-specific DNA binding factors; and L3MBTL2 is a histone-interacting protein. Having found that they colocalize genome-wide, we set out to investigate their interdependence in genomic targeting of PRC1.6. At first we focused on the role of MGA and examined whether binding of other PRC1.6 subunits was affected in MGA-depleted cells. ChIP-seq analysis revealed that MGAko cells lack genome-wide binding of both L3MBTL2 and E2F6 (Fig 2A and 2B) indicating that MGA is crucial for genomic targeting of L3MBTL2 and E2F6 and potentially for the entire PRC1.6 complex. This finding was particularly unexpected since the E2F6/DP2 heterodimer binds E-box motifs readily in vitro [18]. Western blot analysis revealed that MGA-depleted cells contained markedly less E2F6 as well as PCGF6 (Fig 2C). The reduced protein levels of E2F6 and PCGF6 in MGAko cells were likely due to impaired protein stability, as the transcript levels of E2F6 and PCGF6 were not reduced in MGAko cells (Fig 2D). The protein level of L3MBTL2 in MGAko cells was similar as in wild type cells. However, the fraction of SUMO-modified L3MBTL2 [20] was strongly reduced (Fig 2C), which may indicate that SUMOylation of L3MBTL2 in wild type cells takes place at the level of chromatin. Finally, the level of RING2 protein was unchanged in MGA-deficient cells.

thumbnail
Fig 2. MGA is essential for genomic binding of PRC1.6.

(A) Heat map view of the distribution of union MGA, L3MBTL2 and E2F6 peaks in wild type cells (n = 8342) and in MGA-depleted cells at +/- 2 kb regions centred over the MGA peaks. (B) Representative genome browser screenshots showing binding of MGA, L3MBTL2, E2F6 and PCGF6 to the AEBP2, RPA2, RFC1 and SPOP promoters in wild type cells. MGA-depleted cells lack binding of L3MBTL2 and E2F6. (C) Western blot analysis of L3MBTL2, E2F6, PCGF6 and RING2 in wild type HEK293 cells and in two different MGA-depleted clones (cl26 and cl27). The anti-Tubulin blot served as a loading control. (D) L3MBTL2-, E2F6- and PCGF6 transcripts were determined in wild type cells and in MGA-depleted cell clones by RT-qPCR analysis. B2M transcript levels were used to normalize the data across samples, and transcript levels in wild type cells were arbitrarily set to 1. Data represent the average of technical replicates ± SD. (E) ChIP-qPCR data showing lack of L3MBTL2, E2F6, PCGF6, MAX, RING2, RYBP and HP1γ binding to representative PRC1.6 target promoters in MGAko cells, and diminished deposition of H2AK119ub1. The CDC7 -2kb region served as a negative control region. Percent of input values represent the mean of at least three independent experiments +/- SD. (F) PRC1.6 target promoters are not bound by PRC2 and lack H3K27me3. Local levels of EZH2 and H3K27me3 at selected PRC1.6 target promoters in wild type (WT) and in MGAko cells (clones cl26 and cl27) were determined by ChIP-qPCR analysis. Genomic regions known to be bound by canonical PRC1 (FUT9, MYT1 and TSH2B) served as positive control regions. These regions were not bound by MGA (right panel). Percent of input values represent the mean of at least three independent experiments +/- SD.

https://doi.org/10.1371/journal.pgen.1007193.g002

To exclude that the lack of any E2F6 and L3MBTL2 binding in MGAko cells was the result of inefficient ChIPs, we also probed a panel of selected target promoters by ChIP-qPCR. These experiments validated the lack of genomic L3MBTL2 and E2F6 binding in two different MGAko clones (Fig 2E). We also analyzed for the presence of other PRC1.6 components including PCGF6, MAX, RING2, RYBP, HP1γ and the H2AK119ub1 mark. All factors as well as the H2AK119ub1 mark were present at the MGA target sites in wild type cells but were absent or, in the case of the H2AK119ub1 mark, markedly reduced in both MGA-depleted cell clones (Fig 2E). The global H2AK119ub1 levels were similar in wild type, MGAko, L3MBTL2ko, E2F6ko, and PCGF6ko cells (S3 Fig) showing that the observed reduction of the H2AK119ub1 mark at the PRC1.6 target regions is due to changes in local RING2 deposition. Collectively, these results demonstrate that MGA is absolutely crucial for genomic loading of the entire PRC1.6 complex. Importantly, these results also indicate that E2F6, L3MBTL2 and PCGF6 bind to their genomic sites exclusively in the context of the PRC1.6 complex and are not recruited to chromatin independently of PRC1.6.

Since previous studies reported that H2AK119ub1 plays a critical role for recruitment of PRC2 followed by downstream deposition of H3K27me3 [10], we also tested for the presence of the catalytic PRC2 component EZH2 and for H3K27me3 (Fig 2F). Neither EZH2 nor H3K27me3 were enriched at the selected PRC1.6 loci suggesting that PRC1.6 binding is not generally interconnected with PRC2 binding. Importantly, we found considerable enrichment of EZH2 and H3K27me3 at known PRC2-dependent canonical PRC1 target sites. These canonical PRC1 binding sites were not bound by MGA, and the levels of EZH2 and H3K27me3 at these sites remained unchanged in MGAko cells (Fig 2F). The absence of MGA at canonical PRC1 binding regions is consistent with genome-wide data that revealed only a low level of overlap between PCGF6 and other PCGFs in HEK293 cells [7].

MGA promotes the genomic localisation of PRC1.6 through different mechanisms

Given that MGA is essential for targeting of PRC1.6, it would be expected that re-expression of MGA would restore not only genomic binding of MGA but also of the other PRC1.6 components. To test this prediction, we expressed full-length MGA in MGAko cells, and subsequently analyzed a panel of PRC1.6 target promoters for binding of exogenous MGA and of endogenous L3MBTL2, E2F6, PCGF6, MAX and RING2. Indeed, re-expression of MGA in MGAko cells not only restored specific binding of MGA but also of the other PRC1.6 subunits (Fig 3A). We did not observe an increase of H2AK119ub1 levels at these promoters. Potentially, the short time span of transient MGA expression was not sufficient for the H2AK119ub1 mark to be deposited efficiently.

thumbnail
Fig 3. MGA promotes binding of PRC1.6 by DNA-binding-dependent and DNA-binding-independent mechanisms.

(A) Expression of wild type MGA in MGAko cells rescues binding of PRC1.6. ChIP-qPCR data showing binding of transiently expressed MGA and of endogenous L3MBTL2, E2F6, PCGF6, RING2 and MAX to representative PRC1.6 target promoters. The level of the H2AK119ub1 was not affected. Percent of input values represent the mean of at least three independent experiments +/- SD. (B) Schematic representation of the MGA ΔTbox and bHLH mutants. (C) Western blot analysis of wild type MGA and of the DNA-binding-deficient MGA mutants (ΔT-Box, bHLHmut and ΔTbHLHmut) expressed in MGAko cells. The anti-Tubulin blot served as a loading control. (D) ChIP-qPCR analyses of MGA and L3MBTL2 binding to selected PRC1.6 target promoters in MGAko cells and in MGAko cells re-expressing wild type MGA (MGA WT) or DNA-binding-deficient MGA mutants (MGA ΔT-Box, MGA bHLHmut or MGA ΔTbHLHmut). The error bars denote SD; n = 3.

https://doi.org/10.1371/journal.pgen.1007193.g003

MGA contains two different DNA binding domains, a T-box domain close to the N-terminus and a bHLH domain in its C-terminal part (Fig 3B). To test whether these DNA binding domains account for genomic loading of PRC1.6, we generated two different types of DNA binding-deficient MGA mutants by deleting the entire T-box domain (MGA-ΔT, aa 79 –aa 264 deleted), and by replacing several critical amino acids in the bHLH domain [27,28] by alanine residues (MGA-bHLHmut, MGA-H2477A_ER2481/2482AA_R2485A). Compared with wild type MGA, binding of the MGA-bHLH mutant to several target promoters (AEBP2, ZFR, CDIP, CCND2 and TFAP4) was strongly reduced (Fig 3D). We also observed reduced binding of the MGA-T-box deletion mutant to the SPOP promoter. However, both MGA mutants still bound to the RFC1, PHF20, RPA2, RNF130 and CDC7 promoters as efficiently as wild type MGA (Fig 3D). We also tested binding of an MGA double mutant in which both DNA binding domains were mutated simultaneously (MGA-ΔT-bHLHmut). Remarkably, the MGA-ΔT-bHLHmut double mutant still bound to these promoters as efficiently as wild type MGA. Importantly, the DNA binding-deficient MGA mutants also rescued binding of endogenous L3MBTL2 to the RFC1, PHF20, RPA2, RNF130 and CDC7 promoters but not to the MGA-bHLH-dependent AEBP2, ZFR, CDIP, CCND2 and TFAP4 promoters and to the MGA-T-Box-dependent SPOP promoter (Fig 3D, right panel). These results suggest that MGA can recruit PRC1.6 to specific target sites by DNA-binding-dependent and by DNA-binding-independent mechanisms.

L3MBTL2 and E2F6 contribute to genomic binding of PRC1.6

As MGA is able to bind a subset of PRC1.6 loci independent of its DNA-binding activity, we investigated the potential contribution of E2F6, L3MBTL2 or PCGF6 to the recruitment of PRC1.6 to its target sites. To address this issue, we profiled binding of MGA, L3MBTL2 and E2F6 in cells lacking L3MBTL2, E2F6 or PCGF6 (L3MBTL2ko, E2F6ko or PCGF6ko cells). Importantly, the level of MGA and of other PRC1.6 subunits in L3MBTL2ko-, E2F6ko-, and PCGF6ko cells was unaffected (Fig 4A and S4 Fig). Analysis of the ChIP-seq data sets revealed that the overall genomic positions of the PRC1.6 binding sites in E2F6ko-, L3MBTL2ko- and PCGF6ko cells are similar to those in wild type cells (Fig 4B and 4C). However, the signal strengths of the MGA and L3MBTL2 peaks in E2F6ko cells and the signal strength of the MGA and E2F6 peaks in L3MBTL2ko cells were significantly reduced, but only slightly affected in PCGF6ko cells (Fig 4C and 4D). Notably the extent of reduction of MGA binding in E2F6ko cells correlated well with the extent of reduction of L3MBTL2 binding in E2F6ko cells (Fig 4E, left panel). Equally, the extent of reduction of MGA binding in L3MBTL2ko cells correlated well with the extent of reduction of E2F6 binding in L3MBTL2ko cells (Fig 4E, right panel). These results demonstrate that the genomic localization of PCR1.6 requires the simultaneous association of MGA, L3MBTL2, E2F6 and PCGF6 in a single complex.

thumbnail
Fig 4. L3MBTL2 and E2F6 contribute to chromatin binding of PRC1.6.

(A) Western blot analysis of L3MBTL2, MGA, E2F6, PCGF6 and RING2 in L3MBTL2ko, E2F6ko and PCGF6ko cells. Re-probing for Tubulin (TUB) controlled loading of extracts. The Tubulin blots are related to the MGA blots. Uncropped versions of the MGA blots are shown in S4 Fig. (B) Representative genome browser screenshots of a 0.5 Mb region of chromosome 19 showing reduced binding of PRC1.6 components to several promoters in L3MBTL2ko and in E2F6ko cells but not in PCGF6ko cells. (C) Heat map views of the distribution of MGA, L3MBTL2 and E2F6 peaks in wild type cells (n = 8342) and in MGAko, L3MBTL2ko, E2F6ko and PCGF6ko cells at +/- 2 kb regions centred over the MGA peaks. (D) Scatter plots comparing the signal intensity of MGA, L3MBTL2 and E2F6 peaks in wild type cells with the signal intensity of corresponding peaks in L3MBTL2ko (left panels), E2F6ko (middle panels) or PCGF6ko cells (right panels). Normalized ChIP-seq read counts in MGA ChIP-seq peak regions of wild type cells were plotted against the normalized read counts in corresponding peak regions of L3MBTL2ko, E2F6ko or PCGF6ko cells. (E) Left panel, scatter plot showing the correlation between reduced MGA binding and reduced L3MBTL2 binding in E2F6ko cells. Right panel, scatter plot showing the correlation between reduced MGA binding and reduced E2F6 binding in L3MBTLko cells. The top 500 ranked MGA binding sites were used to calculate the fold change of normalized ChIP-seq read counts in L3MBTL2ko and E2F6ko cells relative to wild type cells.

https://doi.org/10.1371/journal.pgen.1007193.g004

L3MBTL2 and E2F6 recruit PRC1.6 differently to distinct sets of genes

Binding of MGA to the majority of its genomic sites was greatly reduced in L3MBTL2ko as well as in E2F6ko cells, indicating that both, L3MBTL2 and E2F6 contributed to genomic binding of PRC1.6. Importantly, however, the extent of reduction of MGA and E2F6 binding in L3MBTL2ko cells, and the extent of reduction of MGA and L3MBTL2 binding in E2F6ko cells did not correlate (Fig 5A). Rather, the shape of these plots revealed three distinct types of PRC1.6 binding site (i) loci where binding of MGA was reduced in both, L3MBTL2ko and E2F6ko cells (ii) loci where binding of MGA was reduced in L3MBTL2ko cells but not in E2F6ko cells; (iii) loci where binding of MGA was reduced in E2F6ko cells but not in L3MBTL2ko cells. Thus, we were able to identify L3MBTL2-dependent and E2F6-dependent PRC1.6 binding sites (Fig 5B and S5A Fig).

thumbnail
Fig 5. L3MBTL2 and E2F6 recruit PRC1.6 differentially in a promoter-specific manner.

(A) Left panel, scatter plot comparing the extent of reduction (fold change of normalized tag counts) of MGA binding in L3MBTL2ko cells with the extent of reduction in E2F6ko cells. Right panel, scatter plot comparing the extent of reduction of E2F6 binding in L3MBTL2ko cells with the extent of reduction of L3MBTL2 in E2F6ko cells. The E2F6-dependent RNF130 and the L3MBTL2-dependent ZFR promoters are indicated for clarity. (B) Genome browser screenshots of ChIP-seq tracks showing binding of MGA, L3MBTL2, E2F6 and PCGF6 to the RNF130 and ZFR promoters in wild type cells (WT), and in MGAko, L3MBTL2ko, E2F6ko and PCGF6ko cells. (C) ChIP-qPCR analysis of MGA binding to selected promoters in two different L3MBTL2ko (L2ko cl10 and L2ko cl14, upper panel) and in two different E2F6ko (E2F6ko cl1 and E2F6ko cl11, lower panel) cell clones. The CDC7 -2kb region served as a negative control region. Percent of input values represent the mean of at least three independent experiments +/- SD. (D) Expression of L3MBTL2 in L3MBTL2ko cells rescues binding of PRC1.6. Left, Western blot for L3MBTL2. Right, ChIP-qPCR data showing binding of exogenous L3MBTL2 and of endogenous MGA, E2F6 and PCGF6 to representative PRC1.6 target promoters. Percent of input values represent the mean of at least three independent experiments +/- SD. (E) Expression of wild type E2F6 but not of a DNA binding-deficient E2F6 mutant (E2F6mut) in E2F6ko cells rescues binding of PRC1.6. Left, Western blot for E2F6. Right, ChIP-qPCR data showing binding of exogenous E2F6 (wild type or DNA-binding deficient mutant) and of endogenous MGA and L3MBTL2 to representative PRC1.6 target promoters. Percent of input values represent the mean of at least three independent experiments +/- SD. (F) Venn diagram showing the overlap of E2F6 peaks in L3MBTL2ko cells and L3MBTL2 peaks in E2F6ko cells. Logos of the enriched sequence motifs were obtained by running MEME-ChIP with 300 bp summits of the ChIP-seq peaks. (G) GO analyses of biological functions of E2F6-dependent and of L3MBTL2-dependent PRC1.6 target genes. Enriched GO terms were retrieved using Enrichr. p values are plotted in -log2 scale.

https://doi.org/10.1371/journal.pgen.1007193.g005

We also probed a panel of PRC1.6 target sites in two different L3MBTL2ko and E2F6ko cell clones by conventional ChIP-qPCR. We tested for the presence of MGA, L3MBTL2, E2F6 and PCGF6, MAX, RING2 and H2AK119ub1 (Fig 5C and S5B Fig). This analysis confirmed L3MBTL2- and E2F6-dependent binding of PRC1.6 to the RFC1, PHF20 and SPOP promoters; L3MBTL2-dependent but E2F6-independent binding to the AEBP2 and ZFR promoters; and E2F6-dependent but L3MBTL2-independent binding to the ALDOA, RNF130 and CDC7 promoters (S5B Fig). In all cases the levels of H2AK119ub1 correlated with PRC1.6 binding. Finally, we performed rescue experiments in which we found that expression of L3MBTL2 in L3MBTL2ko cells not only restored binding of ectopically expressed L3MBTL2 but also of endogenous MGA, E2F6 and PCGF6 to the L3MBTL2-dependent RFC1, PHF20, SPOP, AEBP2 and ZFR promoters (Fig 5D). Of note, the enrichment levels observed in rescued L3MBTL2ko cells were approximately 1.5- to 3-fold lower than in wild type cells (compare Fig 5D with in Fig 1G). This is not surprising given that not all cells in the population express L3MBTL2 after transient transfection. Importantly, L3MBTL2 also re-occupied the E2F6-dependent ALDOA, RNF130 and CDC7 promoters; however, binding of MGA, E2F6 and PCGF6 to these promoters was not enhanced. This result strongly supports our model in which L3MBTL2 is only essential for recruitment of PRC1.6 to a subset of loci despite its presence at all PRC1.6 binding sites.

To gain further insight into the E2F6-dependent recruitment of PRC1.6, we examined whether the DNA-binding activity of E2F6 is necessary for PRC1.6 binding. Wild type E2F6 expressed in E2F6ko cells re-occupied all tested PRC1.6 target loci, and also resulted in slightly increased binding of endogenous MGA and L3MBTL2 to E2F6-dependent promoters but not to the L3MBTL2-dependent promoters (Fig 5E). The DNA binding-deficient E2F6 mutant (E2F6-L68E,V69F) did not bind to the E2F6-dependent promoters, and did not re-occupy the L3MBTL2-dependent promoters. This observation indicates that the DNA binding domain of E2F6 is not only necessary for DNA recognition but also for association with PRC1.6.

By ChIP-qPCR analysis of selected promoters we also validated that PCGF6 has a limited role in the recruitment of MGA, L3MBTL2 and E2F6 (S6 Fig). However, it is important to note that binding of RING2 in PCGF6ko cells was nearly reduced to levels at a negative control region. Consistently, H2AK119ub1 levels were also reduced at these promoters (S6 Fig). Thus, PCGF6, albeit not essential for binding site selection by PRC1.6, it is required to recruit RING2 to these loci. This observation is in line with a recent study that revealed recruitment of RING2 by a PCGF6-TET repressor fusion protein tethered to a Tet operator array in vivo [29].

We surveyed the DNA sequences of L3MBTL2- and the E2F6-dependent PRC1.6 loci and found specific enrichment of the E2F binding motif (GCGGGA) in the E2F6-dependent PRC1.6 binding sites, and specific enrichment of the E-box (CACGTG) and T-box (AGGC/TGC/TGAGG) binding motifs in the L3MBTL2-dependent PRC1.6 binding sites (Fig 5F). The strong association of E-box and T-box motifs with L3MBTL2-dependent PRC1.6 binding sites point to an important role of L3MBTL2 in facilitating or stabilizing an interaction of MGA/MAX with DNA.

Finally, we examined whether there are specific functional features shared amongst E2F6-dependent and L3MBTL2-dependent PRC1.6-bound genes. E2F6-dependent PRC1.6 target genes but not L3MBTL2-dependent PRC1.6 target genes were highly enriched in Gene Ontology (GO) terms related to cell cycle control (Fig 5G). This finding is in line with the role of E2F6 as an RB-independent transcriptional repressor during cell cycle progression [30]. GO terms associated with L3MBTL2-dependent PRC1.6 target genes included quite different biological processes such as “positive regulation of neurotransmitter secretion”, meiotic “synaptonemal complex assembly” and “ribosome assembly”. Altogether these results suggest that E2F6 and L3MBTL2 recruit PRC1.6 to distinct gene sets that regulate different biological processes.

Role of PRC1.6 in HEK293 cell function

We went on to investigate the role of PRC1.6 in cell growth and gene expression in HEK293 cells by comparing the proliferation potential of wild type, MGAko, L3MBTL2ko, E2F6ko and PCGF6ko cells. The growth rates of wild type cells and PCGF6ko cells were similar; however, we observed reduced proliferation of MGAko, L3MBTL2ko and E2F6ko cells. (Fig 6A). Next, we examined the transcriptional impact of PRC1.6. RNA-seq of three independent wild type cell cultures and three independent MGAko clones identified 587 genes with ≥2-fold altered expression levels in MGAko cells. Expression of 485 genes was reduced in the MGAko cells, while expression of 102 genes was increased (Fig 6B). Comparison of the set of de-regulated genes with the gene set bound by MGA revealed that MGA was not bound to the majority of the down-regulated genes (434/485, 89%) suggesting an indirect role of MGA in the regulation of these genes. In contrast, MGA was bound to the majority of the up-regulated genes (71/102, 70%) suggesting that PRC1.6 acts as a direct repressor on these genes. Representative ChIP-seq and RNA-seq genome browser screenshots of de-repressed genes bound by PRC1.6 are shown in Fig 6C. Interestingly, the top up-regulated genes in MGAko cells included several critical regulators and effectors of meiosis such as CNTD1, SMC1B, SYCE2, YBX2, MEIOC (C17orf104), RAD9B, TAF7L, STAG3, CPEB1 and ALDH1A2, as well as several testis-enriched genes such as PRSS50, TRIM71, C19orf57, ZCWPW1, ZNF239, RIBC2, NEUROG2 (http://www.proteinatlas.org/).

thumbnail
Fig 6. The role of PRC1.6 in HEK293 cell function.

(A) Reduced proliferation of MGAko, L3MBTL2ko and E2F6ko cells. Shown are growth curves of wildtype, MGAko, L3MBTL2ko, E2F6ko and PCGF6ko HEK293 cells. Cells were seed at 3x105, and counted and replated at the indicated time points. Cumulative cell numbers were calculated by multiplying the initial cell number with the fold-increase in cell numbers in each interval. (B) Venn diagrams illustrating the overlap of MGA-bound genes and genes down- or up-regulated in MGAko cells. Left circle, genes with ≥2-fold reduced transcript levels in MGAko cells; right circle, genes with ≥2-fold increased transcript levels in MGAko cells. (C) Representative genome browser screenshots of ChIP-seq and RNA-seq tracks illustrating binding of MGA, L3MBTL2, E2F6 and PCGF6 (top tracks) to the CNTD1 and SMC1B promoters, and RNA expression (bottom tracks) of the corresponding genes in three wild type samples (MGA_wt1, MGA_wt2 and MGA_wt3), and in three different MGAko cell clones (MGAko_cl26, MGAko_cl27 and MGAko_cl30). (D) RT-qPCR-based analysis of expression changes of selected genes in MGAko, E2F6ko, L3MBTL2ko and PCGF6ko cells. Transcript levels were normalized to B2M transcript levels, and are depicted relative to transcript levels in wild type cells.

https://doi.org/10.1371/journal.pgen.1007193.g006

To test whether L3MBTL2, E2F6 and PCGF6 contribute to PRC1.6 target gene repression, we examined the expression of a panel of fourteen genes in L3MBTL2ko, E2F6ko and PCGF6ko cells by locus-specific RT-PCR assays. We found increased transcript levels of these genes also in L3MBTL2ko, E2F6ko or PCGF6ko cells, yet to different degrees (Fig 6D). For example, compared with wild type cells, transcript levels of CNTD1 were also increased in L3MBTL2ko and in E2F6ko but not in PCGF6ko cells. Transcript levels of SMC1B, however, were increased in E2F6ko cells but not in L3MBTL2ko and PCGF6ko cells. Conversely, transcript levels of STAG3 were increased in L3MBTL2ko and PCGF6ko cells but not in E2F6ko cells (Fig 6D). Thus, L3MBTL2, E2F6 and PCGF6 contributed to repression of these genes differentially in a gene-specific manner. Interestingly, specific de-repression of these genes in L3MBTL2ko or E2F6ko cells, respectively, correlated well with the contribution of L3MBTL2 and E2F6 to PRC1.6 binding. Binding of PRC1.6 to the CNTD1 promoter was diminished in L3MBTL2ko as well as in E2F6ko cells. Binding of PRC1.6 to the SMC1B promoter was lost in E2F6ko cells but remained in L3MBTL2ko cells, and binding of PRC1.6 to the STAG3 promoter was lost in L3MBTL2ko cells but remained in E2F6ko cells (S7 Fig).

Mga, L3mbtl2 and Pcgf6 colocalize in mouse ESCs and repress genes involved in differentiation

Several recent studies revealed critical roles for Mga, L3mbtl2 and Pcgf6 in the regulation of mouse ES cell pluripotency, proliferation and differentiation [13,23,24,26,29]. Therefore, we investigated the genomic localization of PRC1.6 components also in mouse ES cells. We focused on Mga, L3mbtl2 and Pcgf6 as there is no available antibody, which efficiently recognizes murine E2f6. Also of note is that we failed to generate Mga-deficient ESC clones, which is in line with a previous study suggesting that Mga plays an essential role in ESCs [23]. Therefore, we used an IgG control ChIP-seq dataset as a reference for peak selection. Similar to the ChIP-seq results with chromatin of HEK293 cells, we obtained different numbers of filtered (≥30 tags and ≥3-fold enrichment over IgG) peaks for Mga (14.183), L3mbtl2 (17.007) and Pcgf6 (4817) (Fig 7A). The vast majority of the Pcgf6 peaks (90%) overlapped with Mga and L3mbtl2 peaks; and the majority of the Mga peaks (82%) overlapped with the L3mbtl2 peaks. Genome browser track and heatmap views of binding densities also revealed clear colocalization of Mga, L3mbtl2 and Pcgf6 (Fig 7B and 7C). Moreover, visual inspection of genome browser tracks did not confirm any Mga-, L3mbtl2- or Pcgf6-specific binding site (S8A Fig). Collectively, our ChIP-seq data sets reveal that Mga, L3mbtl2 and Pcgf6 colocalize in mouse ESCs suggesting strongly that the function of PRC1.6 is conserved in murine and human cells. This conclusion was further supported by a de novo sequence motif analysis of the top 600 ranked Mga/L3mbtl2/Pcgf6 peak regions, which revealed the presence of centrally enriched E-box as well as T-box and E2F6/DP1 recognition sequences as prevalent motifs (Fig 7D). Finally, as in HEK293 cells the majority of the Mga/L3mbtl2/Pcgf6 binding sites were located close to transcriptional start sites (Fig 7E). However we observed that the genomic distribution of the Mga/L3mbtl2/Pcgf6 peaks in mouse ESCs differ to some extent from the distribution in HEK293 cells. In many instances, we observed multiple Mga/L3mbtl2/Pcgf6 peaks within a gene locus including the promoter, exons, and the 3´-end (S8B Fig). Potentially, the peaks within gene bodies were not direct PRC1.6 binding sites but reflect local intragenic loops within genes that fold exons close to cognate promoters. The capture of such structural features by ChIP-seq has been reported previously [31]. It is also possible that these intragenic peaks reflect discrete compacted chromatin structures similar to those generated by canonical cPRC1 [32].

thumbnail
Fig 7. Mga, L3mbtl2 and Pcgf6 colocalize in mouse ESCs and repress genes involved in differentiation.

(A) Venn diagrams representing the overlap of Mga, L3mbtl2 and Pcgf6 peaks in mouse ESCs. The total number of filtered (≥30 tags and ≥3-fold enrichment over IgG control) ChIP-seq peaks and their overlap is shown. (B) A heat map view of the distribution of the top 8000 union Mga-L3mbtl2-Pcgf6 peaks in mouse ES cells at +/- 2 kb regions centred over the MGA peaks. (C) Representative genome browser screenshot of a 100 kb region of chromosome 1 showing co-binding of Mga, L3mbtl2 and Pcgf6 to four promoter regions. (D) Sequence motifs enriched in Mga-L3mbtl2-Pcgf6 binding regions in mouse ESCs. Top, logos were obtained by running MEME-ChIP with 300 bp summits of the top 600 union Mga-L3mbtl2-Pcgf6 ChIP-seq peaks. The numbers next to the logos indicate the occurrence of the motifs, the statistical significance (E-value) and the transcription factors that bind to the motif. Bottom, local motif enrichment analysis (CentriMo) showing central enrichment of the Mga/Max bHLH domain E-box binding motif and the motif that identified MEME Tomtom as a T-box as well as a E2f6 recognition sequence. The Nrf1 motif was not centrally enriched within the 300 bp peak regions. (E) Distribution of Mga, L3mbtl2 and Pcgf6 peaks relative to positions -2000 bp upstream to +2000 bp downstream of gene bodies. TSS, transcription start site; TES, transcription end site. (F) Middle panel, Venn diagram illustrating the overlap of PRC1.6-bound genes and genes up-regulated in Pcgf6ko cells [26] and in L3mbtl2ko cells [13]. Left panel, GO analyses of biological functions of PRC1.6-bound genes that were de-repressed ≥2-fold in Pcgf6ko cells. Right panel, GO analyses of biological functions of PRC1.6-bound genes that were de-repressed ≥2-fold in L3mbtl2ko cells. Enriched GO terms were retrieved using DAVID 6.8. (GOTERM_BP_DIRECT, Functional Annotation Chart). Benjamini values are plotted in log10 scale.

https://doi.org/10.1371/journal.pgen.1007193.g007

To examine the impact of the Mga/L3mbtl2/Pcgf6 binding sites on gene expression in mouse ESCs, we compared our ChIP-seq data sets with genes that were deregulated in L3mbtl2-depleted [13] or in Pcgf6-depleted ESCs [26]. We found that two-third of the genes (882 out of 1354) that were up-regulated in Pcgf6-depleted ES cells, and 71% of the genes that were up-regulated in L3mbtl2-depleted cells (421 out of 587) by ≥2-fold were bound by Mga, L3mbtl2 and Pcgf6 (Fig 7F). Interestingly, genes aberrantly expressed in Pcgf6ko and in L3mbtl2ko ESCs largely do not overlap (Fig 7F). Nevertheless, a GO analysis revealed that Pcgf6-dependent, as well as L3mbtl2-dependent repressed PRC1.6 target genes were strongly associated with germ-line development (meiosis and spermatogenesis). Also the small group of 78 direct PRC1.6 target genes that were up-regulated in Pcgf6ko as well as in L3mbtl2ko ES cells (Fig 7F) encode several meiotic genes including Syce3, Stk31, Slc22a, Mei1 and Tdrkh. Remarkably, promoters of the meiotic genes were within the top ranked 200 Mga, L3mbtl2 and Pcgf6 peaks. Genes specifically de-repressed in Pcgf6-depleted ES cells but not in L3mbtl2-depleted ES cells were related to the wnt signaling pathway and to neuron differentiation. Conversely, specific L3mbtl2-repressed genes were associated with angiogenesis and positive regulation of cell migration (Fig 7F). This finding suggests that Pcgf6 and L3mbtl2 repress common as well as different sets of genes despite the presence of both factors at all target genes within the PRC1.6 complex.

PRC1.6 distribution in mESCs partially overlaps with other PRC1 complexes

Mouse ESCs also express other polycomb complexes including canonical cPRC1, the non-canonical PRC1.1 (PRC1-Kdm2b, PRC1-Fbxl10) complex and PRC2. To determine whether these complexes also bind to PRC1.6 target genes we compared our Mga/L3mbtl2/Pcgf6 data sets with published ChIP-seq data sets of Ring1b, Rybp, Cbx6, Pcgf2 (Mel18), Cbx7, Suz12, H3K27me3 and Kdm2b (Fbxl10). Ring1b is a constituent of all PRC1 complexes. Cbx6 is associated with cPRC1 as well as with PRC1.6 [33]. Rybp is found in canonical as well as in non-canonical complexes; however the presence of Rybp or Cbx7 in PRC1 complexes is mutually exclusive [8,34]. Pcgf2 and Cbx7 are subunits of the cPRC1 complex and require the H3K27me3 mark to localize to chromatin [34,35]. Suz12 is a subunit of the PRC2 complex, which deposits the H3K27me3 mark. Kdm2b together with Pcgf1 forms the non-canonical variant PRC1.1 [6,9]. A heatmap view of binding densities shows tight colocalization of Rybp and Mga-L3mbtl2-Pcgf6 (Fig 8A). This is consistent with the presence of Rybp in the PRC1.6 complex [13,26]. Also the Cbx6 ChIP-seq data set displayed colocalization with Mga-L3mbtl2-Pcgf6 binding sites despite its weak density. This finding is consistent with a recent report that revealed an interaction of Cbx6 with Pcgf6 and L3mbtl2 [33]. A considerable number of PRC1.6 target regions was also occupied by canonical PRC1 (Pcgf2 and Cbx7), PRC1.1 (Kdm2b) and PRC2 (Suz12), and was decorated with H3K27me3 (Fig 8A). Unlike Rybp, however, Pcgf2, Cbx7, Kdm2b, Suz12 and H3K27me3 displayed a broader distribution at the Pcgf6 target regions. We assessed that approximately 30%, 50% and 90% of the high confidence Pcgf6 target genes were co-occupied by Cbx7 (cPRC1), Suz12/H3K27me3 (PRC2) and Kdm2b (PRC1.1), respectively (Fig 8B). Interestingly, meiosis-related genes that were de-repressed in Pcgf6- and L3mbtl2-depleted cells were largely bound exclusively by PRC1.6, whereas “typical” cPRC1 target genes such as Nkx-2 or Hoxa7 were decorated with both PRC1.6 and cPRC1 as well as with PRC2 (Fig 8C and 8D). Together, these results suggest that PRC1.6 and cPRC1 have both unique and common target genes in mouse ESCs.

thumbnail
Fig 8. PRC1.6 binding sites partially overlap with cPRC1, PRC2 and ncPRC1.1 binding sites.

(A) ChIP-seq heatmaps of Pcgf6, IgG control, Ring1b (GSM1041372) [34], Rybp (GSM1041375) [34], Cbx6-HA (GSM2610616) [33], Cbx7 (GSM2610619) [33], Pcgf2 (GSM1657387) [56], Suz12 (GSM1041374) [34], Kdm2b (GSM1003594) [6] and H3K27me3 (GSM1341951) [10] peaks in mESCs at +/- 2 kb regions centred over the Mga-L3mbtl2-Pcgf6 peaks. (B) Venn diagrams showing the overlap of high confidence Pcgf6 target genes (location of binding sites between -2.5 kb of TSS and TES) with those of Cbx7 (cPRC1), Suz12 and H3K27me3 (PRC2) and Kdm2b (ncPRC1.1). (C) Genome browser screenshots of ChIP-seq tracks at promoters of representative meiosis-related genes (Dazl, Sycp3, Stk31 and Mei1) (D) Genome browser screenshots of ChIP-seq tracks at cPRC1 target genes (Nkx2-4 and Hoxa7).

https://doi.org/10.1371/journal.pgen.1007193.g008

Discussion

In this study, we provide insights into the genomic targeting mechanism of the non-canonical PRC1 complex PRC1.6. We find that MGA, L3MBTL2, E2F6 and PCGF6 colocalize genome-wide in the context of PRC1.6. MGA is absolutely crucial for binding of the complete PRC1.6 since genome-wide binding of E2F6, L3MBTL2 and PCGF6 is lost in MGA-depleted cells (Fig 2). Mechanistically, we provide strong evidence that MGA executes recruitment of PRC1.6 to its target sites through two distinct functions (Fig 9). On the one hand, MGA acts as a sequence-specific DNA-binding factor mediating recruitment of PRC1.6 to E-box and T-box containing promoters. On the other hand, MGA has a scaffolding function, which is independent of its DNA binding capacity (Fig 3B and 3C). The scaffolding function of MGA may protect E2F6 and PCGF6 against degradation (Fig 2C).

thumbnail
Fig 9. Model summarizing PRC1.6 targeting mechanisms.

(1) PRC1.6 is recruited to a subset of target promoters by direct DNA binding of MGA/MAX to E-boxes (CACGTG) and/or T-boxes (TCACACCT). (2) Interaction of L3MBTL2 and HP1γ with methylated histones may promote binding site selection by facilitating and stabilizing binding of MGA/MAX. (3) MGA also acts as a scaffold tethering E2F6 that in turn mediates PRC1.6 binding to E2F6-recognition sites. (4) PCGF6 recruits RING1/2 that deposits the repressive histone mark H2AK119ub1.

https://doi.org/10.1371/journal.pgen.1007193.g009

The other components of PRC1.6 have distinct functional roles. L3MBTL2 is also involved in genomic targeting of PRC1.6 since in L3MBTL2ko cells, MGA, E2F6 and PCGF6 fail to bind to a large fraction of promoters (Figs 4 and 5). These L3MBTL2-dependent PRC1.6 binding sites are enriched for the bHLH E-box motif but not for the E2F6-binding motif (Fig 5). The MBT domains of L3MBTL2 are known to bind preferentially mono-, and di-methylated histone H3 and H4 marks [1921]; and full-length L3MBTL2 interacts with histone tails independent of their lysine methylation state [12,20]. Thus, we propose that L3MBTL2 promotes binding site selection of PRC1.6 by facilitating and stabilising the interaction of MGA/MAX with E- or T-box-containing promoters.

PCGF6 has a minor role in genomic loading of PRC1.6 (Fig 4), but significantly it interacts with RING1B [36], recruits it to genomic PRC1.6 sites and facilitates downstream H2AK119 ubiquitination and transcriptional repression [29]. Consistently, PRC1.6-bound promoters are enriched of H2AK119ub1 (Fig 2E and S6 Fig). Importantly, these targets are not bound by PRC2 and are not enriched in H3K27me3 (Fig 2F). The absence of PRC2 and H3K27me3 at PRC1.6 target promoters is consistent with a previous report that revealed lack of H3K27me3 at L3MBTL2-E2F6 binding sites in K562 cells [12]. Yet, H3K27me3 enrichment was found at a subgroup of Pcgf6 binding sites in mouse ESCs (Fig 8 and [29]) suggesting a potential cell type-specific role of Pcgf6-dependent recruitment of PRC2 and downstream H3K27me3 deposition.

A large fraction of PRC1.6 binds to promoters that regulate mitotic cell cycle genes. Since binding is largely unaffected in L3MBTL2-depleted cells targeting of PRC1.6 to this class of genes is more likely mediated by E2F6 (Fig 5F and 5G). This finding is consistent with a previous report showing that E2F6 functions as an RB-independent transcriptional repressor by controlling E2F1-3-dependent transcription during cell cycle progression, particularly by counteracting the activating E2Fs during S phase [30]. These cell cycle-regulated genes are not upregulated in MGA-depleted cells. Likely, E2F4, another repressive E2F family member, compensates for the loss of E2F6-mediated PRC1.6 binding. Indeed, it has been shown that only simultaneous inhibition of both, E2F6 and E2F4 activity, results in depression of these PRC1.6 target genes [30].

Mga, L3mbtl2 and Pcgf6 colocalize also in mouse ESCs (Fig 7) strongly suggesting that the core components of PRC1.6 are evolutionarily and functionally conserved. In addition, knockdown of Mga and Max in mouse ESCs leads to the loss of Pcgf6 binding at several promoters of the genes that are up-regulated in Pcgf6ko cells [29] indicating that also the recruitment mechanisms in ESCs are similar to those observed in human cells. Notably, Pcgf6 is the most highly expressed Pcgf paralog in undifferentiated ESCs [24], and Pcgf6 is the predominant Ring1b-interactor in ESCs [37]. These observations indicate that PRC1.6 is a major PRC1 complex in ESCs. PRC1.6 components play essential roles in ESCs including regulation of ESC pluripotency, proliferation and differentiation. Most significantly, Mga depletion leads to the death of proliferating pluripotent ICM cells in vivo and in vitro, and the death of ESCs in vitro [23]. Also Pcgf6ko and L3mbtl2ko as well as Maxko ESCs have defects in proliferation and differentiation [13,26,38] but less severe as Mgako ESCs. The most severe phenotype of Mgako ESCs is in line with the crucial importance of Mga for genomic PRC1.6 binding.

Consistent with published reports, we have found that in ESCs, PRC1.6 is involved in the repression of meiotic genes. Ablation of Max, the dimerization partner of Mga, activates meiotic genes in ESCs and induces cytological changes, which are reminiscent of germ cells at the leptotene and zygotene stages of meiosis [39,40]. Meiotic and germ-line-specific genes are also activated in Pcgf6ko and L3mbtl2ko cells [13,26]. Mga, L3mbtl2 and Pcgf6 bind to the promoters of these meiosis-specific genes (Fig 7) strongly suggesting that PRC1.6 directly represses these genes in ESCs thereby safeguarding/preventing meiosis. Interestingly, several meiotic genes are also de-repressed in MGA-deficient 293 cells (Fig 6). De-repression of a limited number of meiotic and germ cell-specific genes is also observed in E2F6-deficient MEFs indicating that the repressive function operates in somatic cells [4143].

Knockdown of Pcgf6 results also in strongly increased expression levels of several mesodermal genes including T (Brachyury), the Runx transcription factor Mlf1 and the vascular endothelial growth factor receptor 2 (Vegfr-2, Flk) encoded by the Kdr gene [24]. Our ChIP-seq data revealed binding of Mga, L3mbtl2 and Pcgf6 to these genes suggesting that PRC1.6 also directly represses mesodermal lineage genes in mouse ESCs.

Apart from meiosis-specific and germ-line-specific genes, quite different gene sets are de-repressed on Pcgf6- and L3mbtl2-depletion in ESCs. Based on this observation it was suggested that Pcgf6 acts independently of L3mbtl2 [24]. However we provide strong evidence that all Pcgf6 binding sites are also bound by L3mbtl2. We speculate that L3mbtl2 facilitates binding of PRC1.6 to specific loci, while Pcgf6 acts through recruitment of Ring1b and downstream H2AK119ub1 [29]. Since L3mbtl2 associates with the methyltransferases G9A and GLP [13,14] it may also facilitate H3K9 dimethylation. Indeed, G9A and GLP are required for repression of germ cell-specific genes [44]. It is also possible that L3mbtl2, known to compact nucleosomal arrays in vitro [12], represses transcription directly by chromatin compaction making promoters inaccessible for the transcription machinery.

Materials and methods

Antibodies

Rabbit polyclonal antibodies against MGA for use in ChIP experiments and immunoblotting were generated by immunizing with a bacterially expressed GST fusion protein carrying the 300 C-terminal amino acids of human MGA. Immunization was carried out by Eurogentec (Seraing, Belgium) using the 28-day Speedy immunization protocol. Antisera were affinity-purified according to a protocol described in [45] using the matrix-coupled GST-MGA fusion protein. The commercially available antibodies used in this study are shown in Table 1.

Generation of MGA-, E2F6-, L3MBTL2- and PCGF6-depleted cell lines

HEK293 cells were transfected using FugeneHD (Promega, Madison, WI) with plasmids expressing mammalian-codon optimized Cas9 and sgRNAs targeting the coding region of human MGA, E2F6, L3MBTL2 or PCGF6 (S1 Fig). The parental vector pSpCas9-2A-Puro (pX459) was a gift from Feng Zhang (Addgene plasmid # 48139) [46]. The sequences of the oligonucleotides used for targeting MGA, L3MBTL2, E2F6 and PCGF6 were as follows. MGA-gRNA6: CATCTGGAAAGGTACTCCCA, MGA-gRNA7: GTCATACTTGAATTGTATAC; L3MBTL2-gRNA6: GGATGTGATGAAAGGGATGA, L3MBTL2-gRNA7: GCCTCTGTCATCCAGACAGC; E2F6-gRNA1: GGGTATTCTTGACTTAAACA, E2F6-gRNA2: GTTTAAGTCAAGAATACCCC, E2F6-gRNA3: GTCGATTCCATCTAAGACAT; PCGF6-gRNA3: GGTATGAAGACATTCTGTGA, PCGF6-gRNA4: TGTACTACTATATTGCATTT.

The empty pX459 vector was transfected as a negative control. Puromycin selection (3 μg/ml) was carried out 48 hours after transfection for 3 to 6 days. Individual colonies were isolated and the targeted loci were genotyped by PCR (see S1 Fig) and sequenced. Cell clones with indels in the targeted locus were further analyzed by Western blotting.

Construction of expression vectors

The expression vector for 3xFLAG-L3MBTL2 has been described in [20]; and the expression vectors for HA-tagged wild type E2F6 and the DNA-binding-deficient E2F6 mutant in [18]. The HA-tag was removed by BamHI/HindIII digestion and blunt-end re-ligation. For expression of 3xFLAG-tagged MGA under control of the CMV promoter, several MGA cDNA fragments were amplified from poly(A)- and random-primed HEK293 cell cDNA libraries, and placed stepwise into pN3-3xFLAG using conventional restriction cloning procedures. The sequence of the cloned MGA cDNA is identical to the NCBI reference sequence XM_005254246.2 and encodes the 3115 amino acid full-length MGA isoform XP_005254303.1. Mutations of the MGA T-box and bHLH domains were introduced into the wild type MGA construct by replacing appropriate wild type fragments with corresponding mutant gBlock DNA fragments (IDT, Leuven, Belgium) using internal restriction sites of the MGA cDNA.

Expression of MGA, L3MBTL2 and E2F6

For expression of MGA, L3MBTL2 or E2F6, the respective knockout clones were transiently transfected with the corresponding expression plasmid using the FugeneHD transfection reagent (Promega). Five million cells on a 15-cm dish were transfected with 20 μg of plasmid DNA, harvested 48 hours after transfection and cross-linked chromatin was prepared. Expression of the proteins was monitored by Western blotting.

Cell growth conditions and growth curves

HEK293 cells were cultured in DMEM/F-12 + GlutaMax medium (Gibco, Thermo Fisher, Waltham, MA) supplemented with 10% fetal bovine serum (Sigma Aldrich, St. Louis, MO) and 1% Penicillin/Streptomycin (Sigma Aldrich). Mouse J1 ES cells were cultivated feeder-cell free on gelatin-coated plates in DMEM + GlutaMax (Gibco, Thermo Fisher), supplemented with 15% fetal bovine serum (Biochrom, Berlin, Germany), 1% non-essential amino acids (Gibco, Thermo Fisher), 1% Penicillin/Streptomycin (Sigma Aldrich), 50 mM ß-Mercaptoethanol and 1000 U/mL ESGRO leukemia inhibitory factor (Merck Millipore, Billerica, MA). For determination of growth rates of wild type and corresponding knockout HEK293 cell lines, 3x105 cells were plated on a 6-well dish and counted in two or three days intervals as indicated in Fig 6A. Cumulative cell numbers were calculated by multiplying the initial cell number with the fold-increase in cell numbers in each interval.

ChIP-qPCR

ChIP experiments were performed with the One Day ChIP kit (Diagenode, Seraing, Belgium). ChIP-qPCRs with gene-specific primers (Table 2) were performed using the ImmoMix PCR reagent (Bioline, Luckenwalde, Germany) in the presence of 0.1 x SYBRGreen (Molecular Probes, Thermo Fisher, Waltham, MA). Enrichment was calculated relative to input.

ChIP-seq and data analysis

Three to four individual ChIPs were pooled and purified on QIAquick columns (Qiagen, Hilden, Germany). Five nanograms of precipitated DNA were used for indexed sequencing library preparation using the Microplex library preparation kit v2 (Diagenode). Libraries were purified on AMPure magnetic beads (Beckman Coulter, Brea, CA) and quantified on a Bioanalyzer (Agilent Technologies, Santa Clara, CA). Pooled libraries were sequenced on an Illumina HiSeq1500 platform (Illumina Inc., San Diego, CA), rapid-run mode, single-read 50 bp (HiSeq SR Rapid Cluster Kit v2, HiSeq Rapid SBS Kit v2–50 cycles) according to manufacturer´s instructions.

Raw ChIP-seq reads were aligned using Subread [47] version 1.4.3-p1. Reads matching multiple locations were discarded during alignment. Peaks were called with MACS [48] version1.4.0rc2 against the respective knockout control or against IgG for mouse ES cell data. Filtered peaks were required to have at least 30 tags and a sequencing depth-corrected ratio over control of 3x. Published mESC datasets (Fig 8) were retrieved from GEO and processed as above using Subread and MACS, but were not filtered. Unions and overlaps were calculated on an ‘at least 1bp overlap’ basis. For motif search and heatmaps, peaks were centred at their summits and fixed sized regions extracted. Summits were defined as the point of highest read overlap after extending the reads to 200 bp. Heatmaps show number of reads extended to 200 bp, normalized for sequencing depth. The signal distribution was truncated at the 99th percentile in each sample in order to increase contrast. Regions for heatmaps were ordered by the sum of signal in the first sample depicted. ChIP-seq signal plots shown in Figs 1F and 7E are also based on reads extended to 200 bp. Genes were associated with a peak if the peak was located within -2.5 kb of TSS to TES.

Motif analysis

De novo motif search including Tomtom and CentriMo was performed online with MEME-ChIP versions 4.11.3 and 4.11.4 (http://meme-suite.org/meme_4.11.4/tools/meme-chip) [49] within the MEME Suite (http://meme-suite.org) [50] using 300 bp sequences surrounding peak summits (+/- 150 bp).

Gene ontology analysis

Gene Ontology (GO) analyses were performed using Enrichr (http://amp.pharm.mssm.edu/Enrichr/) [51,52] and the DAVID 6.8 web-based tool (https://david.ncifcrf.gov) [53,54].

Expression analysis

For RNA-seq, total RNA was extracted from HEK293 cells stably transfected with the empty pX459 vector and three different MGAko clones by using the RNeasy Mini system (Qiagen) including an on-column DNaseI digestion. RNA integrity was assessed on an Experion (Bio-Rad Laboratories, Hercules, CA). Sequencing libraries were generated using the TruSeq stranded mRNA Library Preparation Kit (Illumina Inc.). Libraries were quantified on a Bioanalyzer (Agilent Technologies) and subsequently sequenced on an Illumina HiSeq1500 platform (Illumina Inc.), rapid-run mode, single-read 50 bp (HiSeq SR Rapid Cluster Kit v2, HiSeq Rapid SBS Kit v2–50 cycles) according to manufacturer´s instructions.

Quantitative RT-qPCR was performed essentially as described in [20]. cDNA was synthesized with the Tetro reverse transcriptase (Bioline) using one to two microgram of total RNA. Quantitative PCR was performed in triplicates by using the ImmoMix PCR reagent (Bioline) with gene-specific primers (Table 3). Values were normalized to GAPDH and/or B2M mRNA content.

Databases and data availability

The source for genome sequences and annotation was Ensembl revision 83 [55]. Our ChIP-seq and RNA-seq were deposited at ArrayExpress under accession numbers E-MTAB-6006 (ChIP-seq, HEK293), E-MTAB-6007 (ChIP-seq, mouse ES) and E-MTAB-6005 (RNA-seq, HEK293). For assessing the overlap of PRC1.6 with other polycomb complexes in mESCs, the following ChIP-seq data sets were used: Ring1b (GSM1041372), Rybp (GSM1041375), Cbx6-HA (GSM2610616), Pcgf2 (GSM1657387); Cbx7 (GSM2610619), Suz12 (GSM1041374), Kdm2b (GSM1003594) and H3K27me3 (GSM1341951).

Supporting information

S1 Fig. Schematic presentation of the CRISPR/Cas-mediated generation of MGAko, L3MBTL2ko, E2F6ko and PCGF6ko HEK293 cells.

Shown are the genomic exon/intron structures of the human MGA, L3MBTL2, E2F6 and PCGF6 genes. PAM sequences are highlighted in red, and sgRNA targeting sequences are highlighted in blue. The location of the PCR primers used for amplification of the targeted loci are indicated by arrowheads. Sequencing of the PCR products identified the indicated deletions, which led to frameshift mutations and/or deletion of exon/intron boundaries.

https://doi.org/10.1371/journal.pgen.1007193.s001

(TIF)

S2 Fig. MGA, L3MBTL2, E2F6 and PCGF6 colocalize in HEK293 cells.

(A) Knockout control cell lines identified false postive peaks. Genome browser screenshots showing false positive PCGF6 and L3MBTL2 peaks at the BMF and PXMP2, and at the SMARCD2 and TJP3 promoters, respectively. (B, C, D, E) Venn diagramms showing the overlap of filtered (F) peaks (≥30 tags and ≥3-fold enrichment over the knockout control) with unfiltered (UF) peaks called by MACS. (B) Filtered MGA peaks were compared with unfiltered L3MBTL2, E2F6 and PCGF6 peaks. (C) Filtered L3MBTL2 peaks were compared with unfiltered MGA, E2F6 and PCGF6 peaks. (D) Filtered E2F6 peaks were compared with unfiltered MGA, L3MBTL2 and PCGF6 peaks. (E) Filtered PCGF6 peaks were compared with unfiltered MGA, L3MBTL2 and E2F6 peaks. Representative genome browser screenshots of potentially MGA-, L3MBTL2-, E2F6 or PCGF6-specific peaks are presented below the Venn diagramms.

https://doi.org/10.1371/journal.pgen.1007193.s002

(TIF)

S3 Fig. Global H2AK119ub1 levels are similar in wild type, MGAko, L3MBTL2ko, E2F6ko and PCGF6ko cells.

(A) Coomassie Blue-stained SDS gel showing acid-extracted histones [57] of wild type (WT), L3MBTL2ko (L2ko), MGAko, E2F6ko and PCGF6ko cells. The locations of the linker histone protein H1 and the core histone proteins H2A, H2B, H3 and H4 are indicated. (B) Western blot analysis of H2AK119ub1 using the acid-extracted histone preparations shown in panel (A). (C) Re-probing for H2B controlled loading of extracts.

https://doi.org/10.1371/journal.pgen.1007193.s003

(TIF)

S4 Fig. Expression of MGA is not affected in L3MBTL2ko-, E2F6ko, and PCGF6ko cells.

Western blot analysis of MGA with whole cell extracts from wild type (WT), MGAko, L3MBTL2ko, E2F6ko and PCGF6ko HEK293 cells. Shown are uncropped Western blots. The blots were stripped and re-probed with anti-Tubulin.

https://doi.org/10.1371/journal.pgen.1007193.s004

(TIF)

S5 Fig. L3MBTL2 and E2F6 promote binding of PRC1.6 differentially in a promoter-specific manner.

(A) Additional genome browser screenshots of ChIP-seq tracks showing differential binding of PRC1.6 components (MGA, L3MBTL2 and E2F6) in L3MBTL2ko and E2F6ko cells. Binding of MGA to the LACTB2 promoter was reduced in L3MBTL2ko and E2F6ko cells. Binding of MGA to the AEBP2 and TSSK2 promoters was lost in L3MBTL2ko cells but remained in E2F6ko cells. Conversely, binding of MGA to the TRA2B and FOXRED2 promoters was lost in E2F6ko cells but remained in L3MBTL2ko cells. (B) Local levels of L3MBTL2, E2F6, PCGF6, MAX, RING2 and H2AK119ub1 at selected PRC1.6 target promoters were determined in two different L3MBTL2ko (L2ko cl10 and L2ko cl14) and in two different E2F6ko (E2F6ko cl1 and E2F6ko cl11) cell clones by ChIP-qPCR. The CDC7 -2kb region served as a negative control region. Percent of input values represent the mean of at least three independent experiments +/- SD.

https://doi.org/10.1371/journal.pgen.1007193.s005

(TIF)

S6 Fig. PCGF6 is essential for RING2 recruitment.

Local levels of PCGF6, MGA, L3MBTL2, E2F6, RING2 and H2AK119ub1 at selected PRC1.6 target promoters were determined in two different PCGF6ko cell clones (PCGF6ko cl2 and PCGF6ko cl9) by ChIP-qPCR. The CDC7 -2kb region served as a negative control region. Percent of input values represent the mean of at least three independent experiments +/- SD.

https://doi.org/10.1371/journal.pgen.1007193.s006

(TIF)

S7 Fig. E2F6- and L3MBTL2-dependent binding of PRC1.6 to the meiotic CNTD1, SMC1B and STAG3 genes.

Genome browser screenshots of ChIP-seq tracks showing binding of MGA, L3MBTL2, E2F6 and PCGF6 to the CNTD1, STAG3 and SMC1B promoters in wild type cells (WT), and in MGAko, L3MBTL2ko, E2F6ko and PCGF6ko cells.

https://doi.org/10.1371/journal.pgen.1007193.s007

(TIF)

S8 Fig. Mga, L3mbtl2 and Pcgf6 colocalize in mouse ESCs.

(A) Top, Venn diagrams showing the overlap of filtered Mga (left), L3mbtl2 (middle) and Pcgf6 (right) MACS peaks (F; ≥30 tags and 3x over IgG) with unfiltered MACS peaks (UF) of the two other PRC1.6 subunits. Bottom, representative genome browser screenshots of ChIP-seq tracks of potential Mga-, L3mbtl2- or E2f6-specific peaks indicate also binding the other PRC1.6 subunits. (B) Genome browser screenshots of ChIP-seq tracks showing multiple Mga, L3mbtl2 and Pcgf6 peaks in promoter regions and in gene bodies. Alternative transcripts according to Ensembl are shown above.

https://doi.org/10.1371/journal.pgen.1007193.s008

(TIF)

Acknowledgments

We thank Dana Berger, Dorit Schneider and Franziska Liss for their contribution to the acquisition and collection of data, and Iris Rohner for excellent technical assistance. We thank Colin Dingwall for discussion and critical reading of the manuscript.

References

  1. 1. Simon JA, Kingston RE (2013) Occupying Chromatin: Polycomb Mechanisms for Getting to Genomic Targets, Stopping Transcriptional Traffic, and Staying Put. Molecular Cell 49: 808–824. pmid:23473600
  2. 2. Pasini D, Di Croce L (2016) Emerging roles for Polycomb proteins in cancer. Curr Opin Genet Dev 36: 50–58. pmid:27151431
  3. 3. Luis NM, Morey L, Di Croce L, Benitah SA (2012) Polycomb in Stem Cells: PRC1 Branches Out. Cell Stem Cell 11: 16–21. pmid:22770239
  4. 4. Di Croce L, Helin K (2013) Transcriptional regulation by Polycomb group proteins. Nature Structural & Molecular Biology 20: 1147–1155.
  5. 5. Aranda S, Mas G, Di Croce L (2015) Regulation of gene transcription by Polycomb proteins. Sci Adv 1: e1500737. pmid:26665172
  6. 6. Farcas AM, Blackledge NP, Sudbery I, Long HK, McGouran JF, et al. (2012) KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands. Elife 1: e00205. pmid:23256043
  7. 7. Gao Z, Zhang J, Bonasio R, Strino F, Sawai A, et al. (2012) PCGF homologs, CBX proteins, and RYBP define functionally distinct PRC1 family complexes. Mol Cell 45: 344–356. pmid:22325352
  8. 8. Tavares L, Dimitrova E, Oxley D, Webster J, Poot R, et al. (2012) RYBP-PRC1 Complexes Mediate H2A Ubiquitylation at Polycomb Target Sites Independently of PRC2 and H3K27me3. Cell 148: 664–678. pmid:22325148
  9. 9. Wu X, Johansen JV, Helin K (2013) Fbxl10/Kdm2b recruits polycomb repressive complex 1 to CpG islands and regulates H2A ubiquitylation. Mol Cell 49: 1134–1146. pmid:23395003
  10. 10. Blackledge NP, Farcas AM, Kondo T, King HW, McGouran JF, et al. (2014) Variant PRC1 Complex-Dependent H2A Ubiquitylation Drives PRC2 Recruitment and Polycomb Domain Formation. Cell 157: 1445–1459. pmid:24856970
  11. 11. Almeida M, Pintacuda G, Masui O, Koseki Y, Gdula M, et al. (2017) PCGF3/5-PRC1 initiates Polycomb recruitment in X chromosome inactivation. Science 356: 1081–1084. pmid:28596365
  12. 12. Trojer P, Cao AR, Gao Z, Li Y, Zhang J, et al. (2011) L3MBTL2 protein acts in concert with PcG protein-mediated monoubiquitination of H2A to establish a repressive chromatin structure. Mol Cell 42: 438–450. pmid:21596310
  13. 13. Qin J, Whyte WA, Anderssen E, Apostolou E, Chen HH, et al. (2012) The polycomb group protein L3mbtl2 assembles an atypical PRC1-family complex that is essential in pluripotent stem cells and early development. Cell Stem Cell 11: 319–332. pmid:22770845
  14. 14. Ogawa H, Ishiguro K, Gaubatz S, Livingston DM, Nakatani Y (2002) A complex with chromatin modifiers that occupies E2F- and Myc-responsive genes in G0 cells. Science 296: 1132–1136. pmid:12004135
  15. 15. Hauri S, Comoglio F, Seimiya M, Gerstung M, Glatter T, et al. (2016) A High-Density Map for Navigating the Human Polycomb Complexome. Cell Reports 17: 583–595. pmid:27705803
  16. 16. Jolma A, Yan J, Whitington T, Toivonen J, Nitta KR, et al. (2013) DNA-Binding Specificities of Human Transcription Factors. Cell 152: 327–339. pmid:23332764
  17. 17. Hurlin PJ, Steingrimsson E, Copeland NG, Jenkins NA, Eisenman RN (1999) Mga, a dual-specificity transcription factor that interacts with Max and contains a T-domain DNA-binding motif. EMBO J 18: 7019–7028. pmid:10601024
  18. 18. Gaubatz S, Wood JG, Livingston DM (1998) Unusual proliferation arrest and transcriptional control properties of a newly discovered E2F family member, E2F-6. Proceedings of the National Academy of Sciences of the United States of America 95: 9190–9195. pmid:9689056
  19. 19. Yoo JY, Choi KC, Kang H, Kim YJ, Lee J, et al. (2010) Histone deacetylase 3 is selectively involved in L3MBTL2-mediated transcriptional repression. FEBS Lett 584: 2225–2230. pmid:20385135
  20. 20. Stielow C, Stielow B, Finkernagel F, Scharfe M, Jarek M, et al. (2014) SUMOylation of the polycomb group protein L3MBTL2 facilitates repression of its target genes. Nucleic Acids Res 42: 3044–3058. pmid:24369422
  21. 21. Guo Y, Nady N, Qi C, Allali-Hassani A, Zhu H, et al. (2009) Methylation-state-specific recognition of histones by the MBT repeat protein L3MBTL2. Nucleic Acids Res 37: 2204–2210. pmid:19233876
  22. 22. Hu G, Kim J, Xu QK, Leng YM, Orkin SH, et al. (2009) A genome-wide RNAi screen identifies a new transcriptional module required for self-renewal. Genes & Development 23: 837–848.
  23. 23. Washkowitz AJ, Schall C, Zhang K, Wurst W, Floss T, et al. (2015) Mga is essential for the survival of pluripotent cells during peri-implantation development. Development 142: 31–40. pmid:25516968
  24. 24. Zdzieblo D, Li X, Lin Q, Zenke M, Illich DJ, et al. (2014) Pcgf6, a polycomb group protein, regulates mesodermal lineage differentiation in murine ESCs and functions in iPS reprogramming. Stem Cells 32: 3112–3125. pmid:25187489
  25. 25. Yang CS, Chang KY, Dang J, Rana TM (2016) Polycomb Group Protein Pcgf6 Acts as a Master Regulator to Maintain Embryonic Stem Cell Identity. Sci Rep 6: 26899. pmid:27247273
  26. 26. Zhao WK, Tong H, Huang YK, Yan Y, Teng HJ, et al. (2017) Essential Role for Polycomb Group Protein Pcgf6 in Embryonic Stem Cell Maintenance and a Noncanonical Polycomb Repressive Complex 1 (PRC1) Integrity. Journal of Biological Chemistry 292: 2773–2784. pmid:28049731
  27. 27. Ferredamare AR, Prendergast GC, Ziff EB, Burley SK (1993) Recognition by Max of Its Cognate DNA through a Dimeric B/Hlh/Z Domain. Nature 363: 38–45. pmid:8479534
  28. 28. Brownlie P, Ceska TA, Lamers M, Romier C, Stier G, et al. (1997) The crystal structure of an intact human Max-DNA complex: New insights into mechanisms of transcriptional control. Structure 5: 509–520. pmid:9115440
  29. 29. Endoh M, Endo TA, Shinga J, Hayashi K, Farcas A, et al. (2017) PCGF6-PRC1 suppresses premature differentiation of mouse embryonic stem cells by regulating germ cell-related genes. Elife 6: e21064. pmid:28304275
  30. 30. Giangrande PH, Zhu WC, Schlisio S, Sun X, Mori S, et al. (2004) A role for E2F6 in distinguishing G1/S- and G2/M-specific transcription. Genes & Development 18: 2941–2951.
  31. 31. Mercer TR, Edwards SL, Clark MB, Neph SJ, Wang H, et al. (2013) DNase I-hypersensitive exons colocalize with promoters and distal regulatory elements. Nature Genetics 45: 852–U181. pmid:23793028
  32. 32. Kundu S, Ji F, Sunwoo H, Jain G, Lee JT, et al. (2017) Polycomb Repressive Complex 1 Generates Discrete Compacted Domains that Change during Differentiation. Molecular Cell 65: 432–446. pmid:28157505
  33. 33. Santanach A, Blanco E, Jiang H, Molloy KR, Sanso M, et al. (2017) The Polycomb group protein CBX6 is an essential regulator of embryonic stem cell identity. Nature Communications 8: 1235. pmid:29089522
  34. 34. Morey L, Aloia L, Cozzuto L, Benitah SA, Di Croce L (2013) RYBP and Cbx7 Define Specific Biological Functions of Polycomb Complexes in Mouse Embryonic Stem Cells. Cell Reports 3: 60–69. pmid:23273917
  35. 35. Morey L, Pascual G, Cozzuto L, Roma G, Wutz A, et al. (2012) Nonoverlapping Functions of the Polycomb Group Cbx Family of Proteins in Embryonic Stem Cells. Cell Stem Cell 10: 47–62. pmid:22226355
  36. 36. Akasaka T, Takahashi N, Suzuki M, Koseki H, Bodmer R, et al. (2002) MBLR, a new RING finger protein resembling mammalian Polycomb gene products, is regulated by cell cycle-dependent phosphorylation. Genes to Cells 7: 835–850. pmid:12167161
  37. 37. Kloet SL, Makowski MM, Baymaz HI, van Voorthuijsen L, Karemaker ID, et al. (2016) The dynamic interactome and genomic targets of Polycomb complexes during stem-cell differentiation. Nat Struct Mol Biol 23: 682–690. pmid:27294783
  38. 38. Hishida T, Nozaki Y, Nakachi Y, Mizuno Y, Okazaki Y, et al. (2011) Indefinite Self-Renewal of ESCs through Myc/Max Transcriptional Complex-Independent Mechanisms. Cell Stem Cell 9: 37–49. pmid:21726832
  39. 39. Suzuki A, Hirasaki M, Hishida T, Wu J, Okamura D, et al. (2016) Loss of MAX results in meiotic entry in mouse embryonic and germline stem cells. Nat Commun 7: 11056. pmid:27025988
  40. 40. Okuda A, Suzuki A (2016) Unexpected link between MAX and meiotic onset. Cell Cycle 15: 2235–2236. pmid:27267300
  41. 41. Kehoe SM, Oka M, Hankowski KE, Reichert N, Garcia S, et al. (2008) A conserved E2F6-binding element in murine meiosis-specific gene promoters. Biol Reprod 79: 921–930. pmid:18667754
  42. 42. Pohlers M, Truss M, Frede U, Scholz A, Strehle M, et al. (2005) A role for E2F6 in the restriction of male-germ-cell-specific gene expression. Curr Biol 15: 1051–1057. pmid:15936277
  43. 43. Storre J, Schafer A, Reichert N, Barbero JL, Hauser S, et al. (2005) Silencing of the meiotic genes SMC1beta and STAG3 in somatic cells by E2F6. J Biol Chem 280: 41380–41386. pmid:16236716
  44. 44. Maeda I, Okamura D, Tokitake Y, Ikeda M, Kawaguchi H, et al. (2013) Max is a repressor of germ cell-related gene expression in mouse embryonic stem cells. Nat Commun 4: 1754. pmid:23612295
  45. 45. Chalkley GE, Verrijzer CP (2004) Immuno-depletion and purification strategies to study chromatin-remodeling factors in vitro. Chromatin and Chromatin Remodeling Enzymes, Pt C 377: 421–442.
  46. 46. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, et al. (2013) Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8: 2281–2308. pmid:24157548
  47. 47. Liao Y, Smyth GK, Shi W (2013) The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res 41: e108. pmid:23558742
  48. 48. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, et al. (2008) Model-based analysis of ChIP-Seq (MACS). Genome Biol 9: R137. pmid:18798982
  49. 49. Machanick P, Bailey TL (2011) MEME-ChIP: motif analysis of large DNA datasets. Bioinformatics 27: 1696–1697. pmid:21486936
  50. 50. Bailey TL, Boden M, Buske FA, Frith M, Grant CE, et al. (2009) MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res 37: W202–208. pmid:19458158
  51. 51. Chen EY, Tan CM, Kou Y, Duan QN, Wang ZC, et al. (2013) Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. Bmc Bioinformatics 14.
  52. 52. Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan QN, et al. (2016) Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Research 44: W90–W97. pmid:27141961
  53. 53. Huang DW, Sherman BT, Lempicki RA (2009) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols 4: 44–57. pmid:19131956
  54. 54. Huang DW, Sherman BT, Lempicki RA (2009) Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research 37: 1–13. pmid:19033363
  55. 55. Cunningham F, Amode MR, Barrell D, Beal K, Billis K, et al. (2015) Ensembl 2015. Nucleic Acids Research 43: D662–D669. pmid:25352552
  56. 56. Morey L, Santanach A, Blanco E, Aloia L, Nora EP, et al. (2015) Polycomb Regulates Mesoderm Cell Fate-Specification in Embryonic Stem Cells through Activation and Repression Mechanisms. Cell Stem Cell 17: 300–315. pmid:26340528
  57. 57. Shechter D, Dormann HL, Allis CD, Hake SB (2007) Extraction, purification and analysis of histones. Nature Protocols 2: 1445–1457. pmid:17545981