Advertisement
  • Loading metrics

Novel Approach Identifies SNPs in SLC2A10 and KCNK9 with Evidence for Parent-of-Origin Effect on Body Mass Index

  • Clive J. Hoggart,

    Affiliation: Department of Genomics of Common Disease, Imperial College London, London, United Kingdom

  • Giulia Venturini,

    Affiliation: Department of Medical Genetics, University of Lausanne, Lausanne, Switzerland

  • Massimo Mangino,

    Affiliation: Department of Twin Research & Genetic Epidemiology, King's College London, London, United Kingdom

  • Felicia Gomez,

    Affiliation: Department of Genetics, Division of Statistical Genomics, Washington University School of Medicine in St. Louis, St. Louis, Missouri, United States of America

  • Giulia Ascari,

    Affiliation: Department of Medical Genetics, University of Lausanne, Lausanne, Switzerland

  • Jing Hua Zhao,

    Affiliation: MRC-Epidemiology Unit, University of Cambridge, Cambridge, United Kingdom

  • Alexander Teumer,

    Affiliation: Interfaculty Institute for Genetics and Functional Genomics, University Medicine Greifswald, Greifswald, Germany

  • Thomas W. Winkler,

    Affiliation: Department of Genetic Epidemiology, University of Regensburg, Regensburg, Germany

  • Natalia Tšernikova,

    Affiliations: Estonian Genome Center, University of Tartu, Tartu, Estonia, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia

  • Jian'an Luan,

    Affiliation: MRC-Epidemiology Unit, University of Cambridge, Cambridge, United Kingdom

  • Evelin Mihailov,

    Affiliations: Estonian Genome Center, University of Tartu, Tartu, Estonia, Estonian Biocentre, Tartu, Estonia

  • Georg B. Ehret,

    Affiliations: McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine, Center for Complex Disease Genomics, Baltimore, Maryland, United States of America, Cardiology, Geneva University Hospitals, Geneva, Switzerland

  • Weihua Zhang,

    Affiliation: Epidemiology and Biostatistics, School of Public Health, Imperial College London, London, United Kingdom

  • David Lamparter,

    Affiliations: Department of Medical Genetics, University of Lausanne, Lausanne, Switzerland, Swiss Institute of Bioinformatics, Lausanne, Switzerland

  • Tõnu Esko,

    Affiliations: Center for Basic and Translational Obesity Research and Divisions of Endocrinology and Genetics, Boston Children's Hospital, Boston, Massachusetts, United States of America, Metabolism Initiative and Program in Medical and Population Genetics, Broad Institute, Cambridge, Massachusetts, United States of America, Department of Genetics, Harvard Medical School, Boston, Massachusetts, United States of America

  • Aurelien Macé,

    Affiliations: Department of Medical Genetics, University of Lausanne, Lausanne, Switzerland, Swiss Institute of Bioinformatics, Lausanne, Switzerland

  • Sina Rüeger,

    Affiliations: Department of Medical Genetics, University of Lausanne, Lausanne, Switzerland, Swiss Institute of Bioinformatics, Lausanne, Switzerland

  • Pierre-Yves Bochud,

    Affiliation: Infectious Diseases Service, Department of Medicine, Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne, Switzerland

  • Matteo Barcella,

    Affiliation: Department of Health Sciences, University of Milan, Milan, Italy

  • Yves Dauvilliers,

    Affiliations: INSERM-U1061, Montpellier, France, National Reference Network for Orphan Diseases (Narcolepsy and Idiopathic Hypersomnia), Department of Neurology, Gui-de-Chauliac Hospital, Montpellier, France

  • Beben Benyamin,

    Affiliations: Queensland Brain Institute, University of Queensland, Brisbane, Australia, Genetic Epidemiology, QIMR Berghofer Institute of Medical Research, Brisbane, Australia

  • David M. Evans,

    Affiliations: MRC Integrative Epidemiology Unit, University of Bristol, Bristol, United Kingdom, School of Social and Community Medicine, University of Bristol, Bristol, United Kingdom, Diamantina Institute, Translational Research Institute, University of Queensland, Brisbane, Australia

  • Caroline Hayward,

    Affiliation: MRC Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, Scotland, United Kingdom

  • Mary F. Lopez,

    Affiliations: Center for Basic and Translational Obesity Research and Divisions of Endocrinology and Genetics, Boston Children's Hospital, Boston, Massachusetts, United States of America, Metabolism Initiative and Program in Medical and Population Genetics, Broad Institute, Cambridge, Massachusetts, United States of America, Department of Medicine, Harvard Medical School, Boston, Massachusetts, United States of America

  • Lude Franke,

    Affiliation: Department of Genetics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands

  • Alessia Russo,

    Affiliation: Genomic Variation in Human Populations and Complex Diseases Unit, Human Genetics Foundation and Dept. of Medical Sciences, University of Turin, Turin, Italy

  • Iris M. Heid,

    Affiliation: Department of Genetic Epidemiology, University of Regensburg, Regensburg, Germany

  • Erika Salvi,

    Affiliation: Department of Health Sciences, University of Milan, Milan, Italy

  • Sailaja Vendantam,

    Affiliations: Center for Basic and Translational Obesity Research and Divisions of Endocrinology and Genetics, Boston Children's Hospital, Boston, Massachusetts, United States of America, Metabolism Initiative and Program in Medical and Population Genetics, Broad Institute, Cambridge, Massachusetts, United States of America

  • Dan E. Arking,

    Affiliation: McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine, Center for Complex Disease Genomics, Baltimore, Maryland, United States of America

  • Eric Boerwinkle,

    Affiliation: Human Genetics Center, Houston, Texas, United States of America

  • John C. Chambers,

    Affiliation: Epidemiology and Biostatistics, School of Public Health, Imperial College London, London, United Kingdom

  • Giovanni Fiorito,

    Affiliation: Genomic Variation in Human Populations and Complex Diseases Unit, Human Genetics Foundation and Dept. of Medical Sciences, University of Turin, Turin, Italy

  • Harald Grallert,

    Affiliation: Research Unit Molecular Epidemiology, Helmholtz Zentrum München, Neuherberg, Germany

  • Simonetta Guarrera,

    Affiliation: Genomic Variation in Human Populations and Complex Diseases Unit, Human Genetics Foundation, Turin, Italy

  • Georg Homuth,

    Affiliation: Interfaculty Institute for Genetics and Functional Genomics, University Medicine Greifswald, Greifswald, Germany

  • Jennifer E. Huffman,

    Affiliation: MRC Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, Scotland, United Kingdom

  • David Porteous,

    Affiliation: Centre for Molecular Medicine, Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, Scotland, United Kingdom

  • Generation Scotland Consortium ,

    Affiliation: MRC Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, Scotland, United Kingdom

    Membership of Generation Scotland Consortium, The LifeLines Cohort study, and The GIANT Consortium is provided in the Acknowledgments.

  • The LifeLines Cohort study ,

    Affiliation: Department of Genetics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands

    Membership of Generation Scotland Consortium, The LifeLines Cohort study, and The GIANT Consortium is provided in the Acknowledgments.

  • The GIANT Consortium ,

    Affiliation: Center for Basic and Translational Obesity Research and Divisions of Endocrinology and Genetics, Boston Children's Hospital, Boston, Massachusetts, United States of America

    Membership of Generation Scotland Consortium, The LifeLines Cohort study, and The GIANT Consortium is provided in the Acknowledgments.

  • Darius Moradpour,

    Affiliation: Department of Medicine, Service of Gastroenterology and Hepatology, Lausanne, Switzerland

  • Alex Iranzo,

    Affiliation: Neurology Service, Hospital Clinic, Barcelona, Spain

  • Johannes Hebebrand,

    Affiliation: Department of Child and Adolescent Psychiatry, University of Duisburg-Essen, Essen, Germany

  • John P. Kemp,

    Affiliations: MRC Integrative Epidemiology Unit, University of Bristol, Bristol, United Kingdom, School of Social and Community Medicine, University of Bristol, Bristol, United Kingdom

  • Gert J. Lammers,

    Affiliations: Department of Neurology, Leiden University Medical Centre, Leiden, The Netherlands, Sleep Wake Center SEIN, Heemstede, The Netherlands

  • Vincent Aubert,

    Affiliation: Division of Immunology and Allergy, Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne, Switzerland

  • Markus H. Heim,

    Affiliation: Department of Gastroenterology, University Hospital Basel, Basel, Switzerland

  • Nicholas G. Martin,

    Affiliation: Genetic Epidemiology, QIMR Berghofer Institute of Medical Research, Brisbane, Australia

  • Grant W. Montgomery,

    Affiliation: Molecular Epidemiology, QIMR Berghofer Institute of Medical Research, Brisbane, Australia

  • Rosa Peraita-Adrados,

    Affiliation: Sleep and Epilepsy Unit - Clinical Neurophysiology Department, Gregorio Marañón University Hospital, Madrid, Spain

  • Joan Santamaria,

    Affiliation: Neurology Service, Hospital Clinic, Barcelona, Spain

  • Francesco Negro,

    Affiliation: Service of Gastroenterology and Hepatology, Service of Clinical Pathology, Geneva, Switzerland

  • Carsten O. Schmidt,

    Affiliation: Institute for Community Medicine, University Medicine Greifswald, Greifswald, Germany

  • Robert A. Scott,

    Affiliation: MRC-Epidemiology Unit, University of Cambridge, Cambridge, United Kingdom

  • Tim D. Spector,

    Affiliation: Department of Twin Research & Genetic Epidemiology, King's College London, London, United Kingdom

  • Konstantin Strauch,

    Affiliations: Institute of Genetic Epidemiology, Helmholtz Zentrum München - German Research Center for Environmental Health, Neuherberg, Germany, Institute of Medical Informatics, Biometry and Epidemiology, Chair of Genetic Epidemiology, Ludwig-Maximilians-Universität, Munich, Germany

  • Henry Völzke,

    Affiliation: Institute for Community Medicine, University Medicine Greifswald, Greifswald, Germany

  • Nicholas J. Wareham,

    Affiliation: MRC-Epidemiology Unit, University of Cambridge, Cambridge, United Kingdom

  • Wei Yuan,

    Affiliation: Department of Twin Research & Genetic Epidemiology, King's College London, London, United Kingdom

  • Jordana T. Bell,

    Affiliation: Department of Twin Research & Genetic Epidemiology, King's College London, London, United Kingdom

  • Aravinda Chakravarti,

    Affiliation: McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University School of Medicine, Center for Complex Disease Genomics, Baltimore, Maryland, United States of America

  • Jaspal S. Kooner,

    Affiliation: Cardiovascular Science, National Heart & Lung Institute, Imperial College London, London, United Kingdom

  • Annette Peters,

    Affiliations: Institute of Epidemiology II, Helmholtz Zentrum München, Neuherberg, Germany, Deutsches Zentrum für Diabetes, Neuherberg, Germany

  • Giuseppe Matullo,

    Affiliation: Genomic Variation in Human Populations and Complex Diseases Unit, Human Genetics Foundation and Dept. of Medical Sciences, University of Turin, Turin, Italy

  • Henri Wallaschofski,

    Affiliation: Institute of Clinical Chemistry and Laboratory Medicine, University Medicine Greifswald, Greifswald, Germany

  • John B. Whitfield,

    Affiliation: Genetic Epidemiology, QIMR Berghofer Institute of Medical Research, Brisbane, Australia

  • Fred Paccaud,

    Affiliation: Institute of Social and Preventive Medicine (IUMSP), Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne, Switzerland

  • Peter Vollenweider,

    Affiliation: Department of Internal Medicine, Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne, Switzerland

  • Sven Bergmann,

    Affiliations: Department of Medical Genetics, University of Lausanne, Lausanne, Switzerland, Swiss Institute of Bioinformatics, Lausanne, Switzerland

  • Jacques S. Beckmann,

    Affiliation: Swiss Institute of Bioinformatics, Lausanne, Switzerland

  • Mehdi Tafti,

    Affiliations: Center for Integrative Genomics (CIG), University of Lausanne, Lausanne, Switzerland, Center for Investigation and Research in Sleep (CIRS), Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne, Switzerland

  • Nicholas D. Hastie,

    Affiliation: MRC Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, Scotland, United Kingdom

  • Daniele Cusi,

    Affiliation: Department of Health Sciences, University of Milan, Milan, Italy

  • Murielle Bochud,

    Affiliation: Institute of Social and Preventive Medicine (IUMSP), Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne, Switzerland

  • Timothy M. Frayling,

    Affiliation: University of Exeter Medical School, University of Exeter, Exeter, United Kingdom

  • Andres Metspalu,

    Affiliations: Estonian Genome Center, University of Tartu, Tartu, Estonia, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia, Estonian Biocentre, Tartu, Estonia

  • Marjo-Riitta Jarvelin,

    Affiliations: Institute of Health Sciences, University of Oulu, Oulu, Finland, Biocenter Oulu, University of Oulu, Oulu, Finland, Department of Children and Young People and Families, National Institute for Health and Welfare, Oulu, Finland, Department of Epidemiology and Biostatistics, School of Public Health, MRC-HPA Centre for Environment and Health, Faculty of Medicine, Imperial College London, London, United Kingdom, Unit of Primary Care, Oulu University Hospital, Oulu, Finland

  • André Scherag,

    Affiliations: Institute for Medical Informatics, Biometry and Epidemiology, University Hospital of Essen, University of Duisburg-Essen, Essen, Germany, Clinical Epidemiology, Integrated Research and Treatment Center, Center for Sepsis Control and Care (CSCC), Jena University Hospital, Jena, Germany

  • George Davey Smith,

    Affiliations: MRC Integrative Epidemiology Unit, University of Bristol, Bristol, United Kingdom, School of Social and Community Medicine, University of Bristol, Bristol, United Kingdom

  • Ingrid B. Borecki,

    Affiliation: Department of Genetics, Division of Statistical Genomics, Washington University School of Medicine in St. Louis, St. Louis, Missouri, United States of America

  • Valentin Rousson,

    Affiliation: Institute of Social and Preventive Medicine (IUMSP), Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne, Switzerland

  • Joel N. Hirschhorn,

    Affiliations: Center for Basic and Translational Obesity Research and Divisions of Endocrinology and Genetics, Boston Children's Hospital, Boston, Massachusetts, United States of America, Metabolism Initiative and Program in Medical and Population Genetics, Broad Institute, Cambridge, Massachusetts, United States of America, Department of Genetics, Harvard Medical School, Boston, Massachusetts, United States of America

  • Carlo Rivolta,

    Affiliation: Department of Medical Genetics, University of Lausanne, Lausanne, Switzerland

  • Ruth J. F. Loos,

    Affiliations: MRC-Epidemiology Unit, University of Cambridge, Cambridge, United Kingdom, The Charles Bronfman Institute of Personalized Medicine, The Icahn School of Medicine at Mount Sinai, New York, New York, United States of America, The Mindich Child Health and Development Institute, The Icahn School of Medicine at Mount Sinai, New York, New York, United States of America, The Genetics of Obesity and Related Metabolic Traits Program, The Icahn School of Medicine at Mount Sinai, New York, New York, United States of America

  •  [ ... ],
  • Zoltán Kutalik

    zoltan.kutalik@unil.ch

    Affiliations: Department of Medical Genetics, University of Lausanne, Lausanne, Switzerland, Swiss Institute of Bioinformatics, Lausanne, Switzerland, Institute of Social and Preventive Medicine (IUMSP), Centre Hospitalier Universitaire Vaudois (CHUV), Lausanne, Switzerland

  • [ view all ]
  • [ view less ]

Novel Approach Identifies SNPs in SLC2A10 and KCNK9 with Evidence for Parent-of-Origin Effect on Body Mass Index

  • Clive J. Hoggart, 
  • Giulia Venturini, 
  • Massimo Mangino, 
  • Felicia Gomez, 
  • Giulia Ascari, 
  • Jing Hua Zhao, 
  • Alexander Teumer, 
  • Thomas W. Winkler, 
  • Natalia Tšernikova, 
  • Jian'an Luan
PLOS
x

Abstract

The phenotypic effect of some single nucleotide polymorphisms (SNPs) depends on their parental origin. We present a novel approach to detect parent-of-origin effects (POEs) in genome-wide genotype data of unrelated individuals. The method exploits increased phenotypic variance in the heterozygous genotype group relative to the homozygous groups. We applied the method to >56,000 unrelated individuals to search for POEs influencing body mass index (BMI). Six lead SNPs were carried forward for replication in five family-based studies (of ∼4,000 trios). Two SNPs replicated: the paternal rs2471083-C allele (located near the imprinted KCNK9 gene) and the paternal rs3091869-T allele (located near the SLC2A10 gene) increased BMI equally (beta = 0.11 (SD), P<0.0027) compared to the respective maternal alleles. Real-time PCR experiments of lymphoblastoid cell lines from the CEPH families showed that expression of both genes was dependent on parental origin of the SNPs alleles (P<0.01). Our scheme opens new opportunities to exploit GWAS data of unrelated individuals to identify POEs and demonstrates that they play an important role in adult obesity.

Author Summary

Large genetic association studies have revealed many genetic factors influencing common traits, such as body mass index (BMI). These studies assume that the effect of genetic variants is the same regardless of whether they are inherited from the mother or the father. In our study, we have developed a new approach that allows us to investigate variants whose impact depends on their parental origin (parent-of-origin effects), in unrelated samples when the parental origin cannot be inferred. This is feasible because at genetic markers at which such effects occur there is increased variability of the trait among individuals who inherited different genetic codes from their mother and their father compared to individuals who inherited the same genetic code from both parents. We applied this methodology to discover genetic markers with parent-of-origin effects (POEs) on BMI. This resulted in six candidate markers showing strong POE association. We then attempted to replicate the POE effects of these markers in family studies (where one can infer the parental origin of the inherited variants). Two of our candidates showed significant association in the family studies, the paternal and maternal effects of these markers were in the opposite direction.

Introduction

The effect of genetic variants on phenotypes may depend upon the parent from whom the variant was inherited [1], [2]. Parent-of-origin effects (POEs) may arise through imprinting; mechanisms of which include cytosine methylation and histone deacetylation [2]. To date around 50 human genes are known to be imprinted and for most mammalian species less than 1% of the genome is confirmed to be imprinted [3]. One plausible explanation for this phenomenon is the parental conflict hypothesis, whereby both parents would like to maximize the influence of their genome on their offspring [4]. Current methods for detecting parent-of-origin effects rely on assigning parental ancestry to the inherited alleles. This is straightforward in linkage studies, which have identified potential POEs on type 2 diabetes, body mass index (BMI) [5], [6], and alcohol intake [7][9]. However, only a very few of these findings have been replicated and the identified linkage peaks often span large chromosomal regions harbouring hundreds of genes, hence the causal gene or regulatory sequence is unknown. A notable exception is the work of Kong et al [1] who inferred parental origin through genealogy information and long-range phasing to subsequently test for POEs. This study identified six SNPs, four associated with risk of type 2 diabetes and the other two associated with each of breast cancer and basal-cell carcinoma.

Genome-wide association studies (GWASs) of unrelated individuals have very precisely identified a large number of genetic loci harbouring SNPs whose (alternative) allele counts associate with common traits. Since GWASs predominantly include unrelated individuals, the parental origin of the alleles cannot be determined, hence genetic effects influenced by the parental origin of the alleles are typically not considered. Here we present a novel approach that is able to detect POEs using genome-wide genotype data of unrelated individuals. We chose BMI as our target trait, due to previous findings [5], [6] and the large available sample size. We report the discovery of two novel loci affecting BMI in a manner dependent on the parent-of-origin of the transmitted alleles.

Results

We applied our POE test, which compares the phenotypic variance of the heterozygous genotype group to the variance observed in the homozygous groups, to all SNPs genome-wide. The test, which is applicable to unrelated individuals, assumes that an increased variance in the heterozygous group arises because the heterozygous group consists of two subgroups (paternal reference allele/maternal alternative allele and maternal reference allele/paternal alternative allele) each with different means (see Figure 1). Differences in phenotypic variance were tested using the Brown-Forsythe test, modified to test the mean absolute deviations from the median in the heterozygous and homozygous groups (see Materials and Methods for details). We applied this test to BMI values (corrected for age and age-squared), separately in men and women, in 15 studies, totalling up to 56,092 individuals (detailed description of the cohorts can be found in Tables S1S3), 13 of which participated in previous meta-analyses of the GIANT consortium [10]. In total 2,673,768 HapMap imputed and genotyped SNPs were tested. For each locus, a lead SNP (with the strongest POE association) was identified; other markers within 1 Mb or in LD (r2>0.1) were excluded from further investigations. Sex-specific association summary statistics were then meta-analysed. No sex specific difference in effects were observed, therefore all reported results are sex-combined.

thumbnail
Figure 1. Explanation of the POE test.

Top panel illustrates the phenotype distributions in the four genotype groups that would be observed if the parent-of-origin of the alleles were known. Bottom panel shows how these distributions change if the parent-of-origin is unobserved. The resulting heterozygous group will have increased variance due to its heterogeneity. This example describes a scenario we observe for the two replicated hits, namely that the paternal- and maternal effects are of the same size, but opposite in direction (). Therefore the average phenotype in the B/B group is the same as in the A/A group, as the paternal and maternal B allele effects cancel each other out. In the A/B group there are two subpopulations: the A-pat/B-mat group with phenotypic mean of and the A-mat/B-pat group with mean. Thus, the two subpopulations combined also have zero mean, but increased variance.

http://dx.doi.org/10.1371/journal.pgen.1004508.g001

Our criteria to select SNPs to take forward to the replication stage resulted in the selection of six independent SNPs: four lead SNPs with POE P-value <5×10−6 and three SNPs in imprinted regions with P<5×10−4 (see Fig S1 for QQ-plot), one SNP fulfilled both criteria. See Table 1 for details of these results and Materials and Methods for details of the applied selection methods. These six SNPs were carried forward to the replication stage.

thumbnail
Table 1. Discovery POE association results for the six SNPs selected for replication.

http://dx.doi.org/10.1371/journal.pgen.1004508.t001

Replication in family-based studies

The replication stage utilised five family-based studies (see Tables S1S3) to test for parent-of-origin effects at the six selected SNPs. Only heterozygous individuals are informative when testing for parent-of-origin effects; the number of heterozygous individuals for each of the tested SNPs ranged from 1,122 to 4,128 (see Table 2 and Table S4). A simplified parental asymmetry test (PAT, see Materials and Methods) was applied and SNPs successfully replicated if their PAT P-values were below 0.0083 (Bonferroni corrected significance threshold for family-wise error of 0.05 with six tests). Two of these SNPs, rs2471083 [T/C] (GWAS discovery BMI variance (het vs. hom): 1.058 vs 0.963, PPOE = 9.34×10−7; replication PAT P = 0.00264) and rs3091869 [T/C] (GWAS discovery BMI variance (het vs. hom): 1.046 vs 0.957, PPOE = 4.7×10−6; replication PAT P = 0.00245) successfully replicated. In particular, we found that heterozygous individuals who carry the rs2471083-C allele paternally have 0.11 (SD unit) higher BMI on average than those carrying the C-allele maternally (P = 0.00264). Heterozygous carriers of the paternal rs3091869-C allele have 0.11 (SD unit) lower BMI on average than those carrying the maternal C-allele (P = 0.00245). Figure 2 shows the locuszoom plots of the POE association P-values for the two replicated loci (KCNK9 and SLC2A10).

thumbnail
Figure 2. Local association plots.

Panels show the local POE association P-values for the KCNK9 (left panel) and SLC2A10 (right panel) loci.

http://dx.doi.org/10.1371/journal.pgen.1004508.g002

thumbnail
Table 2. Replication of the 6 discovery SNPs in trios (or parent-offspring pairs).

http://dx.doi.org/10.1371/journal.pgen.1004508.t002

Impact of the discovered variants

By combining the effect difference estimates from the family-based studies and the marginal association effect sizes from the largest-to-date meta-analytic study on BMI [10], we estimated the effects of the maternal and paternal alleles. For both rs2471083-C and rs3091869-T we obtained and . Using these effect sizes and the population frequency of these SNPs, we calculated the explained variance of these SNPs (if their parent of origin is known) to be 0.24% and 0.30% for rs2471083 and rs3091869, respectively. These effects are comparable to that of the strongest BMI-associated variant in the FTO gene (0.34%) [10].

Notably, rs2471083 is located 105 kb upstream of the imprinted gene KCNK9. Mutations in this potassium channel gene cause Birk-Barel syndrome, a maternally transmitted syndrome of mental retardation, hypotonia, and unique dysmorphism, resulting from genomic-imprinting [11]. SNPs within 2 kb have been shown to be associated with HDL cholesterol, adiponectin levels [12] and blood pressure [13]. Its impact on hypertension is potentially via a mechanism involving aldosterone, the concentration of which correlates strongly with fat mass. Interestingly, KCNK9 knock-out mice exhibited more fragmented sleep episodes [14] and 7.1%–9.6% increased weight gain (P = 0.02) at 19–20 weeks of age [15]. SNP rs3091869 is 61 kb upstream of SLC2A10, a glucose transporter involved in arterial morphogenesis. SNPs in low LD (in CEU r2 = 0.05) with rs3091869 have been shown to alter body fat distribution [16].

We tested these two confirmed SNPs in 705 trios with paediatric (extreme) obese offspring in which parental origin of the alleles was known in up to 255 individuals [17]. No significant effect was observed (see Table S5). This could be due to insufficient power, different genetic mechanisms between young individuals and adults or that our association is specific to variations within the range of normal BMI.

Expression experiments

We evaluated whether the parent of origin effect of the rs2471083-T and rs3092611-T (proxy for rs3091869-T, r2 = 0.998) alleles can be observed in the expression levels of their respective genes (KCNK9 or SLC2A10). To test this we carried out quantitative PCR (qPCR) experiments using lymphoblastoid cell lines (LCL) of the CEPH families. These cell lines have been used extensively to identify imprinted genes [18], [19]. Using the available trio data we could infer the parental origin of the alleles of rs2471083 and rs3092611 in 33 (9 maternal T alleles, 24 paternal T alleles) and 24 (16 maternal T alleles, 8 paternal T alleles) individuals respectively (Table S7). We performed between 2 and 10 technical replicates per individual (mean of 7.75) and samples with high coefficient of variation (>5%) were discarded in order to ensure robustness. After quality control, 124 expression values from 23 (mat:pat = 4∶19) samples for KCNK9 and 240 expression values from 24 (mat:pat = 16∶8) for SLC2A10 were available for analysis. We fitted a linear mixed model to test for association between expression levels (Ct values) and allelic origin. The paternal T allele of rs2471083 was associated with lower KCNK9 expression levels (+1.08 [SD unit] Ct values, P = 0.0096), and the paternal T allele of rs3092611 was associated with higher SLC2A10 expression values (−1.09 [SD unit] Ct values, P = 0.0023). To ensure there was no systematic bias in our experiments giving rise to spurious POE associations we repeated the qPCR experiments for two housekeeping genes GAPDH and HRPT1. Both analyses gave non-significant POE P-values (P>0.3).

Methylation lookups

POEs can be driven by differences between inherited paternal and maternal methylation. To explore whether the observed parent-of-origin effects at our discovered SNPs were driven by differential methylation we tested whether methylation in the regions (Chr8: 140.45–140.65 Mb and Chr20: 45.3–45.55 Mb) was (i) associated with the two respective SNPs (rs2471083, rs3091869) in 262 unrelated individuals from the TwinsUK cohort and (ii) associated with BMI in two independent cohorts: 79 BMI discordant (difference >0.5 SD) monozygotic twin pairs from the TwinsUK cohort and a sample of 412 unrelated individuals from the EPIC-Italy cohort. None of these analyses showed significant association (see Supplemental Data S1, Figures S2, S3 and Table S8 for further details).

Discussion

Our novel approach revealed two SNPs, located near the genes KCNK9 and SLC2A10, influencing BMI in a parent-of-origin specific fashion. These loci were the first and fourth most significant genome-wide in our new POE test for unrelated individuals and both showed significant parent-of-origin effects in family studies. Both SNPs exhibit polar overdominance, where homozygous individuals have equal (baseline) phenotypes and heterozygous genotypes confer relative risk/protection, depending on the parental origin. Polar overdominance, has been observed in humans for type2 diabetes [1] and BMI [20], however it is very rare and its molecular mechanism is unknown.

RT-PCR experiments revealed that gene expression levels of KCNK9 and SLC2A10 in LCLs were also influenced in a parent-of-origin manner. The expression of these genes is highest in the brain (although it is also expressed in testis, liver, colon, adrenal gland and kidney; see http://www.genecards.org/) indicating a potential neuronal involvement. Expression levels of KCNK9 and SLC2A10 in living brain cells might have been more informative and robust, however, such information is not available. The applied qPCR method was optimised to ensure that the expression levels measured in LCLs were representative only of the target transcript and amplification efficiency was assessed to be sensitive enough to allow the detection of even small changes in gene expression. Interestingly, rs2471083 alleles, regardless of their parental origin, show marginally significant association (P = 0.03) with KCNK9 expression levels in the hippocampus (http://www.broadinstitute.org/gtex/). Our methylation analyses did not reveal any evidence that the POEs were driven by differences in inherited paternal and maternal methylation. Neither of our two SNPs tag common copy number variants (CNVs) (based on the CNV reference data used in Heid et al. [21]) and we found only one sample (out of 14,315 available in-house, whose BMI Z-score was +1.18) with a 76 kb deletion overlapping rs2471083. Hence, the effect of the two discovered SNPs are unlikely to be driven by CNVs. To check whether the two confirmed SNPs (rs3091869, rs2471083), or SNPs in LD (10 with r2>0.8 in 1000 Genomes EUR population), show regulatory activity, we queried RegulomeDB (http://regulome.stanford.edu). None of these SNPs were annotated to have more than minimal binding evidence (RegulomeDB score below 4).

A previous study proposed to detect POE in inbred F2 mice by a two-component mixture distribution fitting of the heterozygous genotype group and further two components for the homozygous groups [22]. This method requires a parametric distribution of the phenotype to be assumed, small violations of this assumption can result in heavily biased parameter estimates. The method we chose is more robust to a wide range of phenotype distributions (due to the underlying Brown-Forsythe test employed), computationally faster (making it attractive for testing millions of SNPs) and applicable to probabilistic genotype calls. Our POE test for unrelated GWAS samples is similar to a test proposed to detect gene-environment interactions [23] in that it exploits differences in phenotypic variance to detect a phenomenon not directly measured. Inflated phenotypic variance in the heterozygous group might also be the result of other phenomenon: (i) a phenotype altering effect (be it genetic or environmental) acting only on the heterozygous group; (ii) an overdominant effect combined with a genetic or environmental interaction or non-linear, monotonic phenotype transformation that has different derivatives for low and high trait values; (iii) a large marginal additive effect combined with a (monotonic) transformation for which the second derivative is maximised at the mean phenotype value of the heterozygous group (see Materials and Methods for details). More generally, the combination of the scale on which the phenotype is measured and a strong marginal association with an allelic dosage may give rise to spurious associations using variance tests [24]. Recently some evidence has emerged about loci which effect the variance of phenotypes (through impacting environmental plasticity, canalization, developmental stability, etc.) that can be detected via association with phenotypic variability [25]. Therefore, the top hits obtained by our POE test may need further prioritisation before proceeding to trio-based confirmation. We recommend the following checks: (a) Exclude SNPs with overdominant effects; (b) For SNPs with low POE P-value, test gene-environment (GxE) interaction (as done in [23]) via modelling phenotypic variance as a function of the genotype dosage (coded in additive, recessive or dominant fashion). If this test is more significant than the POE test, it is probably a GxE that is driving the POE association and also as a side effect we will observe significant difference in the variance between the two homozygous groups. (c) If a SNP with low POE P-value has marginal effect on the trait, repeat the POE test for various transformed versions of the phenotype such as log and inverse-normal quantile. If the resulting POE P-values are not robust, give lower priority to the examined SNP.

For our confirmed SNPs multiple lines of evidence show that the parent-of-origin effects are real, most convincingly clear replication in independent family data of parent-of-origin associations of the hit SNPs with both BMI and gene expression levels. Further, the GWAS discovery associations are very unlikely to be artefacts of the factors discussed above: (i) there is no evidence of overdominant, additive, recessive or dominant effects (the mean BMI values are near identical in the three genotype groups), hence the signals cannot be driven by gene-environment interactions or be an artefact of the scale on which the phenotype is measured (ii) no SNP within 500 kb has any detectable marginal effect on BMI thus the association cannot be driven by haplotype-specific marginal effects [26]; (iii) the phenotypic variances in the two homozygous groups, are almost identical (rs2471083: , , and rs3091869: , , ); (iv) POE test with log- and inverse-normal quantile transformed BMI values resulted in similar results (Table S6), further reducing the likelihood of an artefact resulting from the scale on which the phenotype is measured [24].

Some of the negative results of the other SNPs carried forward to the replication phase in the family data could be explained by lack of power. The power to replicate POE associations in family-based studies is dependent on the available number of heterozygous individuals (for details see Supplemental Data S1) and thus increases with minor allele frequency (MAF). Therefore, it is unsurprising that the two SNPs which replicated had relatively high MAF (>27%).

Linkage studies have identified four regions exerting POE on BMI (10p12, 12q24, 13q32) [5] and 2q31 [27]). We looked up SNPs in these regions in our genome-wide discovery POE association results. The reported linkage regions showed enrichment for lower than expected POE P-values (see Figure S4 for regional QQ-plots), however, no SNPs survived Bonferroni correction. We also tried to replicate a SNP in exon 5 of DLK1 (rs1802710) because this SNP showed polar overdominance for obesity in children [20], but only a very slight trend (P = 0.32) was visible in our study. Previously reported BMI-associated loci [10] show some enrichment for lower POE P-values (Supplemental Data S1, Tables S9, S10 and Figure S5), however these need to be replicated in family studies.

Previous work comparing strength of associations of mother-offspring BMI with father-offspring BMI did not reveal intrauterine influence on obesity in children [28]. A similar conclusion was reached in a systematic review of seven studies [29], while stronger maternal influence was observed in a recent longitudinal study [30]. The difference in conclusions may be due to that fact that the former studies included predominantly older children than the longitudinal study (0–3.5 years). At early age the diet of the offspring may be more similar to that of the mother than the father (e.g. due to breastfeeding), which might have contributed to the higher mother-offspring BMI similarity found by Linabery et al. [30].

In summary, our findings indicate that POEs may play a role in adult obesity. The two identified SNPs have strong parent-of-origin effect on BMI, close to that of the FTO, contributing substantially to the heritability of BMI. Our follow-up experiments demonstrated parent-of-origin specific gene expression modulation, but failed to link methylation activity of these loci to BMI values. Inevitably for newly discovered loci, further studies are warranted to determine how these variations functionally influence obesity in humans. The reliance of our approach on difference in phenotypic variance means that it cannot be extended to binary outcomes. Since there are other phenomena which can give rise to significant POE association, we recommend that top hits from our method are followed up in family studies, where parental origin of alleles can be inferred. In addition, our variance based POE test for GWAS data is naturally much less powerful than actually testing the mean values of the two heterozygous subgroups in trios. However, GWASs of unrelated individuals are several-fold more numerous and typically much larger than studies with a trio design, hence our methodology provides a great advance in parent-of-origin research by providing means to exploit all available GWAS data of unrelated individuals in order to identify parent-of-origin effects on continuous phenotypes.

Materials and Methods

Ethics statement

All participating studies were approved by the respective institutional Ethics Committees. All study participants gave written consent including for genetic studies.

Detecting parent of origin effects

If we denote the alleles of a bi-allelic SNP by “A” (reference) and “B” (alternative) the possible genotypes are A/A, A/B and B/B. Standard GWASs estimate the effect of the alternative allele dosage on the phenotype in question. In this work we are interested in associations in which a phenotype (y) is influenced by the alleles of a particular SNP and the effect depends on the parental origin of these alleles. In the presence of a parent-of-origin effect the heterozygous genotype group is split into two subgroups, depending on the parental origin of the A and B alleles. We assume that the phenotype of any individual in the A/A genotype group is modelled by , where is the mean and is an individual level error with mean zero and variance . If the maternal and paternal effects of the B allele are and, it follows that the phenotype of an individual in the B/B group is and its variance is . (Note that as a consequence the maternal and paternal effects of the A allele are and .) Here we assume is constant across genotype groups (A/A, A/B and B/B) and and are fixed effects. The effects of violations of these assumptions are covered in the discussion. The phenotype in the heterozygous group is a 50%–50% mixture of two distributions (Fig 1a): where is a Bernoulli random variable (with parameter ½), taking values if the B allele is inherited from the mother and if inherited from the father. The heterozygous phenotype distribution can be simplified to Since and are independent random variables, the phenotypic variance of the heterozygous genotype group is

If a parent-of-origin effect is present andare different, thus is larger than the variance observed in the homozygous groups () (Figure 1). Therefore, although in regular GWAS data we cannot identify the two subgroups within A/B genotypes, we can detect POE via increased phenotypic variance in the heterozygous group relative to the homozygous groups.

In the presence of a marginal association a phenotype transformation could alter the genotype group variances and introduce bias into the test [24]. For this reason we analysed untransformed age-, age2-corrected BMI values (normalised to have zero mean and unit variance) separately for men and women. Standard variance tests (such as the F-test) are, however, sensitive to deviations from the Gaussian distribution.

Therefore, we used a robust version of the Brown-Forsythe test. Briefly, we first centred the phenotype values (at zero) in each genotype group to avoid inflated variance in the presence of marginal effects in the group of all homozygote individuals. We denote these centred phenotypes by , where

Here stands for the genotype of individual , and represents the median phenotype value in genotype group , where can take the values of AA, AB or BB. We then regress the absolute deviations from the median onto a 0–1 coded genotype group identifier (1 for heterozygous and 0 for homozygous individuals) in order to estimate the POE effect size [31]. This regression result in a slope estimatewhere and . The corresponding standard error iswhere

Finally, the POE P-value is assigned based on the test statistic . The test was extended to imputed genotype probabilities and implemented in the latest version (v0.98) of the Quicktest software (http://www3.unil.ch/wpmu/sgg/quicktest/). The robustness of this test to deviations from normality has been studied in [32] and its power in [31].

SNP selection strategy

We applied our POE test genome-wide to all HapMap imputed markers in a set of cohorts and results were combined across cohorts using fixed-effect inverse-variance weighting meta-analysis. SNPs were selected for replication if they met at least one of the following two criteria: (1) POE P-value <5×10−6 or (2) POE P-value <5×10−4 and within 500 kb of previously reported imprinted regions according to the Catalogue of Parent of Origin Effects database (http://igc.otago.ac.nz/home.html). At loci which met either criteria, a lead SNP (with the strongest POE association) was identified; other markers within 1 Mb or in LD (r2>0.1) were excluded from further investigations. In total 2,673,768 HapMap imputed and genotyped SNPs were analysed, of which 29,457 were considered as lying in imprinted regions, criterion (2). Using the procedure of Gao et al. [33] we estimated the effective number of tests considered by each criterion to be ∼1,000,000 and 6,100 respectively, justifying the ∼100 fold drop in the P-value threshold applied to the second criterion.

Testing in family-based studies

We tested our findings in family-based studies using a simplified parental asymmetry test [34] (PAT). For each target SNP, in each family we searched for trios (or parent-offspring pairs) with heterozygous offspring and determined the parent of origin of the alleles (whenever possible, i.e. at least one homozygous parent). From each family at most one heterozygous offspring with known parental origin was then collected and grouped according to the parental origin of the alleles. Note that although POE is acting in every genotype group, it can only be detected in the heterozygous group.

As at the discovery phase, we used sex-, age- and age2-corrected BMI residuals as phenotype. The equality of phenotypic means in the two groups was tested using a Student t-test. When significant differences were detected we also estimated the difference between paternal and maternal effect sizes, which is simply the difference between the phenotype averages in the paternal- and maternal- groups.

Effect size estimation

In order to estimate paternal ) and maternal () effect sizes it is sufficient to know their mean and their difference . The difference between paternal and maternal effect alleles can also be derived from GWAS of unrelated individuals. It is easy to see that the test statistic defined asgives an unbiased estimate of . Since , the variance of T is . Therefore, the absolute difference in paternal and maternal effects () can be estimated if the phenotypic variances in the three genotype groups are known. However, these estimates will be strongly subject to the winner's curse [35], thus we used the family studies to derive more reliable estimates of . To reduce the effect of differences in the distribution of BMI between the family-based studies, we meta-analysed the difference estimates from each study in order to obtain a combined estimate of . The average of the maternal- and paternal effects, , is the association effect size using a simple additive genetic model, which can be most accurately estimated from the largest-to-date meta-analytic study on BMI [10] (including ∼250,000 individuals).

Effect of phenotype transformation in case of marginal association

If there is an additive marginal genetic effect influencing the trait certain transformations may inflate the phenotypic variance of the heterozygous group. Let be the phenotypic mean in the heterozygous group and the marginal effect of the SNP (on the original scale). Let denote an S-shaped transformation function of the form that is applied to the trait.

In the following we show that for any value arbitrarily large phenotypic variance inflation can be achieved in the heterozygous group, compared to the two homozygous groups by an appropriate parameter choice for . Using a second order Taylor expansion the variance of the transformed phenotype in the heterozygous group can be estimated by

If we assume the phenotype follows a Gaussian distribution then, simplifies to and thus

Without loss of generality one can assume that . The variance in AA genotype group can be estimated similarly and thus

Using the special form of , the variance difference can be expressed asand since and

It is easy to see that for a fixed

As , faster than , thus for any effect size we can find a transformation function such that the variance inflation of the heterozygous group exceeds any arbitrary threshold.

Cell lines, nucleic acids isolation, sequencing and qPCR

Lymphoblastoid cell lines were derived from peripheral blood leukocytes of 95 members of 11 CEPH families [36] (#102, #884, #1333, #1340, #1341, #1345, #1346, #1347, #1362, #1408, #13292). They were purchased from the Coriell Cell Repository (http://ccr.coriell.org/), and cultured as previously described [37]. DNA was extracted by using the QIAamp DNA Mini kit (QIAGEN), and RNA by using the RNeasy Mini kit (QIAGEN), according to the manufacturer's instructions. Primer sequences were designed to amplify a 328-bp region on chromosome 8 that spans the rs2471083 polymorphism (forward primer: 5′-ACCACAGAAGTCAGTAGACGAG-3′; reverse primer: 5′- GTGACATTGGGAGCATGGGA-3′) and a 146-bp region on chromosome 20 that spans the rs3092611 polymorphism (forward primer: 5′-GCCACCAGTGGTCTGATAGT-3′; reverse primer: 5′- TAACTCGTCATTCTGCCCTGG -3′). PCR amplification was performed in a 25 µl reaction using GoTaq polymerase (Promega). After purification of PCR products (ExoSAP-IT, USB), sequencing reactions were carried out by using 1 µl of each of the 3.2 µM sequencing primers and 0.5 µl of BigDye Terminator v1.1 (Applied Biosystems). Following on-column purification (EdgeBio), sequencing products were run on an ABI-3130 XLS sequencer (Applied Biosystem). To synthesize cDNA, 2 µg of total RNA was retrotranscribed using the Superscript III reverse transcriptase (Invitrogen/Life Technologies) according to the manufacturer's instructions and a mix of random hexamers and oligo-dT that facilitate the detection of poorly expressed genes. To validate primers for qPCR, we first performed a series of test amplifications by using a defined range of primer concentrations (50–200 nM). We then loaded 10 µl of each qPCR product on 1% agarose gels to check the specificity of the amplification product, which should correspond to a 113-bp (KCNK9) and 148-bp (SLC2A10) fragment. To test KCNK9 and SLC2A10 PCR efficiency a standard curve made of five serial dilutions of brain and lung cDNA were used, respectively, since the two genes are known to be highly expressed in these organs. We obtained a standard curve slope of −3.49 for KCNK9 and of −3.37 for SLC2A10, corresponding to 94% and 98% PCR efficiency. For more details see Supplemental Data S1.

Comparing Ct values

The output of the analysis was threshold cycles (Ct), i.e. the number of cycles at which the fluorescent signal of the reaction crosses a pre-determined threshold value. Since standard quantification methods (including normalization by housekeeping genes) introduce a considerable amount of experimental noise for very lowly expressed genes, raw Ct values were used to perform an absolute quantification of KCNK9 and SLC2A10 transcripts. As negative controls, housekeeping genes (HPRT1, GAPDH) were also tested for parent-origin-effect to exclude the possibility that the observed difference in KCNK9 and SLC2A10 expression levels was due to the sample preparation process. Raw Ct values were inverse-normal quantile transformed and a linear mixed model was fitted (using the R function lmer) modelling the technical replicates as random effects and parental origin as a fixed effect.

Supporting Information

Figure S1.

QQ-plot of the POE test P-values for SNPs in imprinted regions (left) and for the whole genome (right).

doi:10.1371/journal.pgen.1004508.s001

(PNG)

Figure S2.

Left hand side plots describe SNP-methylation associations (mQTLs), where each point is a methylation probe. X-axis represents their physical position and y-axis the −log10 association P-value with the target SNP, whose location is indicated by the dashed line. Note that rs3092611 was used as a proxy for rs3091869 (r2 = 0.998). The corresponding QQ-plots appear on the right hand side. Neighbouring methylation probes are strongly correlated therefore expected P-values were computed by estimating the effective number of tests For expected P-values we computed the effective number of tests [33].

doi:10.1371/journal.pgen.1004508.s002

(PNG)

Figure S3.

Left hand side plots describe methylation associations with BMI in MZ twins. Each point is a methylation probe, X-axis represents their physical position and y-axis the −log10 association P-value with BMI. Location of the target SNP is indicated by the dashed line. Note that rs3092611 was used as a proxy for rs3091869 (r2 = 0.998). The corresponding QQ-plots appear on the right hand side. Neighbouring methylation probes are strongly correlated therefore expected P-values were computed by estimating the effective number of tests For expected P-values we computed the effective number of tests [33].

doi:10.1371/journal.pgen.1004508.s003

(PNG)

Figure S4.

POE association results for previously reported imprinted BMI linkage regions. Second dashed line corresponds to the Benjamini-Hochberg 5% FDR threshold.

doi:10.1371/journal.pgen.1004508.s004

(PNG)

Figure S5.

POE association P-value QQ-plot for the top 58 independent SNPs with marginal BMI-association P-value <10−5 in Speliotes et al. [10].

doi:10.1371/journal.pgen.1004508.s005

(PNG)

Table S1.

Description of the BMI distribution in the participating cohorts.

doi:10.1371/journal.pgen.1004508.s006

(XLSX)

Table S2.

Brief summary of the participating cohorts.

doi:10.1371/journal.pgen.1004508.s007

(XLSX)

Table S3.

Information on the genotyping methods in the participating cohorts.

doi:10.1371/journal.pgen.1004508.s008

(XLSX)

Table S4.

Replication of the 6 discovery SNPs in family studies. Extended version of Table 2.

doi:10.1371/journal.pgen.1004508.s009

(XLSX)

Table S5.

Parental asymmetry test results for our 6 candidate SNPs in adolescent population.

doi:10.1371/journal.pgen.1004508.s010

(XLSX)

Table S6.

Analysis of the effect of gender- and age-correction and phenotype transformations on the POE association results.

doi:10.1371/journal.pgen.1004508.s011

(XLSX)

Table S7.

Genotyping results and parental allele determination for members of the CEPH families.

doi:10.1371/journal.pgen.1004508.s012

(XLSX)

Table S8.

Association results between methylation- and BMI- differences among MZ twins of the TwinsUK study.

doi:10.1371/journal.pgen.1004508.s013

(XLSX)

Table S9.

POE association P-values for the 32 SNPs associated with BMI in the largest-to-date meta-analysis [10].

doi:10.1371/journal.pgen.1004508.s014

(XLSX)

Table S10.

POE association P-values for the top 58 independent SNPs with BMI-association P-value <10−5 in the largest-to-date meta-analysis [10].

doi:10.1371/journal.pgen.1004508.s015

(XLSX)

Data S1.

Supporting information contain text on the expression- and methylation analysis, the effective sample size derivation in mother-offspring vs trio studies, POE look-ups for SNPs with marginal BMI association, study descriptions and acknowledgements.

doi:10.1371/journal.pgen.1004508.s016

(DOCX)

Acknowledgments

A full list of acknowledgments can be found in the Supporting Information. We would like to thank Rosanna Pescini-Gobert, for help with the qPCR experiments establishing KCNK9 and SLC2A10 expressions. Special thanks to Gerard Weber, Vincent Mooser and Martin Preisig for their kind contribution on behalf of the CoLaus study.

Members of the Scientific Board of the LifeLines Cohort Study

P de Bakker, U Bültmann, M Geleijnse, P v.d. Harst, G Koppelman, J G.M. Rosmalen, L van Rossum, H Smidt, M A. Swertz, R P. Stolk

Collaborators: Alizadeh B, de Boer R, Boezen HM, Bruinenberg M, Franke L, van der Harst P, Hillege H, van der Klauw M, Navis G, Ormel J, Postma D, Rosmalen J, Slaets J, Snieder H, Stolk R, Wolffenbuttel B, Wijmenga C.

Members of the Scientific Committee of the Generation Scotland Study

Jonathan Berg, Douglas Blackwood, Harry Campbell, Jonathan Cavanagh, John Connell, Mike Connor, Sarah Cunningham-Burley, Ian Deary, Anna Dominiczak, Paul Ellis, Bridie FitzPatrick, Ian Ford, Rena Gertz, Antonio Grau, Gill Haddow, Cathy Jackson, Shona Kerr, Robbie Lindsay, Mark McGilchrist, Donald McIntyre, Andrew Morris, Robin Morton, Walter Muir, Graeme Murray, Colin Palmer, Jill Pell, Alastair Philp, David Porteous, Mary Porteous, Rob Procter, Stuart Ralston, David Reid, Richard Sinnott, Blair Smith, David St Clair, Frank Sullivan, Mary Sweetland, Jenny Ure, Graham Watt, Roland Wolf, Alan Wright

Members of the Genetic Investigation of ANthropometric Traits (GIANT) Consortium

Sonja I. Berndt, Stefan Gustafsson, Reedik Mägi, Andrea Ganna, Eleanor Wheeler, Mary F. Feitosa, Anne E. Justice, Keri L. Monda, Damien C. Croteau- Chonka, Felix R. Day, Tonu Esko, Tove Fall, Teresa Ferreira, Davide Gentilini, Anne U. Jackson, Jian'an Luan, Joshua C. Randall, Sailaja Vedantam, Cristen J. Willer, Thomas W. Winkler, Andrew R. Wood, Tsegaselassie Workalemahu, Yi-Juan Hu, Sang Hong Lee, Liming Liang, Dan-Yu Lin, Josine L. Min, Benjamin M. Neale, Gudmar Thorleifsson, Jian Yang, Eva Albrecht, Najaf Amin, Jennifer L. Bragg-Gresham, Gemma Cadby, Martin den Heijer, Niina Eklund, Krista Fischer, Anuj Goel, Jouke-Jan Hottenga, Jennifer E. Huffman, Ivonne Jarick, Asa Johansson, Toby Johnson, Stavroula Kanoni, Marcus E. Kleber, Inke R. König, Kati Kristiansson, Zoltán Kutalik, Claudia Lamina, Cecile Lecoeur, Guo Li, Massimo Mangino, Wendy L. McArdle, Carolina Medina-Gomez, Martina Müller-Nurasyid, Julius S. Ngwa, Ilja M. Nolte, Lavinia Paternoster, Sonali Pechlivanis, Markus Perola, Marjolein J. Peters, Michael Preuss, Lynda M. Rose, Jianxin Shi, Dmitry Shungin, Albert Vernon Smith, Rona J. Strawbridge, Ida Surakka, Alexander Teumer, Mieke D. Trip, Jonathan Tyrer, Jana V. Van Vliet-Ostaptchouk, Liesbeth Vandenput, Lindsay L. Waite, Jing Hua Zhao, Devin Absher, Folkert W. Asselbergs, Mustafa Atalay, Antony P. Attwood, Anthony J. Balmforth, Hanneke Basart, John Beilby, Lori L. Bonnycastle, Paolo Brambilla, Marcel Bruinenberg, Harry Campbell, Daniel I. Chasman, Peter S. Chines, Francis S. Collins, John M. Connell, William Cookson, Ulf de Faire, Femmie de Vegt, Mariano Dei, Maria Dimitriou, Sarah Edkins, Karol Estrada, David M. Evans, Martin Farrall, Marco M. Ferrario, Jean Ferrières, Lude Franke, Francesca Frau, Pablo V. Gejman, Harald Grallert, Henrik Grönberg, Vilmundur Gudnason, Alistair S. Hall, Per Hall, Anna-Liisa Hartikainen, Caroline Hayward, Nancy L. Heard-Costa, Andrew C. Heath, Johannes Hebebrand, Georg Homuth, Frank B. Hu, Sarah E. Hunt, Elina Hyppönen, Carlos Iribarren, Kevin B. Jacobs, John-Olov Jansson, Antti Jula, Mika Kähönen, Sekar Kathiresan, Frank Kee, Kay-Tee Khaw, Mika Kivimaki, Wolfgang Koenig, Aldi T. Kraja, Meena Kumari, KariKuulasmaa, Johanna Kuusisto, Jaana H. Laitinen, Timo A. Lakka, Claudia Langenberg, Lenore J. Launer, Lars Lind, Jaana Lindström, Jianjun Liu, Antonio Liuzzi, Marja-Liisa Lokki, Mattias Lorentzon, Pamela A. Madden,Patrik K. Magnusson, Paolo Manunta, Diana Marek, Winfried März, Irene Mateo Leach, Barbara McKnight, Sarah E. Medland, Evelin Mihailov, Lili Milani, Grant W. Montgomery, Vincent Mooser, Thomas W. Mühleisen, Patricia B. Munroe, Arthur W. Musk, Narisu Narisu, Gerjan Navis, George Nicholson, Ellen A. Nohr, Ken K. Ong, Ben A. Oostra, Colin N.A. Palmer, Aarno Palotie, John F. Peden, Nancy Pedersen, Annette Peters, Ozren Polasek, Anneli Pouta, Peter P. Pramstaller, Inga Prokopenko, Carolin Pütter, Aparna Radhakrishnan, Olli Raitakari, Augusto Rendon, Fernando Rivadeneira, Igor Rudan, Timo E. Saaristo, Jennifer G. Sambrook, Alan R. Sanders, Serena Sanna, Jouko Saramies, Sabine Schipf, Stefan Schreiber, Heribert Schunkert, So-Youn Shin, Stefano Signorini, Juha Sinisalo, Boris Skrobek, Nicole Soranzo, Alena Stancakova, Klaus Stark, Jonathan C. Stephens, Kathleen Stirrups, Ronald P. Stolk, Michael Stumvoll, Amy J. Swift, Eirini V. Theodoraki, Barbara Thorand, David-Alexandre Tregouet, Elena Tremoli, Melanie M. Van der Klauw, Joyce B.J. van Meurs, Sita H. Vermeulen, Jorma Viikari, Jarmo Virtamo, Veronique Vitart, Gérard Waeber, Zhaoming Wang, Elisabeth Widen, Sarah H. Wild, Gonneke Willemsen, Bernhard R. Winkelmann, Jacqueline C.M. Witteman, Bruce H.R. Wolffenbuttel, Andrew Wong, Alan F. Wright, M. Carola Zillikens, Philippe Amouyel, Bernhard O. Boehm, Eric Boerwinkle, Dorret I. Boomsma, Mark J. Caulfield, Stephen J. Chanock, L. Adrienne Cupples, Daniele Cusi, George V. Dedoussis, Jeanette Erdmann, Johan G. Eriksson, Paul W. Franks, Philippe Froguel, Christian Gieger, Ulf Gyllensten, Anders Hamsten, Tamara B. Harris, Christian Hengstenberg, Andrew A. Hicks, Aroon Hingorani, Anke Hinney, Albert Hofman, Kees G. Hovingh, Kristian Hveem, Thomas Illig, Marjo-Riitta Jarvelin, Karl-Heinz Jöckel, Sirkka M. Keinanen-Kiukaanniemi, Lambertus A. Kiemeney, Diana Kuh, Markku Laakso, Terho Lehtimäki, Douglas F. Levinson, Nicholas G. Martin, Andres Metspalu, Andrew D. Morris, Markku S. Nieminen, Inger Njølstad, Claes Ohlsson, Albertine J. Oldehinkel, Willem H. Ouwehand, Lyle J. Palmer, Brenda Penninx, Chris Power, Michael A. Province, Bruce M. Psaty, Lu Qi, Rainer Rauramaa, Paul M. Ridker, Samuli Ripatti, Veikko Salomaa, Nilesh J. Samani, Harold Snieder, Thorkild I.A. Sørensen, Timothy D. Spector, Kari Stefansson, Anke Tönjes, Jaakko Tuomilehto, André G. Uitterlinden, Matti Uusitupa, Pim van der Harst, Peter Vollenweider, Henri Wallaschofski, Nicholas J. Wareham, Hugh Watkins, H.-Erich Wichmann, James F.Wilson, Goncalo R. Abecasis, Themistocles L. Assimes, Ines Barroso, Michael Boehnke, Ingrid B. Borecki, Panos Deloukas, Caroline S. Fox, Timothy Frayling, Leif C. Groop, Talin Haritunian, Iris M. Heid, David Hunter, Robert C. Kaplan, Fredrik Karpe, MiriamMoffatt, Karen L. Mohlke, Jeffrey R. O'Connell, Yudi Pawitan, Eric E. Schadt, David Schlessinger, Valgerdur Steinthorsdottir, David P. Strachan, Unnur Thorsteinsdottir, Cornelia M. van Duijn, Peter M. Visscher, Anna Maria Di Blasio, Joel N. Hirschhorn, Cecilia M. Lindgren, Andrew P. Morris, David Meyre, André Scherag, Mark I. McCarthy, Elizabeth K. Speliotes, Kari E. North, Ruth J.F. Loos, Erik Ingelsson

Author Contributions

Conceived and designed the experiments: CJH JCC NJW JSK JNH CR RJFL ZK. Performed the experiments: GV GA GBE BB JCC JSK. Analyzed the data: CJH GV MM FG JHZ AT TWW NT JL EM GBE WZ DL TE AMa SR PYB BB DME CH MFL LF AR SV GF SG JPK GM SB MT MBo IBB VR JNH CR ZK. Contributed reagents/materials/analysis tools: GBE MBa YD CH ES DEA EB JCC HG GH JEH DP DM AI GJL VA MHH NGM RPA JS FN COS RAS HV WY JTB AC JSK AP HW JBW MT NDH DC TMF GDS IBB CR IMH HG JH GWM TDS KS NJW FP PV JSB AMe MRJ AS RJFL. Wrote the paper: CJH FG ZK.

References

  1. 1. Kong A, Steinthorsdottir V, Masson G, Thorleifsson G, Sulem P, et al. (2009) Parental origin of sequence variants associated with complex diseases. Nature 462: 868–874.
  2. 2. Rampersaud E, Mitchell BD, Naj AC, Pollin TI (2008) Investigating parent of origin effects in studies of type 2 diabetes and obesity. Curr Diabetes Rev 4: 329–339. doi: 10.2174/157339908786241179
  3. 3. Lawson HA, Cheverud JM, Wolf JB (2013) Genomic imprinting and parent-of-origin effects on complex traits. Nat Rev Genet 14: 609–617. doi: 10.1038/nrg3543
  4. 4. Guilmatre A, Sharp AJ (2012) Parent of origin effects. Clin Genet 81: 201–209. doi: 10.1111/j.1399-0004.2011.01790.x
  5. 5. Dong C, Li WD, Geller F, Lei L, Li D, et al. (2005) Possible genomic imprinting of three human obesity-related genetic loci. Am J Hum Genet 76: 427–437. doi: 10.1086/428438
  6. 6. Lindsay RS, Kobes S, Knowler WC, Bennett PH, Hanson RL (2001) Genome-wide linkage analysis assessing parent-of-origin effects in the inheritance of type 2 diabetes and BMI in Pima Indians. Diabetes 50: 2850–2857. doi: 10.2337/diabetes.50.12.2850
  7. 7. Paterson AD, Petronis A (1999) Sex-based linkage analysis of alcoholism. Genet Epidemiol 17 Suppl 1S289–294. doi: 10.1002/gepi.1370170749
  8. 8. Wyszynski DF, Panhuysen CI (1999) Parental sex effect in families with alcoholism. Genet Epidemiol 17 Suppl 1S409–413. doi: 10.1002/gepi.1370170769
  9. 9. Strauch K, Furst R, Ruschendorf F, Windemuth C, Dietter J, et al. (2005) Linkage analysis of alcohol dependence using MOD scores. BMC Genet 6 Suppl 1S162. doi: 10.1186/1471-2156-6-s1-s162
  10. 10. Speliotes EK, Willer CJ, Berndt SI, Monda KL, Thorleifsson G, et al. (2010) Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. Nat Genet 42: 937–948.
  11. 11. Barel O, Shalev SA, Ofir R, Cohen A, Zlotogora J, et al. (2008) Maternally inherited Birk Barel mental retardation dysmorphism syndrome caused by a mutation in the genomically imprinted potassium channel KCNK9. Am J Hum Genet 83: 193–199. doi: 10.1016/j.ajhg.2008.07.010
  12. 12. Qi L, Menzaghi C, Salvemini L, De Bonis C, Trischitta V, et al. (2011) Novel locus FER is associated with serum HMW adiponectin levels. Diabetes 60: 2197–2201. doi: 10.2337/db10-1645
  13. 13. Jung J, Barrett PQ, Eckert GJ, Edenberg HJ, Xuei X, et al. (2012) Variations in the potassium channel genes KCNK3 and KCNK9 in relation to blood pressure and aldosterone production: an exploratory study. J Clin Endocrinol Metab 97: E2160–2167. doi: 10.1210/jc.2012-2196
  14. 14. Pang DS, Robledo CJ, Carr DR, Gent TC, Vyssotski AL, et al. (2009) An unexpected role for TASK-3 potassium channels in network oscillations with implications for sleep mechanisms and anesthetic action. Proc Natl Acad Sci U S A 106: 17546–17551. doi: 10.1073/pnas.0907228106
  15. 15. Linden AM, Sandu C, Aller MI, Vekovischeva OY, Rosenberg PH, et al. (2007) TASK-3 knockout mice exhibit exaggerated nocturnal activity, impairments in cognitive functions, and reduced sensitivity to inhalation anesthetics. J Pharmacol Exp Ther 323: 924–934. doi: 10.1124/jpet.107.129544
  16. 16. Lowe JK, Maller JB, Pe'er I, Neale BM, Salit J, et al. (2009) Genome-wide association studies in an isolated founder population from the Pacific Island of Kosrae. PLoS Genet 5: e1000365. doi: 10.1371/journal.pgen.1000365
  17. 17. Jarick I, Vogel CI, Scherag S, Schafer H, Hebebrand J, et al. (2011) Novel common copy number variation for early onset extreme obesity on chromosome 11q11 identified by a genome-wide analysis. Hum Mol Genet 20: 840–852. doi: 10.1093/hmg/ddq518
  18. 18. Morcos L, Ge B, Koka V, Lam KC, Pokholok DK, et al. (2011) Genome-wide assessment of imprinted expression in human cells. Genome Biol 12: R25. doi: 10.1186/gb-2011-12-3-r25
  19. 19. Pollard KS, Serre D, Wang X, Tao H, Grundberg E, et al. (2008) A genome-wide approach to identifying novel-imprinted genes. Hum Genet 122: 625–634. doi: 10.1007/s00439-007-0440-1
  20. 20. Wermter AK, Scherag A, Meyre D, Reichwald K, Durand E, et al. (2008) Preferential reciprocal transfer of paternal/maternal DLK1 alleles to obese children: first evidence of polar overdominance in humans. Eur J Hum Genet 16: 1126–1134. doi: 10.1038/ejhg.2008.64
  21. 21. Heid IM, Jackson AU, Randall JC, Winkler TW, Qi L, et al. (2010) Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. Nat Genet 42: 949–960.
  22. 22. Cui Y, Lu Q, Cheverud JM, Littell RC, Wu R (2006) Model for mapping imprinted quantitative trait loci in an inbred F2 design. Genomics 87: 543–551. doi: 10.1016/j.ygeno.2005.11.021
  23. 23. Yang J, Loos RJ, Powell JE, Medland SE, Speliotes EK, et al.. (2012) FTO genotype is associated with phenotypic variability of body mass index. Nature.
  24. 24. Sun X, Elston R, Morris N, Zhu X (2013) What Is the Significance of Difference in Phenotypic Variability across SNP Genotypes? Am J Hum Genet 93: 390–397. doi: 10.1016/j.ajhg.2013.06.017
  25. 25. Shen X, Pettersson M, Ronnegard L, Carlborg O (2012) Inheritance beyond plain heritability: variance-controlling genes in Arabidopsis thaliana. PLoS Genet 8: e1002839. doi: 10.1371/journal.pgen.1002839
  26. 26. Shibata K, Diatchenko L, Zaykin DV (2009) Haplotype associations with quantitative traits in the presence of complex multilocus and heterogeneous effects. Genet Epidemiol 33: 63–78. doi: 10.1002/gepi.20358
  27. 27. Guo YF, Shen H, Liu YJ, Wang W, Xiong DH, et al. (2006) Assessment of genetic linkage and parent-of-origin effects on obesity. J Clin Endocrinol Metab 91: 4001–4005. doi: 10.1210/jc.2006-0549
  28. 28. Davey Smith G, Steer C, Leary S, Ness A (2007) Is there an intrauterine influence on obesity? Evidence from parent child associations in the Avon Longitudinal Study of Parents and Children (ALSPAC). Arch Dis Child 92: 876–880. doi: 10.1136/adc.2006.104869
  29. 29. Patro B, Liber A, Zalewski B, Poston L, Szajewska H, et al. (2013) Maternal and paternal body mass index and offspring obesity: a systematic review. Ann Nutr Metab 63: 32–41. doi: 10.1159/000350313
  30. 30. Linabery AM, Nahhas RW, Johnson W, Choh AC, Towne B, et al. (2013) Stronger influence of maternal than paternal obesity on infant and early childhood body mass index: the Fels Longitudinal Study. Pediatr Obes 8: 159–169. doi: 10.1111/j.2047-6310.2012.00100.x
  31. 31. Gastwirth JL, Gel YL, Miao W (2009) The Impact of Levene's Test of Equality of Variances on Statistical Theory and Practice. Statistical Science 24: 343–360. doi: 10.1214/09-sts301
  32. 32. Ramsey PH (1994) Testing Variances in Psychological and Educational-Research. J Educ Stat 19: 23–42. doi: 10.3102/10769986019001023
  33. 33. Gao X, Starmer J, Martin ER (2008) A multiple testing correction method for genetic association studies using correlated single nucleotide polymorphisms. Genet Epidemiol 32: 361–369. doi: 10.1002/gepi.20310
  34. 34. He F, Zhou JY, Hu YQ, Sun F, Yang J, et al. (2011) Detection of parent-of-origin effects for quantitative traits in complete and incomplete nuclear families with multiple children. Am J Epidemiol 174: 226–233. doi: 10.1093/aje/kwr056
  35. 35. Zollner S, Pritchard JK (2007) Overcoming the winner's curse: estimating penetrance parameters from case-control data. Am J Hum Genet 80: 605–615. doi: 10.1086/512821
  36. 36. Prescott SM, Lalouel JM, Leppert M (2008) From linkage maps to quantitative trait loci: the history and science of the Utah genetic reference project. Annu Rev Genomics Hum Genet 9: 347–358. doi: 10.1146/annurev.genom.9.081307.164441
  37. 37. Rio Frio T, Civic N, Ransijn A, Beckmann JS, Rivolta C (2008) Two trans-acting eQTLs modulate the penetrance of PRPF31 mutations. Hum Mol Genet 17: 3154–3165. doi: 10.1093/hmg/ddn212