The Rheumatoid Arthritis Risk Variant CCR6DNP Regulates CCR6 via PARP-1

Gang Li; Pierre Cunin; Di Wu; Dorothée Diogo; Yu Yang; Yukinori Okada; Robert M. Plenge; Peter A. Nigrovic

doi:10.1371/journal.pgen.1006292

Abstract

Understanding the implications of genome-wide association studies (GWAS) for disease biology requires both identification of causal variants and definition of how these variants alter gene function. The non-coding triallelic dinucleotide polymorphism CCR6DNP is associated with risk for rheumatoid arthritis, and is considered likely causal because allelic variation correlates with expression of the chemokine receptor CCR6. Using transcription activator-like effector nuclease (TALEN) gene editing, we confirmed that CCR6DNP regulates CCR6. To identify the associated transcription factor, we applied a novel assay, Flanking Restriction Enhanced Pulldown (FREP), to identify specific association of poly (ADP-ribose) polymerase 1 (PARP-1) with CCR6DNP consistent with the established allelic risk hierarchy. Correspondingly, manipulation of PARP-1 expression or activity impaired CCR6 expression in several lineages. These findings show that CCR6DNP is a causal variant through which PARP-1 regulates CCR6, and introduce a highly efficient approach to interrogate non-coding genetic polymorphisms associated with human disease.

Author Summary

Genome-wide association studies (GWAS) identify loci associated with human disease risk, but bridging the gap between locus and mechanism has proven particularly difficult in cases where associated variants do not alter coding. We aimed to develop a generalizable approach to this problem. Previously, a dual nucleotide polymorphism within the first intron of CCR6 (termed the CCR6DNP) had been associated with risk for rheumatoid arthritis, but the pathway by which this variant altered gene expression could not be determined. Here, we employed sequence perturbation to confirm a regulatory role for the CCR6DNP. Next, using a new technique termed Flanking Restriction Enhanced Pulldown (FREP), we identified PARP-1 as the protein that regulates CCR6 expression through allelic association with the CCR6DNP, a finding confirmed by chromatin immunoprecipitation and functional assays. These findings reveal an unexpected regulatory pathway for CCR6 implicated in rheumatoid arthritis and other disease by human genetics, and more generally introduce a novel approach to identifying regulatory protein-DNA interactions.

Citation: Li G, Cunin P, Wu D, Diogo D, Yang Y, Okada Y, et al. (2016) The Rheumatoid Arthritis Risk Variant CCR6DNP Regulates CCR6 via PARP-1. PLoS Genet 12(9): e1006292. https://doi.org/10.1371/journal.pgen.1006292

Editor: Barbara E. Stranger, University of Chicago Department of Medicine, UNITED STATES

Received: March 1, 2016; Accepted: August 10, 2016; Published: September 14, 2016

Copyright: © 2016 Li et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All data are contained within the paper and/or Supporting Information files.

Funding: This work was supported by the Arthritis National Research Foundation (GL, http://www.curearthritis.org/), R01 AR063722 (RMP), and by the Rheumatology Research Foundation (https://www.rheumresearch.org/), Cogan Family Foundation (PAN, no URL), and Fundación Bechara (PAN, http://www.fundacionbechara.org/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Rheumatoid arthritis (RA) is an autoimmune disease that affects 0.5–1% of the population, resulting in destructive inflammation of the joints and other tissues. The pathogenesis of RA remains incompletely understood [1]. GWAS have identified over 100 associated loci, confirming remarkable genetic complexity [2]. For many of these loci, the responsible genetic polymorphism remains ambiguous, in particular for loci that are not in linkage dysequlibrium (LD) with any variant that affects protein sequence. This ambiguity complicates the optimal utilization of human genetics to understand disease pathogenesis and to identify new therapeutic targets [3].

For some loci, however, specific non-coding variants have been implicated in disease risk. One example is the RA risk locus at 6q37. While several genes reside in this locus, integrative bioinformatics approaches implicate CCR6 as the likely risk gene [2],[4]. This suggestion is supported by biological plausibility. CCR6 is expressed by T cells, including Th17 and Treg subtypes, dendritic cells, and B cells, and plays a role in cell recruitment during inflammation [5]. CCL20, the only known ligand for CCR6, is produced within the inflamed joint by cells including fibroblast-like synoviocytes, neutrophils, and Th17 cells [5]. Murine studies confirm that CCR6 antagonism can attenuate experimental arthritis [6]. Thus, understanding how genetic variants around CCR6 influence RA risk could shed new light on disease pathogenesis.

In 2010, Kochi, Okada et al. identified a novel triallelic dinucleotide polymorphism, CCR6DNP, as the likely non-coding variant regulating CCR6 expression [4]. CCR6DNP alleles enhanced CCR6 expression in a luciferase reporter assay and correlated with greater expression of CCR6 in Epstein-Barr virus-transformed lymphoblastoid cell lines, in parallel with the order of RA risk (TG>CG>CA). RA patients carrying higher risk alleles were more likely to have detectable circulating levels of IL-17. Finally, binding of nuclear protein(s) in an allele-specific manner was observed using an electrophoretic mobility shift assay (EMSA). However, bioinformatic and candidate approaches were unsuccessful in defining a specific transcriptional regulator. These data provide strong, but still correlative, support for the hypothesis that CCR6DNP regulates CCR6.

Identification of the specific protein or protein complex that regulates CCR6 through CCR6DNP would be important. First, it would confirm that CCR6DNP is indeed the direct regulatory variant. Second, it would define the cellular pathway that regulates CCR6 expression and thereby open up the potential for therapeutic targeting, not only for RA but also for other inflammatory diseases associated with the CCR6DNP, including Crohn’s disease, Graves’ disease, and systemic sclerosis [4,7].

However, identification of specific regulatory proteins is difficult. Traditional DNA pulldown assays are complicated by extensive binding of non-specific DNA binding proteins. This technical limitation represents an important roadblock in the effort to “bridge the gap” from GWAS to mechanism for polymorphisms that do not alter protein coding.

Here, we sought to identify the mechanism by which the CCR6DNP regulates CCR6. We first confirmed its regulatory function through TALEN gene editing at the CCR6DNP locus. We then applied a novel DNA pulldown method, termed Flanking Restriction Enhanced Pulldown (FREP), that reduces non-specific binding to the DNA probe through sequential enzymatic restriction and that can further be employed in an allelic competition assay to test sequence-specific binding. Using FREP, we identified a specific allelic association between the CCR6DNP and PARP-1, a protein previously implicated in murine arthritis [8]. This result was confirmed by chromatin immunoprecipitation (ChIP) and genetic targeting as well as enzymatic inhibition of PARP-1. These findings begin to define the mechanism through which CCR6DNP regulates CCR6 and more generally model an efficient approach to proceed from regulatory polymorphism to molecular mechanism.

Results

Mutations at the CCR6DNP locus alter CCR6 expression

The CCR6DNP resides in intron 1 of CCR6 (Fig 1a). To confirm the role of the CCR6DNP in gene expression we employed TALEN gene editing [9]. For these experiments we employed HCT116 cells, a human colon cancer line that expresses CCR6 at a high level and is easily transfectable. Cells were co-transfected with both left and right TALEN constructs together with a puromycin selection marker. After selection, we screened more than 100 puromycin-resistant clones by Sanger sequencing of a 122bp PCR fragment flanking the CCR6DNP. Clones positive for mutations at the CCR6DNP locus were sub-cloned. Identical 122bp PCR fragments from these sub-clones were cloned into TA vectors for sequencing to define the mutations on each allele. In total, we obtained 17 mutated clones, including 18 deletions and 4 mutated alleles (Fig 1b and S1 Fig). We then measured CCR6 expression by both qPCR and Western blot, confirming that in most clones sequence perturbation at CCR6DNP modulated gene expression (Fig 1c and 1d; S2a Fig). By contrast, expression of the control gene CD40 was unchanged (S2b Fig). This result confirms that CCR6DNP participates directly in the regulation of CCR6 and is thus a plausible causal variant at the RA-associated 6q27 locus.

Download:

Fig 1. Characterization of mutated HCT116 clones generated by TALENs targeting the CCR6DNP.

(a) Partial genomic arrangement of CCR6 showing alternative transcripts CCR6-a and CCR6-b and the location of CCR6DNP. Only CCR-b could be detected in HCT116 and Jurkat T cells by real time PCR (see S3 Fig). (b) Sequence of the three alleles of CCR6DNP in 7 representative targeted HCT116 clones. The CCR6DNP is underlined. (c) and (d) Expression of CCR6 in the 7 targeted clones by qPCR and Western blot. For qPCR, data are shown as mean±s.d. (n = 3). Sequence, sequence trace and expression data for all 17 mutated HCT116 clones are in S1 and S2 Figs. Statistical significance in 1c reflects comparison to WT.

https://doi.org/10.1371/journal.pgen.1006292.g001

Flanking Restriction Enhanced Pulldown (FREP) identifies the association of PARP-1 with the CCR6DNP

We assumed that CCR6DNP, as a causal allele located in an intron, required a transcription factor or enhancer to carry out its regulatory function. To identify such a protein, we developed a novel DNA pulldown assay termed FREP (Fig 2). An 82bp biotinylated DNA fragment was conjugated to streptavidin-coated magnetic Dynabeads (Invitrogen). This fragment was engineered to include a 31bp sequence containing the CCD6DNP (TG allele, termed CCR6DNP/TG), flanked by restriction enzyme cleavage sites for BamH I proximally and EcoR I distally, as well as 20bp sequences to allow PCR amplification of the whole unit. This configuration allows pulldown of DNA-binding proteins specific to the sequence of interest and also elimination of proteins that bind non-specifically to DNA. CCR6DNP/TG beads were incubated with nuclear extract from THP-1 cells, a human monocyte leukemia line expressing of CCR6. Following magnetic separation and wash, the CCR6DNP/TG beads were cut with EcoR I and the supernatant was collected as the EcoR I fraction. After a second round of magnetic separation and wash, the DNA beads were cut with BamH I to release the CCR6DNP/TG fragment together with any binding proteins. In parallel, we performed a control FREP in the presence of a 40-fold excess of free CCR6DNP/TG as a binding competitor. BamH I fractions from these experiments were resolved by SDS-PAGE and silver stained to identify potential CCR6DNP/TG binding proteins (Fig 3). A dominant band emerged at approximately 120kD (lane 1, indicated by an arrow) but was much lower in intensity in the presence of competitor (lane 2). This band was cut and analyzed by mass spectrometry, revealing 27 peptide fragments from a single protein, PARP-1 (Table 1).

Download:

Fig 2. Flanking Restriction Enhanced Pulldown (FREP).

(a) An 82 bp biotinylated DNA fragment is conjugated to streptavidin-coated magnetic Dynabeads (Invitrogen). This fragment is engineered to include a 31bp gene specific (“bait”) sequence (black box), flanked by restriction enzyme cleavage sites for BamH I proximally (blue box) and EcoR I distally (red box), as well as 20bp DNA fragments to allow PCR amplification of the whole unit. (b) DNA-beads are mixed with nuclear extract. A free 82 bp non-biotinylated DNA fragment can be included in the control reaction at this stage as a specific competitor. (c) Magnetic separation and wash to remove non-DNA binding proteins. (d) EcoR I digestion to release 3’ DNA end-binding proteins, yielding the EcoR I fraction. (e) BamH I digestion to separate the sequence specific DNA binding proteins, BamH I fraction, from proteins that bind 5’ DNA and Dynabeads. (f) Mass spectrometry (MS) to identify proteins remaining within the BamH I fraction.

https://doi.org/10.1371/journal.pgen.1006292.g002

Download:

Fig 3. FREP to identify the binding of PARP-1 with CCR6DNP.

(a) Silver stain and (b) densitometry to show proteins pulled down from CCR6DNP/TG-beads mixed with nuclear extract from THP-1 cells. Lane 1, BamH I fraction; Lane 2, BamH I fraction where pulldown was performed in the presence of a 40x excess of competitor (free CCR6DNP/TG). Arrow indicates the specific band sent for mass spectrometry analysis.

https://doi.org/10.1371/journal.pgen.1006292.g003

Download:

Table 1. Mass spectrometry analysis identifies PARP-1 as the CCR6DNP binding protein.

https://doi.org/10.1371/journal.pgen.1006292.t001

The PARP-1 association with CCR6DNP exhibits sequence and allele specificity

PARP-1 is a well-known DNA repair protein [10]. It is a DNA end-binding protein and can also bind single-stranded DNA without sequence specificity [11]. However, FREP minimizes detection of such non-specific binding through restriction enzyme digestion, because the 3’ free end is cleaved off by EcoR I, while single-stranded DNA is not cleaved by BamH I and is therefore discarded along with the bead. To confirm sequence-specific association of PARP-1 with CCR6DNP/TG, we combined FREP with Western blot, adapting a method developed by Wu [12]. We compared FREP using CCR6DNP/TG with FREP using a non-specific 31bp DNA sequence, and probed the Western blot of BamH I fractions with an anti-PARP-1 antibody (Fig 4a). Our results showed that PARP-1 associated much more strongly with CCR6DNP/TG (lane 2) than with the non-specific DNA sequence (lane 4). This association could be specifically competed away by the free CCR6DNP/TG (lane 3). In this assay, some PARP-1 was also observed with the non-specific DNA sequence, likely reflecting end binding to DNA uncut by EcoR I. Together, these results demonstrate that PARP-1 binds CCR6DNP/TG with sequence specificity.

Download:

Fig 4. The association of PARP-1 with CCR6DNP is sequence dependent and allele specific.

(a) FREP+Western blot for PARP-1 with BamH I fractions. Lane 1: nuclear extract (NE) input, lane 2: NE with CCR6DNP/TG-beads, lane 3: NE with CCR6DNP/TG-beads with cold competitor (Free TG), and lane 4: NE with a non-specific DNA sequence (NS-beads). (b) To detect allele specificity, FREP was modified to cut directly with BamH I only, yielding a combined BamH I+EcoR I fraction, and SDS-PAGE was probed with anti-PARP-1. Anti-Ku86 antibody was used as the internal loading control to ensure comparable amounts of competitor DNA. CCR6DNP/TG-beads were incubated with NE and competed with equal amount of free competitors. Lane 1: no competitor; lane 2: free CCR6DNP/TG; lane 3: CCR6DNP/CG; lane 4: free CCR6DNP/CA; and lane 5: free non-specific DNA. Upper: Western blot; Lower: relative density from the Western blot. (c) ChIP assay with an anti-PARP-1 antibody on WT HCT116 cells and 5 mutants as indicated in Fig 1 showing impaired binding of PARP-1 to the CCR6DNP. (d) ChIP assay with an anti-PARP-1 antibody on WT Jurkat T cells showing significant enrichment of the CCR6DNP fragments comparing to anti-IgG antibody. (e) Sequencing of the CCR6DNP fragments from the ChIP with WT HCT116 cells showing the significant enrichment of the T allele over the C allele by an anti-PARP-1 antibody. Results from (a), (b), (c), and (d) representative of 3 experiments. Data are shown as mean±s.d. (n = 3).

https://doi.org/10.1371/journal.pgen.1006292.g004

We then investigated whether PARP-1 exhibited allele-specific association with CCR6DNP in accordance with the order of RA risk TG>CG>CA [4]. For this purpose, we repeated FREP using CCR6DNP/TG beads in the presence of excess free competitors CCR6DNP/TG, CCR6DNP/CG, CCR6DNP/CA, or a non-specific DNA sequence (Fig 4b; lane 2, 3, 4 and 5, respectively). In these experiments, CCR6DNP/TG-beads were mixed with nuclear extract and different competitors, after which the beads were washed and separated. The bead-bound CCR6DNP/TG was cut directly with BamH I and the supernatant was resolved on SDS-PAGE. Western blots were probed with an anti-PARP-1 antibody. In triplicate experiments, the association of PARP-1 with CCR6DNP/TG was competed away by free CCR6DNP/TG more efficiently than by non-specific DNA (p<0.05, n = 3), with a trend toward TG>GC>CA in line with the established CCR6DNP risk hierarchy (Fig 4b; lane 2, 3, and 4, respectively). Non-specific DNA also competed for PARP-1 binding, but less efficiently, consistent with the known end-binding activity of PARP-1 (Fig 4b; lane 5) [11,13]. To ensure equivalent concentrations of competitors, we probed simultaneously against Ku86, a double-stranded DNA end-binding protein without known sequence specificity. All four competitors inhibited Ku86 binding equally. Together, these data show that PARP-1 associates with the CCR6DNP in an allelic manner consistent with the RA risk hierarchy TG>CG>CA.

To further confirm the association of PARP-1 with CCR6DNP, we performed ChIP assays using an anti-PARP-1 antibody (Genetex GTX100573). First, we performed ChIP using wild type HCT116 cells and the mutated HCT116 clones #1, 3, 4, 7 and 10 as shown in Fig 1. In brief, cells from different clones were cross-linked using 1% formaldehyde, fragmented with sonication, and followed by immunoprecipitation. After the cross-linked DNAs were reversed and purified, the endogenous association of PARP-1 with CCR6DNP was detected by qPCR using primers recognizing a shared sequence 5’ of the CCR6DNP and outside of the mutated regions. Our data showed that the binding of PARP-1 to CCR6DNP corresponds with the levels of CCR6 expression in these mutants in Fig 1 (Fig 4c). Second, we performed ChIP with human Jurkat T cells, confirming that the association of PARP-1 with CCR6DNP is evident not only in HCT116 but also in T cells (Fig 4d). Further, we sequenced the CCR6DNP fragments from the ChIP with WT HCT116 cells in Fig 4c, which as shown in Fig 1b are heterozygous TG/CG at the CCR6DNP. CCR6DNP fragments were cloned by PCR into TA vector. Random sequencing of both alleles revealed significant enrichment of the risk allele T, consistent with preferential binding of PARP-1 to the TG allele (Fig 4e). Together, these results support the conclusion that PARP-1 associates with the CCR6DNP in an allele-specific manner.

PARP-1 regulates CCR6 expression in human HCT116 cells and Jurkat T cells

The association of PARP-1 with CCR6DNP suggests that PARP-1 is a regulatory protein that regulates CCR6. To test this hypothesis, we generated PARP-1-deficient HCT116 cells by shRNA knockdown. PARP-1-specific shRNA, but not scrambled shRNA, induced a striking reduction of CCR6 expression by both Western blot (Fig 5a, left) and qPCR analysis (Fig 5a, middle and right). To ensure that this mechanism is not restricted to HCT116 cells, we performed siRNA knockdown of PARP-1 in human Jurkat T cells and confirmed a similar result (Fig 5b). These results demonstrate that PARP-1 is a novel regulator of CCR6 expression across human cell types.

Download:

Fig 5. CCR6 expression in PARP-1 knockdown human cells.

HCT116 cells (a) and Jurkat T cells (b) by Western blot (left), and qPCR analysis on PARP-1 (middle) and on CCR6 (right). For Western blot, whole cell extract was isolated and separated on SDS-PAGE gel. Western blot was detected with mouse anti-human PARP-1, CCR6 and α-tubulin antibodies simultaneously. Lane 1: negative control for shRNA. Lane 2: shRNA treatment for HCT116 cells or siRNA treatment for Jurkat T cells. For qPCR, data are shown as mean±s.d. (n = 3).

https://doi.org/10.1371/journal.pgen.1006292.g005

The (ADP-ribose) polymerase activity of PARP-1 participates in the regulation of CCR6 in human cells

PARP-1 is a poly(ADP-ribose)polymerase that transfers ADP-ribose groups to target proteins and can thereby alter gene transcription [10]. To test if poly(ADP-ribose)polymerase activity is required for the regulation of CCR6 expression, we treated human Jurkat T cells, HCT116 cells and Hela cells with a PARP-1 inhibitor, 3-aminobenzamide (3-AB), that inhibits PARP-1 enzymatic activity by competing for the NAD+ binding site on PARP-1 [14]. Cells were treated with 0, 5 and 10 mM 3-AB for 72 h and analyzed for CCR6 expression by qPCR and Western blot (Fig 6a and 6b). At the 10 mM concentration, our results showed a significant decrease of CCR6 expression on Jurkat T cells and HCT116, while Hela cells exhibited a trend in the same direction. Under these conditions, treated cells grew at a slower rate (~75% of control), but no apoptosis was observed morphologically or by Western blot, as PARP-1 degradation is a marker of apoptosis (Fig 6b). This result confirms the identification of PARP-1 in the regulation of CCR6 expression and implicates its poly(ADP-ribose)polymerase activity in this function.

Download:

Fig 6. CCR6 expression in human cells treated with 3-aminobenzamide.

(a) qPCR and (b) Western blot to show expression of CCR6 and PARP-1 in Jurkat T cells, HCT116 and Hela cells. Cells were treated with 0 mM (lane 1), 5 mM (lane 2) and 10 mM (lane 3) 3-AB for 72 hrs. For qPCR, data are shown as mean±s.d. (n = 3).

https://doi.org/10.1371/journal.pgen.1006292.g006

Discussion

GWAS have identified a role for numerous genetic loci in the modulation of complex phenotypes, including common diseases such as RA. Dissecting the associated mechanistic pathways remains a major challenge, especially for non-coding variants, even when a putative causative polymorphism has been established [3]. In this report, we introduce FREP as a technically straightforward tool to identify DNA binding proteins, and use this method to define the pathway by which a functional polymorphism, the CCR6DNP, regulates expression of CCR6. Specifically, we show that PARP-1 associates with the CCR6DNP in sequence- and allele-specific manner; that interference with PARP-1 expression impairs expression of CCR6 at mRNA and protein levels; and that chemical inhibition of PARP-1 exerts a similar effect, indicating that the enzymatic activity of PARP-1 is relevant for its regulatory function, while confirming that the pathway spans cellular lineages.

Compared with conventional DNA pulldown assays [15], FREP reduces non-specific binding through distinct restriction enzyme cleavage sites on either side of the bait sequence. An identical DNA construct, but without bead linkage, can be employed as a competitor to highlight proteins that bind bait DNA with sequence specificity (see Fig 3). We further adapted a method developed by Wu [12] to combine DNA pulldown with Western blot, in the setting of varying competitor sequences, to assess allelic specificity (see Fig 4b). Together, these techniques provide a new approach to explore regulatory DNA-protein associations identified by genetic association studies.

FREP and other pulldown assays cannot distinguish direct DNA binding from participation in a larger DNA-binding protein complex. Previous reports have implicated PARP-1 in transcriptional regulation of a number of human genes including HFE, CXCL1, cTnT, iNOS, SNCA and Tcirg1 [16–24]. In these reports, PARP-1 interacted with the TGTTG sequence in the cTnT promoter, GCTGTGGGAA in the Tcirg1 promoter, and the palindrome-like sequence ATGGTcttACCTA in the HFE promoter. The lack of sequence specificity could suggest that PARP-1 serves as part of a larger protein complex, or alternately that it recognizes a secondary structure such as cruciform DNA [25,26]. Indeed, our present data do not establish that PARP-1 itself directly recognizes the CCR6DNP sequence. However, it is interesting to note that the CCR6DNP risk allele GCAGAATGGGGGGT bears some similarity to the binding sequences at cTnT and Tcirg1, suggesting that—if in fact PARP-1 binds directly to these sequences—then TG might play an important role in DNA recognition.

PARP-1 is the founding member of a family of enzymes engaged in transfer of poly ADP-ribose (PAR) to a wide range of nuclear and cytoplasmic proteins, including PARP-1 itself [10,27]. PARP-1 is a multifunctional protein that plays essential roles in the cell, including DNA repair, translation, transcription, telomere maintenance, genomic stability, and chromatin remodeling [28]. PARP-1-deficient mice are viable but show increased sensitivity to genotoxic stress, resistance to DNA damage-induced cell death, and increased susceptibility to chemically- or genetically-induced tumors [29]. Recently, accumulating data suggest that PARP-1 is an important regulator of gene transcription [28–30]. This role may be accomplished in multiple ways, including binding to DNA, decondensation of chromatin [31,32], alteration of mRNA splicing through regulation of the splicing silencers or enhancers [33], recruitment of transcription factors [34], and post-translational modulation of RNA translation [35,36]. Some of these studies implicate the enzymatic activity of PARP-1 [24, 30], although in other contexts this activity appears dispensable [37]. Our findings add to this literature by identifying CCR6 as a specific target of PARP-1, defining a disease-associated DNA polymorphism that modulates this association, and confirming a role for PARP-1 enzymatic activity in the transcriptional regulation of CCR6. Our data do not define the relevant PARylation target, which could include another protein in the CCR6 regulatory complex, associated histones, or PARP-1 itself.

Identification of the role for PARP-1 as a regulator of CCR6 began with experimental confirmation by TALEN that CCR6DNP was directly involved in modulation of gene expression, as had been suggested previously [4]. These experiments targeted the general locus, rather than the dinuclotide motif itself, and revealed clone-to-clone variability that we presume reflects the effect of each mutation on the larger binding sequence, not defined here. For example, deletions flanking the CCR6DNP in clone 9 translated into impaired CCR6 expression despite an intact CCR6DNP (S1 and S2 Figs), while gene expression was hardly altered by mutations introduced in clones 13 and 17 (Fig 1). Despite this variability, these results helped to engender confidence that CCR6DNP was indeed a suitable “bait” region, a conclusion borne out by the subsequent identification of the allelic association of PARP-1 with this locus.

One strength of FREP is its utility to test allele specificity through a unique assay in which FREP is performed in the presence of allelic competitors (Fig 4b). This assay can be technically challenging if allelic impact on binding affinity is partial. For example, in triplicate repeats quantitated using densitometry, we were able to distinguish statistically between the high-risk TG allele and non-specific DNA, but found only a trend with respect to intermediate risk alleles GC and CA, though it is notable that no such trend was evident in the binding of loading control Ku86.

The effect of PARP-1 on CCR6 is consistent with its role as an activator of inflammation mediated by NFκB, AP-1, and MAP kinases [38–40]. Its impact on CCR6 via a RA-associated functional polymorphism is also consistent with the role of PARP-1 in inflammatory arthritis [8], although limited knowledge of signal transduction pathways downstream of CCR6 constrains the understanding of how the interaction between PARP-1 and CCR6 contributes to RA. Nevertheless, both genetic deficiency [41] and chemical inhibition [42–44] of PARP-1 attenuates experimental arthritis in the mouse. The latter is accompanied by significant reductions in pro-inflammatory cytokines, chemokines, inflammatory mediators, and endothelial expression of key adhesion molecules VCAM-1 and ICAM-1. Our finding that PARP-1 regulates CCR6 –work originating in human genetics—lends further support to the hypothesis that PARP-1 could represent a promising anti-inflammatory target in humans, a conclusion of potential importance since PARP-1 inhibitors are already approved for human use in ovarian cancer [8,45].

More generally, our studies demonstrate a solution to the challenge of bridging the gap from GWAS to biological mechanism for regulatory polymorphisms, considered to represent a substantial fraction of GWAS hits [2,3]. First, TALEN or other targeted gene editing technique (such as clustered regularly-interspaced short palindromic repeats, CRISPR) is used to confirm that a specific locus is active in regulating a target gene. Second, FREP is employed to identify associated transcriptional enhancers or repressors. This approach is applicable both to the identification of regulatory proteins, as demonstrated here, and also to the validation of candidate regulatory proteins implicated through bioinformatic or other approaches.

In conclusion, we confirm that CCR6DNP is a causal allele that controls expression of CCR6, and identify PARP-1 as a direct regulator of CCR6 through the RA risk polymorphism CCR6DNP. Our strategy, encompassing sequence perturbation and FREP, represents a novel approach to defining pathways by which non-coding genetic polymorphisms alter disease risk. A comprehensive understanding of such pathways will represent an important step forward in the development of individualized therapeutic strategies for patients with RA and other diseases.

Materials and Methods

Cells and culture

The human colon cancer line HCT116 and the human monocyte line THP-1 were purchased from ATCC and cultured in McCoy’s 5A and RPMI medium supplemented with 10% FBS, respectively. Mouse anti-human PARP-1 antibody (Cat#: 14-6666-92) and CCR6 antibody (Cat#: 14-1969-82) were purchased from eBioscience and used at 1μg/ml.

Construction of TALEN expression plasmids

TALEN expression plasmids were constructed exactly as described [9]. The TALEN cloning backbone and TALE monomer template were purchased from Addgene (TALEN Kit #1000000019). All primers were synthesized and purchased from IDT. The TALEN target sequence for CCR6 is AGCACCCCCCATTCTGCAGC. Sequences for the left and right TALENs are TCATTCATGTTAGATCCACC and AGCCACAGCCCCCAGGGTGA.

Generation of mutations by TALENs in HCT116 cells

50μg of right and left TALENs were transfected together with 5μg of pGK/puro (Addgene, plasmid 11349) using standard calcium phosphate transfection. After 48 h incubation, cells were re-plated and selected against 0.8 μg/ml puromycin. Single puromycin- resistant clones were harvested and genomic DNA isolated to amplify the CCR6 fragment using forward primer 5’-ACATGTCTCCCAAACTTCTCACCC-3’ and reverse primer: 5’-TTTGTGCAGGGAGGTTGGGATGAA-3’. The PCR fragments were either sequenced directly with the reverse primer or cloned into TA vector and sequenced with T7 primer (Genewiz). Clones positive for mutations were subcloned and their DNA was cloned into TA vector to sequence both alleles. Each clone was sequenced at least 10 times to establish heterozygosity or homozygosity.

RNA isolation, reverse transcription and real time PCR

RNA was isolated using the RNeasy Mini Kit (Qiagen). cDNA was synthesized with SuperScript III First-Strand Synthesis System and cDNA was amplified by real time PCR with Power SYBR Green PCR Master Mix (Life Technologies). For detection of whole CCR6 mRNA (both a and b variants), 5’ primer: TGAGCGGGGAATCAATGAATT and 3’ primer: TCCTGCAAGGAGCACAGTAACAT were used. For detection of the transcript variant a, 5’ primer: TAGGAAGTGGCAATCCAGAAC and 3’ primer: ATGACTCCAGCTCACCAATG were used. For detection of the transcript variant b, 5’ primer: CCACGTGTATATGCTGGTGAA and 3’ primer: GGAGCTGTCTGTTCCACAAA were used.

Flanking Restriction Enhanced Pulldown (FREP)

An 82bp DNA fragment biotinylated at the 5’ end by IDT was conjugated to streptavidin-coated Dynabeads as per manufacturer’s instructions (Invitrogen). This fragment was engineered to include a 31bp target sequence (see below) flanked by restriction enzyme cleavage sites with BamH I proximally and EcoR I distally. Outside these two cleavage sites were introduced 20bp DNA fragments for PCR amplification of the whole unit (proximal: 5’- AATGATACGGCGACCACCGA-3’; distal: 5’- CAAGCAGAAGACGGCATACGA-3’). Bead-linked DNA was mixed with 50μg THP-1 nuclear extract in 1x binding buffer (10 mM Tris pH 7.5, 50 mM KCl, 5mM MgCl2, 2.5% glycerol, 0.5% NP-40 and 1 μg polydI-dC) at room temperature for 20 min. Nuclear extract was generated by NE-PER nuclear and cytoplasmic extraction reagents (Thermo Scientific). After magnetic selection and wash with PBS+0.05% Tween 20, DNA beads with bound proteins were digested with EcoR I at 37C for 30 min. The supernatant was collected as the EcoR I fraction. After another magnetic selection and wash, the DNA beads were digested with BamH I at 37C for 30 min and the supernatant was collected as the BamH I fraction. Both EcoR I and BamH I fractions were resolved by 7% SDS-PAGE gel for either Western blot analysis or silver staining. Mass spectrometry was performed in BIDMC using Thermohybrid Orbitrap XL high resolution MS (Thermo Scientific).

The “bait” DNA fragment used for FREP was:

CCR6DNP/TG:

/5Biosg/AATGATACGGCGACCACCGAGGATCCGTGGCTGCTGCAGAATGGGGGGTGCTGGTGAATTCTCGTATGCCGTCTTCTGCTTG.

The DNA fragments used for the competition assay were:

CCR6DNP/TG:

AATGATACGGCGACCACCGAGGATCCGTGGCTGCTGCAGAATGGGGGGTGCTGGTGAATTCTCGTATGCCGTCTTCTGCTTG

CCR6DNP/CG:

AATGATACGGCGACCACCGAGGATCCGTGGCTGCTGCAGAACGGGGGGTGCTGGTGAATTCTCGTATGCCGTCTTCTGCTTG

CCR6DNP/CA:

AATGATACGGCGACCACCGAGGATCCGTGGCTGCTGCAGAACAGGGGGTGCTGGTGAATTCTCGTATGCCGTCTTCTGCTTG

Irrelevant DNA sequence: AATGATACGGCGACCACCGAGGATCCAGGGCTGTAGATTCCGGCCTGAAGCCTGGGAATTCTCGTATGCCGTCTTCTGCTTG.

ChIP assay

The ChiP assay was performed as described in Noss et al., 2015 [46]. PARP-1 antibody was purchased from Genetex (GTX100573). The CCR6DNP fragment was detected by qPCR with 5’ primer: GTGAGAAGTTTGGGAGACATGT and 3’ primer TTGGAAACGCTCTAATAGACCAC. For assessing the frequency of both alleles on the CCR6DNP in wild type HCT116 cells before and after the ChIP assays, CCR6DNP fragments were cloned into TA vectors (Promega) and sequenced by T7 primer.

PARP-1 knockdown

PARP-1 knockdown in HCT116 cells was performed using a mixture of four retroviruses containing 4 PARP-1 unique 29mer shRNAs, as per manufacturer’s instructions (Origene Cat#: TG315488). 24 h after infection, cells were re-plated and selected in 1 ug/ml puromycin. 3 days after selection, both protein and RNA were isolated for assays. PARP-1 knockdown in Jurkat cells was performed using PARP-1 siRNA from Santa Cruz Biotech (sc-29437). Transfection was done using GenMute siRNA Transfection Reagent for Jurkat Cell (SignaGen Laboratories) in a 24 well format. 40 pmoles siRNA was used. 48 h after transfection, protein and RNA were isolated for assay.

3-Aminobenzamide treatment

1x10⁵ cells were plated in a 24-well plate the day before the treatment. On day one, both DMSO (control) and different concentrations of 3-AB (Sigma) were added. After 72 hrs, protein and RNA were isolated for Western blot and qPCR assays.

Statistical analysis

Statistical significance was evaluated with Student’s t-test, 2 tailed, *P<0.05, **P<0.01, ***P<0.001, NS, nonsignificant. n stands for the number of replicated independent experiments.

Supporting Information

S1 Fig. Sequence and sequence trace of 17 mutants generated by TALENs.

https://doi.org/10.1371/journal.pgen.1006292.s001

(TIF)

S2 Fig. Expression of CCR6 (a) and CD40 (b) in mutated HCT116 cells by real time PCR.

https://doi.org/10.1371/journal.pgen.1006292.s002

(TIF)

S3 Fig. Expression of CCR6 variants a and b in HCT116 and Jurkat T cells.

https://doi.org/10.1371/journal.pgen.1006292.s003

(TIF)

Acknowledgments

We thank Dr. Feng Zhang for support with TALENs technology and Drs. Jonathan Higgins and Soumya Raychaudhuri for scientific discussion.

Author Contributions

Conceptualization: GL RMP PAN.
Formal analysis: GL DW DD YO.
Funding acquisition: GL PAN.
Investigation: GL PC YY.
Methodology: GL.
Project administration: GL PAN.
Resources: GL RMP PAN.
Supervision: GL RMP PAN.
Visualization: GL.
Writing – original draft: GL PAN.
Writing – review & editing: GL PC DW DD YY YO RMP PAN.

References

1. McInnes IB, Schett G (2011) The pathogenesis of rheumatoid arthritis. N Engl J Med 365: 2205–2219. pmid:22150039
- View Article
- PubMed/NCBI
- Google Scholar
2. Okada Y, Wu D, Trynka G, Raj T, Terao C, et al. (2014) Genetics of rheumatoid arthritis contributes to biology and drug discovery. Nature 506: 376–381. pmid:24390342
- View Article
- PubMed/NCBI
- Google Scholar
3. (2014) Little boxes. Nat Genet 46: 659. pmid:24965724
- View Article
- PubMed/NCBI
- Google Scholar
4. Kochi Y, Okada Y, Suzuki A, Ikari K, Terao C, et al. (2010) A regulatory variant in CCR6 is associated with rheumatoid arthritis susceptibility. Nat Genet 42: 515–519. pmid:20453841
- View Article
- PubMed/NCBI
- Google Scholar
5. Lee AY, Korner H (2014) CCR6 and CCL20: emerging players in the pathogenesis of rheumatoid arthritis. Immunol Cell Biol 92: 354–358. pmid:24394994
- View Article
- PubMed/NCBI
- Google Scholar
6. Hirota K, Yoshitomi H, Hashimoto M, Maeda S, Teradaira S, et al. (2007) Preferential recruitment of CCR6-expressing Th17 cells to inflamed joints via CCL20 in rheumatoid arthritis and its animal model. J Exp Med 204: 2803–2812. pmid:18025126
- View Article
- PubMed/NCBI
- Google Scholar
7. Koumakis E, Bouaziz M, Dieude P, Ruiz B, Riemekasten G, et al. (2013) A regulatory variant in CCR6 is associated with susceptibility to antitopoisomerase-positive systemic sclerosis. Arthritis Rheum 65: 3202–3208. pmid:23983073
- View Article
- PubMed/NCBI
- Google Scholar
8. Garcia S, Conde C (2015) The Role of Poly(ADP-ribose) Polymerase-1 in Rheumatoid Arthritis. Mediators Inflamm 2015: 837250. pmid:26339143
- View Article
- PubMed/NCBI
- Google Scholar
9. Sanjana NE, Cong L, Zhou Y, Cunniff MM, Feng G, et al. (2012) A transcription activator-like effector toolbox for genome engineering. Nat Protoc 7: 171–192. pmid:22222791
- View Article
- PubMed/NCBI
- Google Scholar
10. Gibson BA, Kraus WL (2012) New insights into the molecular and cellular functions of poly(ADP-ribose) and PARPs. Nat Rev Mol Cell Biol 13: 411–424. pmid:22713970
- View Article
- PubMed/NCBI
- Google Scholar
11. Langelier MF, Pascal JM (2013) PARP-1 mechanism for coupling DNA damage detection to poly(ADP-ribose) synthesis. Curr Opin Struct Biol 23: 134–143. pmid:23333033
- View Article
- PubMed/NCBI
- Google Scholar
12. Wu KK (2006) Analysis of protein-DNA binding by streptavidin-agarose pulldown. Methods Mol Biol 338: 281–290. pmid:16888365
- View Article
- PubMed/NCBI
- Google Scholar
13. Tong WM, Cortes U, Hande MP, Ohgaki H, Cavalli LR, et al. (2002) Synergistic role of Ku80 and poly(ADP-ribose) polymerase in suppressing chromosomal aberrations and liver cancer formation. Cancer Res 62: 6990–6996. pmid:12460917
- View Article
- PubMed/NCBI
- Google Scholar
14. Zheng YD, Xu XQ, Peng F, Yu JZ, Wu H (2011) The poly(ADP-ribose) polymerase-1 inhibitor 3-aminobenzamide suppresses cell growth and migration, enhancing suppressive effects of cisplatin in osteosarcoma cells. Oncol Rep 25: 1399–1405. pmid:21399878
- View Article
- PubMed/NCBI
- Google Scholar
15. Xia Q, Deliard S, Yuan CX, Johnson ME, Grant SF (2015) Characterization of the transcriptional machinery bound across the widely presumed type 2 diabetes causal variant, rs7903146, within TCF7L2. Eur J Hum Genet 23: 103–109. pmid:24667787
- View Article
- PubMed/NCBI
- Google Scholar
16. Pelham C, Jimenez T, Rodova M, Rudolph A, Chipps E, et al. (2013) Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter. Biochim Biophys Acta 1829: 1257–1265. pmid:24184271
- View Article
- PubMed/NCBI
- Google Scholar
17. Lodhi N, Kossenkov AV, Tulin AV (2014) Bookmarking promoters in mitotic chromatin: poly(ADP-ribose)polymerase-1 as an epigenetic mark. Nucleic Acids Res 42: 7028–7038. pmid:24861619
- View Article
- PubMed/NCBI
- Google Scholar
18. Beranger GE, Momier D, Rochet N, Quincey D, Guigonis JM, et al. (2006) RANKL treatment releases the negative regulation of the poly(ADP-ribose) polymerase-1 on Tcirg1 gene expression during osteoclastogenesis. J Bone Miner Res 21: 1757–1769. pmid:17002555
- View Article
- PubMed/NCBI
- Google Scholar
19. Chiba-Falek O, Kowalak JA, Smulson ME, Nussbaum RL (2005) Regulation of alpha-synuclein expression by poly (ADP ribose) polymerase-1 (PARP-1) binding to the NACP-Rep1 polymorphic site upstream of the SNCA gene. Am J Hum Genet 76: 478–492. pmid:15672325
- View Article
- PubMed/NCBI
- Google Scholar
20. Yu Z, Kuncewicz T, Dubinsky WP, Kone BC (2006) Nitric oxide-dependent negative feedback of PARP-1 trans-activation of the inducible nitric-oxide synthase gene. J Biol Chem 281: 9101–9109. pmid:16464859
- View Article
- PubMed/NCBI
- Google Scholar
21. Yazdany J, Davis J (2004) The role of CD40 ligand in systemic lupus erythematosus. Lupus 13: 377–380. pmid:15230296
- View Article
- PubMed/NCBI
- Google Scholar
22. Frizzell KM, Gamble MJ, Berrocal JG, Zhang T, Krishnakumar R, et al. (2009) Global analysis of transcriptional regulation by poly(ADP-ribose) polymerase-1 and poly(ADP-ribose) glycohydrolase in MCF-7 human breast cancer cells. J Biol Chem 284: 33926–33938. pmid:19812418
- View Article
- PubMed/NCBI
- Google Scholar
23. Ambrose HE, Papadopoulou V, Beswick RW, Wagner SD (2007) Poly-(ADP-ribose) polymerase-1 (Parp-1) binds in a sequence-specific manner at the Bcl-6 locus and contributes to the regulation of Bcl-6 transcription. Oncogene 26: 6244–6252.
- View Article
- Google Scholar
24. Nirodi C, NagDas S, Gygi SP, Olson G, Aebersold R, et al. (2001) A role for poly(ADP-ribose) polymerase in the transcriptional regulation of the melanoma growth stimulatory activity (CXCL1) gene expression. J Biol Chem 276: 9366–9374. pmid:11112786
- View Article
- PubMed/NCBI
- Google Scholar
25. Huang K, Tidyman WE, Le KU, Kirsten E, Kun E, et al. (2004) Analysis of nucleotide sequence-dependent DNA binding of poly(ADP-ribose) polymerase in a purified system. Biochemistry 43: 217–223. pmid:14705948
- View Article
- PubMed/NCBI
- Google Scholar
26. Petrucco S, Percudani R (2008) Structural recognition of DNA by poly(ADP-ribose)polymerase-like zinc finger families. FEBS J 275: 883–893. pmid:18215166
- View Article
- PubMed/NCBI
- Google Scholar
27. Bonicalzi ME, Haince JF, Droit A, Poirier GG (2005) Regulation of poly(ADP-ribose) metabolism by poly(ADP-ribose) glycohydrolase: where and when? Cell Mol Life Sci 62: 739–750. pmid:15868399
- View Article
- PubMed/NCBI
- Google Scholar
28. Thomas C, Tulin AV (2013) Poly-ADP-ribose polymerase: machinery for nuclear processes. Mol Aspects Med 34: 1124–1137. pmid:23624145
- View Article
- PubMed/NCBI
- Google Scholar
29. Kim MY, Zhang T, Kraus WL (2005) Poly(ADP-ribosyl)ation by PARP-1: 'PAR-laying' NAD+ into a nuclear signal. Genes Dev 19: 1951–1967. pmid:16140981
- View Article
- PubMed/NCBI
- Google Scholar
30. Schiewer MJ, Goodwin JF, Han S, Brenner JC, Augello MA, et al. (2012) Dual roles of PARP-1 promote cancer growth and progression. Cancer Discov 2: 1134–1149. pmid:22993403
- View Article
- PubMed/NCBI
- Google Scholar
31. Martinez-Zamudio R, Ha HC (2012) Histone ADP-ribosylation facilitates gene transcription by directly remodeling nucleosomes. Mol Cell Biol 32: 2490–2502. pmid:22547677
- View Article
- PubMed/NCBI
- Google Scholar
32. Ji Y, Tulin AV (2010) The roles of PARP1 in gene control and cell differentiation. Curr Opin Genet Dev 20: 512–518. pmid:20591646
- View Article
- PubMed/NCBI
- Google Scholar
33. Ji Y, Tulin AV (2009) Poly(ADP-ribosyl)ation of heterogeneous nuclear ribonucleoproteins modulates splicing. Nucleic Acids Res 37: 3501–3513. pmid:19346337
- View Article
- PubMed/NCBI
- Google Scholar
34. Krishnakumar R, Gamble MJ, Frizzell KM, Berrocal JG, Kininis M, et al. (2008) Reciprocal binding of PARP-1 and histone H1 at promoters specifies transcriptional outcomes. Science 319: 819–821. pmid:18258916
- View Article
- PubMed/NCBI
- Google Scholar
35. Di Giammartino DC, Shi Y, Manley JL (2013) PARP1 represses PAP and inhibits polyadenylation during heat shock. Mol Cell 49: 7–17. pmid:23219533
- View Article
- PubMed/NCBI
- Google Scholar
36. Ji Y, Tulin AV (2012) Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization. Nat Commun 3: 760. pmid:22453833
- View Article
- PubMed/NCBI
- Google Scholar
37. Pavri R, Lewis B, Kim TK, Dilworth FJ, Erdjument-Bromage H, et al. (2005) PARP-1 determines specificity in a retinoid signaling pathway via direct modulation of mediator. Mol Cell 18: 83–96. pmid:15808511
- View Article
- PubMed/NCBI
- Google Scholar
38. Oliver FJ, Menissier-de Murcia J, Nacci C, Decker P, Andriantsitohaina R, et al. (1999) Resistance to endotoxic shock as a consequence of defective NF-kappaB activation in poly (ADP-ribose) polymerase-1 deficient mice. EMBO J 18: 4446–4454. pmid:10449410
- View Article
- PubMed/NCBI
- Google Scholar
39. Zingarelli B, Hake PW, Burroughs TJ, Piraino G, O'Connor M, et al. (2004) Activator protein-1 signalling pathway and apoptosis are modulated by poly(ADP-ribose) polymerase-1 in experimental colitis. Immunology 113: 509–517. pmid:15554929
- View Article
- PubMed/NCBI
- Google Scholar
40. Veres B, Radnai B, Gallyas F Jr., Varbiro G, Berente Z, et al. (2004) Regulation of kinase cascades and transcription factors by a poly(ADP-ribose) polymerase-1 inhibitor, 4-hydroxyquinazoline, in lipopolysaccharide-induced inflammation in mice. J Pharmacol Exp Ther 310: 247–255. pmid:14999056
- View Article
- PubMed/NCBI
- Google Scholar
41. Garcia S, Bodano A, Gonzalez A, Forteza J, Gomez-Reino JJ, et al. (2006) Partial protection against collagen antibody-induced arthritis in PARP-1 deficient mice. Arthritis Res Ther 8: R14. pmid:16356201
- View Article
- PubMed/NCBI
- Google Scholar
42. Gonzalez-Rey E, Martinez-Romero R, O'Valle F, Aguilar-Quesada R, Conde C, et al. (2007) Therapeutic effect of a poly(ADP-ribose) polymerase-1 inhibitor on experimental arthritis by downregulating inflammation and Th1 response. PLoS One 2: e1071. pmid:17971849
- View Article
- PubMed/NCBI
- Google Scholar
43. Ahmad SF, Attia SM, Zoheir KM, Ashour AE, Bakheet SA (2014) Attenuation of the progression of adjuvant-induced arthritis by 3-aminobenzamide treatment. Int Immunopharmacol 19: 52–59. pmid:24444779
- View Article
- PubMed/NCBI
- Google Scholar
44. Ahmad SF, Zoheir KM, Bakheet SA, Ashour AE, Attia SM (2014) Poly(ADP-ribose) polymerase-1 inhibitor modulates T regulatory and IL-17 cells in the prevention of adjuvant induced arthritis in mice model. Cytokine 68: 76–85. pmid:24845796
- View Article
- PubMed/NCBI
- Google Scholar
45. Ledermann J, Harter P, Gourley C, Friedlander M, Vergote I, et al. (2012) Olaparib maintenance therapy in platinum-sensitive relapsed ovarian cancer. N Engl J Med 366: 1382–1392. pmid:22452356
- View Article
- PubMed/NCBI
- Google Scholar
46. Noss EH, Nguyen HN, Chang SK, Watts GF, Brenner MB (2015) Genetic polymorphism directs IL-6 expression in fibroblasts but not selected other cell types. Proc Natl Acad Sci U S A 112: 14948–14953. pmid:26578807
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. McInnes IB, Schett G (2011) The pathogenesis of rheumatoid arthritis. N Engl J Med 365: 2205–2219. pmid:22150039
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Okada Y, Wu D, Trynka G, Raj T, Terao C, et al. (2014) Genetics of rheumatoid arthritis contributes to biology and drug discovery. Nature 506: 376–381. pmid:24390342
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. (2014) Little boxes. Nat Genet 46: 659. pmid:24965724
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Kochi Y, Okada Y, Suzuki A, Ikari K, Terao C, et al. (2010) A regulatory variant in CCR6 is associated with rheumatoid arthritis susceptibility. Nat Genet 42: 515–519. pmid:20453841
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. Lee AY, Korner H (2014) CCR6 and CCL20: emerging players in the pathogenesis of rheumatoid arthritis. Immunol Cell Biol 92: 354–358. pmid:24394994
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Hirota K, Yoshitomi H, Hashimoto M, Maeda S, Teradaira S, et al. (2007) Preferential recruitment of CCR6-expressing Th17 cells to inflamed joints via CCL20 in rheumatoid arthritis and its animal model. J Exp Med 204: 2803–2812. pmid:18025126
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Koumakis E, Bouaziz M, Dieude P, Ruiz B, Riemekasten G, et al. (2013) A regulatory variant in CCR6 is associated with susceptibility to antitopoisomerase-positive systemic sclerosis. Arthritis Rheum 65: 3202–3208. pmid:23983073
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Garcia S, Conde C (2015) The Role of Poly(ADP-ribose) Polymerase-1 in Rheumatoid Arthritis. Mediators Inflamm 2015: 837250. pmid:26339143
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref9] 9. Sanjana NE, Cong L, Zhou Y, Cunniff MM, Feng G, et al. (2012) A transcription activator-like effector toolbox for genome engineering. Nat Protoc 7: 171–192. pmid:22222791
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref10] 10. Gibson BA, Kraus WL (2012) New insights into the molecular and cellular functions of poly(ADP-ribose) and PARPs. Nat Rev Mol Cell Biol 13: 411–424. pmid:22713970
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref11] 11. Langelier MF, Pascal JM (2013) PARP-1 mechanism for coupling DNA damage detection to poly(ADP-ribose) synthesis. Curr Opin Struct Biol 23: 134–143. pmid:23333033
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref12] 12. Wu KK (2006) Analysis of protein-DNA binding by streptavidin-agarose pulldown. Methods Mol Biol 338: 281–290. pmid:16888365
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref13] 13. Tong WM, Cortes U, Hande MP, Ohgaki H, Cavalli LR, et al. (2002) Synergistic role of Ku80 and poly(ADP-ribose) polymerase in suppressing chromosomal aberrations and liver cancer formation. Cancer Res 62: 6990–6996. pmid:12460917
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref14] 14. Zheng YD, Xu XQ, Peng F, Yu JZ, Wu H (2011) The poly(ADP-ribose) polymerase-1 inhibitor 3-aminobenzamide suppresses cell growth and migration, enhancing suppressive effects of cisplatin in osteosarcoma cells. Oncol Rep 25: 1399–1405. pmid:21399878
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref15] 15. Xia Q, Deliard S, Yuan CX, Johnson ME, Grant SF (2015) Characterization of the transcriptional machinery bound across the widely presumed type 2 diabetes causal variant, rs7903146, within TCF7L2. Eur J Hum Genet 23: 103–109. pmid:24667787
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref16] 16. Pelham C, Jimenez T, Rodova M, Rudolph A, Chipps E, et al. (2013) Regulation of HFE expression by poly(ADP-ribose) polymerase-1 (PARP1) through an inverted repeat DNA sequence in the distal promoter. Biochim Biophys Acta 1829: 1257–1265. pmid:24184271
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref17] 17. Lodhi N, Kossenkov AV, Tulin AV (2014) Bookmarking promoters in mitotic chromatin: poly(ADP-ribose)polymerase-1 as an epigenetic mark. Nucleic Acids Res 42: 7028–7038. pmid:24861619
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref18] 18. Beranger GE, Momier D, Rochet N, Quincey D, Guigonis JM, et al. (2006) RANKL treatment releases the negative regulation of the poly(ADP-ribose) polymerase-1 on Tcirg1 gene expression during osteoclastogenesis. J Bone Miner Res 21: 1757–1769. pmid:17002555
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref19] 19. Chiba-Falek O, Kowalak JA, Smulson ME, Nussbaum RL (2005) Regulation of alpha-synuclein expression by poly (ADP ribose) polymerase-1 (PARP-1) binding to the NACP-Rep1 polymorphic site upstream of the SNCA gene. Am J Hum Genet 76: 478–492. pmid:15672325
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref20] 20. Yu Z, Kuncewicz T, Dubinsky WP, Kone BC (2006) Nitric oxide-dependent negative feedback of PARP-1 trans-activation of the inducible nitric-oxide synthase gene. J Biol Chem 281: 9101–9109. pmid:16464859
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref21] 21. Yazdany J, Davis J (2004) The role of CD40 ligand in systemic lupus erythematosus. Lupus 13: 377–380. pmid:15230296
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref22] 22. Frizzell KM, Gamble MJ, Berrocal JG, Zhang T, Krishnakumar R, et al. (2009) Global analysis of transcriptional regulation by poly(ADP-ribose) polymerase-1 and poly(ADP-ribose) glycohydrolase in MCF-7 human breast cancer cells. J Biol Chem 284: 33926–33938. pmid:19812418
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref23] 23. Ambrose HE, Papadopoulou V, Beswick RW, Wagner SD (2007) Poly-(ADP-ribose) polymerase-1 (Parp-1) binds in a sequence-specific manner at the Bcl-6 locus and contributes to the regulation of Bcl-6 transcription. Oncogene 26: 6244–6252.
View Article
Google Scholar

[90] View Article

[91] Google Scholar

[ref24] 24. Nirodi C, NagDas S, Gygi SP, Olson G, Aebersold R, et al. (2001) A role for poly(ADP-ribose) polymerase in the transcriptional regulation of the melanoma growth stimulatory activity (CXCL1) gene expression. J Biol Chem 276: 9366–9374. pmid:11112786
View Article
PubMed/NCBI
Google Scholar

[93] View Article

[94] PubMed/NCBI

[95] Google Scholar

[ref25] 25. Huang K, Tidyman WE, Le KU, Kirsten E, Kun E, et al. (2004) Analysis of nucleotide sequence-dependent DNA binding of poly(ADP-ribose) polymerase in a purified system. Biochemistry 43: 217–223. pmid:14705948
View Article
PubMed/NCBI
Google Scholar

[97] View Article

[98] PubMed/NCBI

[99] Google Scholar

[ref26] 26. Petrucco S, Percudani R (2008) Structural recognition of DNA by poly(ADP-ribose)polymerase-like zinc finger families. FEBS J 275: 883–893. pmid:18215166
View Article
PubMed/NCBI
Google Scholar

[101] View Article

[102] PubMed/NCBI

[103] Google Scholar

[ref27] 27. Bonicalzi ME, Haince JF, Droit A, Poirier GG (2005) Regulation of poly(ADP-ribose) metabolism by poly(ADP-ribose) glycohydrolase: where and when? Cell Mol Life Sci 62: 739–750. pmid:15868399
View Article
PubMed/NCBI
Google Scholar

[105] View Article

[106] PubMed/NCBI

[107] Google Scholar

[ref28] 28. Thomas C, Tulin AV (2013) Poly-ADP-ribose polymerase: machinery for nuclear processes. Mol Aspects Med 34: 1124–1137. pmid:23624145
View Article
PubMed/NCBI
Google Scholar

[109] View Article

[110] PubMed/NCBI

[111] Google Scholar

[ref29] 29. Kim MY, Zhang T, Kraus WL (2005) Poly(ADP-ribosyl)ation by PARP-1: 'PAR-laying' NAD+ into a nuclear signal. Genes Dev 19: 1951–1967. pmid:16140981
View Article
PubMed/NCBI
Google Scholar

[113] View Article

[114] PubMed/NCBI

[115] Google Scholar

[ref30] 30. Schiewer MJ, Goodwin JF, Han S, Brenner JC, Augello MA, et al. (2012) Dual roles of PARP-1 promote cancer growth and progression. Cancer Discov 2: 1134–1149. pmid:22993403
View Article
PubMed/NCBI
Google Scholar

[117] View Article

[118] PubMed/NCBI

[119] Google Scholar

[ref31] 31. Martinez-Zamudio R, Ha HC (2012) Histone ADP-ribosylation facilitates gene transcription by directly remodeling nucleosomes. Mol Cell Biol 32: 2490–2502. pmid:22547677
View Article
PubMed/NCBI
Google Scholar

[121] View Article

[122] PubMed/NCBI

[123] Google Scholar

[ref32] 32. Ji Y, Tulin AV (2010) The roles of PARP1 in gene control and cell differentiation. Curr Opin Genet Dev 20: 512–518. pmid:20591646
View Article
PubMed/NCBI
Google Scholar

[125] View Article

[126] PubMed/NCBI

[127] Google Scholar

[ref33] 33. Ji Y, Tulin AV (2009) Poly(ADP-ribosyl)ation of heterogeneous nuclear ribonucleoproteins modulates splicing. Nucleic Acids Res 37: 3501–3513. pmid:19346337
View Article
PubMed/NCBI
Google Scholar

[129] View Article

[130] PubMed/NCBI

[131] Google Scholar

[ref34] 34. Krishnakumar R, Gamble MJ, Frizzell KM, Berrocal JG, Kininis M, et al. (2008) Reciprocal binding of PARP-1 and histone H1 at promoters specifies transcriptional outcomes. Science 319: 819–821. pmid:18258916
View Article
PubMed/NCBI
Google Scholar

[133] View Article

[134] PubMed/NCBI

[135] Google Scholar

[ref35] 35. Di Giammartino DC, Shi Y, Manley JL (2013) PARP1 represses PAP and inhibits polyadenylation during heat shock. Mol Cell 49: 7–17. pmid:23219533
View Article
PubMed/NCBI
Google Scholar

[137] View Article

[138] PubMed/NCBI

[139] Google Scholar

[ref36] 36. Ji Y, Tulin AV (2012) Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization. Nat Commun 3: 760. pmid:22453833
View Article
PubMed/NCBI
Google Scholar

[141] View Article

[142] PubMed/NCBI

[143] Google Scholar

[ref37] 37. Pavri R, Lewis B, Kim TK, Dilworth FJ, Erdjument-Bromage H, et al. (2005) PARP-1 determines specificity in a retinoid signaling pathway via direct modulation of mediator. Mol Cell 18: 83–96. pmid:15808511
View Article
PubMed/NCBI
Google Scholar

[145] View Article

[146] PubMed/NCBI

[147] Google Scholar

[ref38] 38. Oliver FJ, Menissier-de Murcia J, Nacci C, Decker P, Andriantsitohaina R, et al. (1999) Resistance to endotoxic shock as a consequence of defective NF-kappaB activation in poly (ADP-ribose) polymerase-1 deficient mice. EMBO J 18: 4446–4454. pmid:10449410
View Article
PubMed/NCBI
Google Scholar

[149] View Article

[150] PubMed/NCBI

[151] Google Scholar

[ref39] 39. Zingarelli B, Hake PW, Burroughs TJ, Piraino G, O'Connor M, et al. (2004) Activator protein-1 signalling pathway and apoptosis are modulated by poly(ADP-ribose) polymerase-1 in experimental colitis. Immunology 113: 509–517. pmid:15554929
View Article
PubMed/NCBI
Google Scholar

[153] View Article

[154] PubMed/NCBI

[155] Google Scholar

[ref40] 40. Veres B, Radnai B, Gallyas F Jr., Varbiro G, Berente Z, et al. (2004) Regulation of kinase cascades and transcription factors by a poly(ADP-ribose) polymerase-1 inhibitor, 4-hydroxyquinazoline, in lipopolysaccharide-induced inflammation in mice. J Pharmacol Exp Ther 310: 247–255. pmid:14999056
View Article
PubMed/NCBI
Google Scholar

[157] View Article

[158] PubMed/NCBI

[159] Google Scholar

[ref41] 41. Garcia S, Bodano A, Gonzalez A, Forteza J, Gomez-Reino JJ, et al. (2006) Partial protection against collagen antibody-induced arthritis in PARP-1 deficient mice. Arthritis Res Ther 8: R14. pmid:16356201
View Article
PubMed/NCBI
Google Scholar

[161] View Article

[162] PubMed/NCBI

[163] Google Scholar

[ref42] 42. Gonzalez-Rey E, Martinez-Romero R, O'Valle F, Aguilar-Quesada R, Conde C, et al. (2007) Therapeutic effect of a poly(ADP-ribose) polymerase-1 inhibitor on experimental arthritis by downregulating inflammation and Th1 response. PLoS One 2: e1071. pmid:17971849
View Article
PubMed/NCBI
Google Scholar

[165] View Article

[166] PubMed/NCBI

[167] Google Scholar

[ref43] 43. Ahmad SF, Attia SM, Zoheir KM, Ashour AE, Bakheet SA (2014) Attenuation of the progression of adjuvant-induced arthritis by 3-aminobenzamide treatment. Int Immunopharmacol 19: 52–59. pmid:24444779
View Article
PubMed/NCBI
Google Scholar

[169] View Article

[170] PubMed/NCBI

[171] Google Scholar

[ref44] 44. Ahmad SF, Zoheir KM, Bakheet SA, Ashour AE, Attia SM (2014) Poly(ADP-ribose) polymerase-1 inhibitor modulates T regulatory and IL-17 cells in the prevention of adjuvant induced arthritis in mice model. Cytokine 68: 76–85. pmid:24845796
View Article
PubMed/NCBI
Google Scholar

[173] View Article

[174] PubMed/NCBI

[175] Google Scholar

[ref45] 45. Ledermann J, Harter P, Gourley C, Friedlander M, Vergote I, et al. (2012) Olaparib maintenance therapy in platinum-sensitive relapsed ovarian cancer. N Engl J Med 366: 1382–1392. pmid:22452356
View Article
PubMed/NCBI
Google Scholar

[177] View Article

[178] PubMed/NCBI

[179] Google Scholar

[ref46] 46. Noss EH, Nguyen HN, Chang SK, Watts GF, Brenner MB (2015) Genetic polymorphism directs IL-6 expression in fibroblasts but not selected other cell types. Proc Natl Acad Sci U S A 112: 14948–14953. pmid:26578807
View Article
PubMed/NCBI
Google Scholar

[181] View Article

[182] PubMed/NCBI

[183] Google Scholar

Figures

Abstract

Author Summary

Introduction

Results

Mutations at the CCR6DNP locus alter CCR6 expression

Flanking Restriction Enhanced Pulldown (FREP) identifies the association of PARP-1 with the CCR6DNP

The PARP-1 association with CCR6DNP exhibits sequence and allele specificity

PARP-1 regulates CCR6 expression in human HCT116 cells and Jurkat T cells

The (ADP-ribose) polymerase activity of PARP-1 participates in the regulation of CCR6 in human cells

Discussion

Materials and Methods

Cells and culture

Construction of TALEN expression plasmids

Generation of mutations by TALENs in HCT116 cells

RNA isolation, reverse transcription and real time PCR

Flanking Restriction Enhanced Pulldown (FREP)

ChIP assay

PARP-1 knockdown

3-Aminobenzamide treatment

Statistical analysis

Supporting Information

S1 Fig. Sequence and sequence trace of 17 mutants generated by TALENs.

S2 Fig. Expression of CCR6 (a) and CD40 (b) in mutated HCT116 cells by real time PCR.

S3 Fig. Expression of CCR6 variants a and b in HCT116 and Jurkat T cells.

Acknowledgments

Author Contributions

References