  • Loading metrics

A Machine Learning Approach for Identifying Novel Cell Type–Specific Transcriptional Regulators of Myogenesis

  • Brian W. Busser ,

    Contributed equally to this work with: Brian W. Busser, Leila Taher

    Affiliation Laboratory of Developmental Systems Biology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland, United States of America

  • Leila Taher ,

    Contributed equally to this work with: Brian W. Busser, Leila Taher

    Affiliation Computational Biology Branch, National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Maryland, United States of America

  • Yongsok Kim,

    Affiliation Laboratory of Developmental Systems Biology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland, United States of America

  • Terese Tansey,

    Affiliation Laboratory of Developmental Systems Biology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland, United States of America

  • Molly J. Bloom,

    Affiliation Laboratory of Developmental Systems Biology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland, United States of America

  • Ivan Ovcharenko , (IO); (AMM)

    Affiliation Computational Biology Branch, National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Maryland, United States of America

  • Alan M. Michelson (IO); (AMM)

    Affiliation Laboratory of Developmental Systems Biology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland, United States of America

A Machine Learning Approach for Identifying Novel Cell Type–Specific Transcriptional Regulators of Myogenesis

  • Brian W. Busser, 
  • Leila Taher, 
  • Yongsok Kim, 
  • Terese Tansey, 
  • Molly J. Bloom, 
  • Ivan Ovcharenko, 
  • Alan M. Michelson


Transcriptional enhancers integrate the contributions of multiple classes of transcription factors (TFs) to orchestrate the myriad spatio-temporal gene expression programs that occur during development. A molecular understanding of enhancers with similar activities requires the identification of both their unique and their shared sequence features. To address this problem, we combined phylogenetic profiling with a DNA–based enhancer sequence classifier that analyzes the TF binding sites (TFBSs) governing the transcription of a co-expressed gene set. We first assembled a small number of enhancers that are active in Drosophila melanogaster muscle founder cells (FCs) and other mesodermal cell types. Using phylogenetic profiling, we increased the number of enhancers by incorporating orthologous but divergent sequences from other Drosophila species. Functional assays revealed that the diverged enhancer orthologs were active in largely similar patterns as their D. melanogaster counterparts, although there was extensive evolutionary shuffling of known TFBSs. We then built and trained a classifier using this enhancer set and identified additional related enhancers based on the presence or absence of known and putative TFBSs. Predicted FC enhancers were over-represented in proximity to known FC genes; and many of the TFBSs learned by the classifier were found to be critical for enhancer activity, including POU homeodomain, Myb, Ets, Forkhead, and T-box motifs. Empirical testing also revealed that the T-box TF encoded by org-1 is a previously uncharacterized regulator of muscle cell identity. Finally, we found extensive diversity in the composition of TFBSs within known FC enhancers, suggesting that motif combinatorics plays an essential role in the cellular specificity exhibited by such enhancers. In summary, machine learning combined with evolutionary sequence analysis is useful for recognizing novel TFBSs and for facilitating the identification of cognate TFs that coordinate cell type–specific developmental gene expression patterns.

Author Summary

The development of multicellular organisms requires the formation of a diversity of cell types. Each cell has a unique genetic program that is orchestrated by regulatory sequences called enhancers, comprising multiple short DNA sequences that bind distinct transcription factors. Understanding developmental regulatory networks requires knowledge of the sequence features of functionally related enhancers. We developed an integrated evolutionary and computational approach for deciphering enhancer regulatory codes and applied this method to discover new components of the transcriptional network controlling muscle development in the fruit fly, Drosophila melanogaster. Our method involves assembling known muscle enhancers, expanding this set with evolutionarily conserved sequences, computationally classifying these enhancers based on their shared sequence features, and scanning the entire Drosophila genome to predict additional related enhancers. Using this approach, we created a map of 5,500 putative muscle enhancers, identified candidate transcription factors to which they bind, observed a strong correlation between mapped enhancers and muscle gene expression, and uncovered extensive heterogeneity among combinations of transcription factor binding sites in validated muscle enhancers, a feature that may contribute to the individual cellular specificities of these regulatory elements. Our strategy can readily be generalized to study transcriptional networks in other organisms and developmental contexts.


Complex spatio-temporal gene expression programs guide the progressive determination of pluripotent cells allowing cell fates to become sequentially restricted during embryonic development. These transitions in cell fate are encoded in the genome by cis regulatory DNA sequences such as transcriptional enhancers. Enhancers respond to the combinatorial input of tissue-specific, cell-specific, ubiquitously-expressed and signal-activated transcription factors (TFs) that collectively control gene expression in the appropriate spatial and temporal patterns [1], [2].

In recent years, we and others have shown that computational approaches can be used to predict enhancers of a given type with reasonable accuracy when prior knowledge exists of the TFs and their binding sites that contribute to the activity of this enhancer class [3][5]. However, this approach is limited when the identities and the binding site sequences of co-regulatory TFs are not known. To circumvent this problem, several groups have identified enhancers based on the presence of shared sequence features without the necessity of knowing the co-regulating TFs or their binding motifs [6][12]. These enhancer modeling approaches generally take advantage of two data sources: (1) the non-coding sequences surrounding the members of a gene set of interest, or a set of previously validated enhancers associated with such genes; and (2) previously described sequence motifs from transcription factor binding site (TFBS) libraries and/or de novo motif discovery. In this way, previously described or candidate motifs and/or word profiles can be used to ascertain a training set of enhancers, with the resulting model being used in a genome-wide scan to predict similar enhancers. The enhancer model is validated by testing the activity of these predictions in transgenic reporter assays [7], [13]. A particular transcriptional regulatory model can also be validated by assaying the functionality of the motifs that are found to be relevant for making predictions, and subsequently by identifying the DNA binding proteins that target these sequences.

The majority of the studies showing the utility of enhancer modeling have focused on regulatory sequences involved in segmentation of the Drosophila blastoderm embryo [11], [13][15]. Furthermore, we have recently demonstrated that enhancer modeling can be used to reveal the enhancers and constituent sequence motifs involved in human heart development [7]. Surprisingly, recently predicted blastoderm segmentation enhancers were often active in other tissues and developmental stages [13], whereas the validation rate for predicted human heart enhancers was much higher [7]. These differences in success rates could reflect methodology or might reflect the composition of the training set of sequences. In support of the latter possibility, there are sequence features unique to the blastoderm segmentation enhancers which might limit their amenability to this approach [16].

The development of the Drosophila larval somatic, visceral and heart muscles from mesodermal progenitors requires the coordinated input of multiple different regulators, including the intrinsic TFs Twist (Twi), Tinman (Tin) and Mef2 [17], [18], and the intercellular signaling pathways mediated by the epidermal growth factor, fibroblast growth factor, Wnt, hedgehog and bone morphogenetic proteins (BMPs) [18][20]. These tissue-specific and downstream signal-activated TFs are highly conserved in sequence and function from Drosophila to vertebrates [21]. Although these factors function in various combinations to confer general and subtype properties on differentiating mesodermal cells, they also have pleiotropic effects in development such that additional factors are required to specify individual cellular identities. For example, the Drosophila larval somatic muscles are multinucleated myotubes each having unique properties that include their size, shape, orientation, epidermal attachments and innervation [18], [19]. The formation of each myotube is initiated by a single muscle founder cell (FC) whose fate prefigures that of the corresponding muscle and is controlled by the combinatorial activities of muscle FC identity TFs [18], [19]. FCs fuse with a more homogeneous population of neighboring muscle cells termed fusion-competent myoblasts (FCMs) to form muscle precursors [18], [19]. The complexity of FC genetic programs [22] necessitates that a large number of identity TFs be involved in their specification, yet only a small number of such factors are known [20], few direct targets of these factors have been characterized, and little information is available about the combinatorial control of FC enhancers by TFs of different classes.

Here we applied evolutionary and machine learning approaches to model Drosophila mesodermal enhancers having FC activities in order to uncover the motifs that orchestrate gene expression at the level of individual cells, to generate testable hypotheses about the nature of the corresponding FC identity TFs, and to gain insights into the combinations of TFs that contribute to individual FC enhancer specificities. The coordinated input of tissue-specific and signal-activated TFs, combined with the discrete identities of individual FCs, suggests that the regulatory network specifying distinct FC genetic programs is likely to share some common features while differing substantially with respect to others. Furthermore, a series of studies by Erives and colleagues has shown that a family of non-homologous enhancers is characterized by a discrete regulatory signature [23][25] in spite of the inherent complexity of isolated enhancers [26], [27]. Taken together, this information suggests that the FC regulatory network should be amenable to an enhancer modeling approach.

To address this problem, we first compiled a small set of enhancers with activity in FCs. To overcome issues associated with small sample sizes, and to increase the diversity of sequences with similar functions, we extended this set by adding orthologs derived from other Drosophila species. In vivo testing revealed that these orthologous sequences are functional FC enhancers in spite of having extensive reorganization of their DNA sequences. We show that increasing the training set through the addition of orthologous sequences improves the performance of our enhancer prediction model. By training on this extended set of enhancers, we were able to computationally predict functionally relevant TFBSs and enhancers for the FC gene set. When the resulting classifier was run genome-wide to search for new D. melanogaster FC enhancers, we identified 5,500 high-scoring predictions at a false-positive rate (FPR) of 5%. Moreover, these predicted enhancers were significantly enriched in the noncoding regions associated with known FC genes. While many of the TFBSs learned by the classifier are known to regulate the transcription of muscle FC genes, our classifier predicted additional motifs which have not previously been identified as contributing to FC enhancer activities. Site-directed mutagenesis of five newly discovered motifs in previously characterized FC enhancers demonstrated the critical role played by these TFBSs in supporting full enhancer activity. These validated motifs also suggest plausible candidate TFs acting in the myogenic regulatory network. In one such case—that of the T-box protein encoded by optomotor-blind-related-gene-1 (org-1)—we were able to use loss- and gain-of-function genetic perturbations to establish that this TF functions as a regulator of muscle identity. Furthermore, an analysis of the TFBS compositions of all known FC enhancers revealed an unanticipated complexity in the combinations of TFs that contribute to the unique specificities of individual regulatory elements, a finding that provides a molecular explanation for the well-known diversity of muscle cell identities and their associated gene expression programs.


Here we utilized phylogenetic profiling and machine learning to decipher the motifs and enhancers that underlie the gene expression patterns of individual muscle FCs, which required an array of computational and experimental tools. This study is composed of 4 main components: (1) compiling a training set of FC enhancers from multiple sources including the literature, testing of additional computational predictions from a previous study [5], increasing the size of the dataset through phylogenetic profiling, including the empirical validation of a subset of those predictions; (2) machine learning on the FC enhancer training set; (3) experimental validation of classifier predictions using transgenic reporter assays and whole embryo in situ hybridization with gene-specific probes; and (4) functional examination of sequence features associated with the computational classification to define novel motifs and TFs regulating myogenesis. An overview of the approach utilized in this study is presented in Figure 1. In addition, we used the information derived from the abovementioned studies to examine the distribution of TFBSs across the entire set of known FC enhancers to ascertain the extent to which TF combinatorics contributes to the diversity of FC enhancer activities.

Figure 1. Schematic of enhancer classification beginning with a small training set.

A small set of known enhancers active in similar cells is increased by incorporating orthologous sequences. De novo and known motifs are mapped onto this training set and a set of control sequences. Feature vectors are used to build an enhancer model based upon the learned motif weighting. This model can be used to scan the genome for similar enhancers as the training set. These predictions can be tested using transgenic reporter assays or analysis of the expression of the associated gene. The motif weighting can likewise be used to identify novel classes of transcriptional regulators. The role of the motifs can be tested in cis and the identification of co-regulating TFs can be subsequently tested in trans.

Building a Training Set of Enhancers That Are Active in Muscle FCs

Previous studies have characterized enhancers for individual FC genes that integrate many of the TFs downstream of the Wnt, Ras/MAPK and BMP signaling pathways, as well as input from the instrinsic TFs Twi and Tin [28][31]. However, relatively sparse information is available from these examples to understand the full complexity of the myogenic regulatory network. To begin unraveling the detailed architecture of this network, we previously used expression profiling of various mutants which perturb FC gene expression in a predictable manner to identify hundreds of candidate genes with FC expression patterns [22]. In situ hybridization of these candidates led to the validation of 180 FC genes (Table S1). To understand how these FC genes are coordinately regulated, we evaluated potential regulatory codes which were based on combinations of TFBSs found within two previously characterized FC enhancers [28], [29]. These studies revealed that three TFs—Twi, Tin, and Pointed (Pnt), an Ets-domain TF acting downstream of Ras/MAPK signaling—combine to regulate a subset of FC genes (termed C1) that are particularly Ras- and Pnt-responsive [5]. Furthermore, we originally showed that 3 out of 4 genomic regions associated with C1 FC genes that contain clusters of binding sites for Pnt, Twi and Tin are functional FC enhancers when tested in transgenic reporter assays [5]. To extend that study, we have now tested 16 more predicted enhancers associated with C1 FC genes and found that 8 of these are bona fide FC regulatory elements (Figure S1 and Table S1). In contrast, only 2 out of 18 similarly selected candidate regions associated with non-C1 FC genes were validated as FC enhancers, although 4 of these predicted elements were active in other mesodermal tissues (Table S1). Similar to our previous work [5], these enhancers are active in differing subsets of the 30 individual FCs per hemisegment, with the only requirement being activity in one or more FCs. In total, these findings suggest that the transcriptional code governing C1 FC gene expression is missing one or more critical regulatory components, including cell type-specific factors.

Interestingly, the activities of 14 of these 16 FC enhancers are not restricted to FCs but also include other mesodermal and non-mesodermal cell types (Table S1). It is generally believed that an individual enhancer controls a particular spatio-temporal aspect of a gene's total expression pattern, with each enhancer composed of distinct clusters of binding sites for different combinations of TFs [2]. However, we have recently shown that the enhancer for the Drosophila Nidogen (Ndg) gene is active at different developmental stages and in multiple cell types (including FCs) due to the binding of multiple cell-specific TFs of the same family ([5] and X. Zhu, S. M. Ahmad, A. Aboukhalil, B. W. Busser, Y. Kim, T. R. Tansey, A. Haimovich, N. Jeffries, M. L. Bulyk, and A. M. Michelson, unpublished data). In this context, it is important to note that in several cases where attempts have been made to separate FC from other sites of mesodermal activity, it has not been possible to identify independent enhancers for the different cell types [5], [28]. Furthermore, a survey of Drosophila enhancers shows that the majority are active in multiple cell types ([32] and see Table S2). A similar survey of vertebrate enhancers shows that this diversity of enhancer activities is not a reflection of the relatively compact Drosophila genome ([33], [34] and data not shown). Thus, the regulation of some genes occurs through multiple enhancers, with each individual enhancer directing a specific spatio-temporal aspect of a particular gene's expression. In contrast, other genes are regulated by a single enhancer which directs the entirety (or a large fraction) of the spatio-temporal expression pattern of the gene through the combinatorial activities of TFs that themselves have cell type restricted expression. The latter model appears to predominate for Drosophila FC enhancers. Despite the potential challenges of machine learning on a set of regulatory sequences having broad expression activities, our goal was to use existing information about FC gene regulation to identify both additional enhancers and novel TFBSs that convey individual FC specificity (Figure 1).

Sequences Orthologous to Known FC Enhancers Have Similar Regulatory Functions

Combining the aforementioned studies and previously published work, the training set contained a total of 16 FC enhancers [5], [28], [29], [35], [36]. Machine learning approaches require large and representative datasets to learn robust decision rules. Small training sets often lead to over-fitting of such decision rules and, consequently, do not satisfactorily generalize data that vary slightly in their statistical structure. In addition, limited datasets are likely to only partially represent the distribution of all instances of their class. Thus, to accurately learn the TFBSs that are responsible for FC gene regulation, and to reliably predict additional related enhancers, we investigated options to expand the set of training sequences. This goal was accomplished by a phylogenetic profiling approach which integrates orthologous sequences from the genomes of the 11 other fully sequenced Drosophila species, mosquito, honeybee and red flour beetle by searching for regions displaying at least 50% but less than 80% sequence identity between any two species [37]. These empirically determined sequence identity thresholds were chosen to avoid overly-conserved regions that would introduce redundancy and cause overfitting, as well as overly-divergent regions that would unlikely constitute functional FC enhancers [38], [39]. Therefore, these identity cutoffs should ensure the representation of functional TFBSs in the training set that correspond to the regulatory function of interest, and thus provide sufficient information for training an accurate classifier [26], [40]. This approach is also consistent with the flexible information display or billboard model of transcriptional enhancers, as proposed by Arnosti and Kulkarni [41]. Using these parameters, we identified 24 orthologous FC enhancer sequences from 6 of the 14 orthologous species based on compliance with our sequence identity constraints, bringing the total size of the training set to 40 elements (Table S1).

To confirm the validity of the phylogenetic profiling approach, we assessed the performance of different classifiers trained on subsets of 62 Drosophila melanogaster enhancers having activities in various mesodermal cell types that was retrieved from the REDfly database [32] and 72 of their orthologs (see Materials and Methods for details). The large size of this dataset, and the functional similarity of its members to the activities of the elements that are the focus of this study, allowed an accurate evaluation of the impact of phylogenetic profiling on the prediction performance across training sets of gradually increasing sizes (including 10, 15, 20, …, and 60 randomly chosen mesodermal enhancers). As expected, increasing the size of the training set improves the classification performance until approaching its maximum and thereby rising to an asymptote (Figure S2A). The improvement in the classification performance, measured by the area under the curve (AUC) of receiver operating characteristic (ROC), stabilizes for classifiers trained on approximately 40 elements, suggesting this to be the minimum necessary number of enhancers to train a reliable classifier. We also found that the addition of orthologous sequences to the training set significantly improves the performance of the 91% of the classifiers independently of the size of the training set (all P-values<0.05, Figure S2A) and reduces the error in the estimation of the true accuracy of all classifiers (Figure S2B). Furthermore, phylogenetic profiling improves the concordance between predicted outcomes, and thus, classifiers including enhancer orthologs systematically recognize a larger proportion of enhancers as compared with the classifiers trained only on Drosophila melanogaster enhancers (Figure S2C and S2D). Therefore, supplementary orthologs not only increase the prediction accuracy, but generate more stable classifiers, with more reproducible predictions. In addition, increasing the size of the training set by including presumably functional orthologous sequences that span different evolutionary distances increases our statistical power. For example, we identified over-represented binding sites of 14 TFs in the expanded set that included the orthologs and none in the original FC enhancer set (as compared with background sequence, correcting for multiple testing; Figure 2A). Among over-represented TFBSs are motifs for FoxO1, Ets and the MyoD family of TFs, which are known to play a role in muscle differentiation [42]. Overall, these results are consistent with what would be expected for an increase in the size of the training set [43][45], and support the use of phylogenetic profiling for expanding the training set.

Figure 2. The enhancer classifier performs with high specificity and sensitivity.

(A) Over-representation of TFBSs in the training set including only D. melanogaster enhancers and in the set extended using phylogenetic profiling, as compared with background sequence. P-values were adjusted for multiple testing using the method of Benjamini and Hochberg (BH) [120]. (B) Average ROC curve for the 10-fold cross-validation. Our method achieves an area under the ROC curve of 0.89 (shaded in gray). FPR: false-positive rate; TPR: true-positive rate. (C) Distribution of FC enhancer scores for the genome-wide scan. Scores assigned by the classifier for each evaluated sequence are shown in red. We used a FPR of 5% to define a cut-off for putative enhancers (dotted blue line; see Materials and Methods for details). (D) Fold-enrichment in 180 validated FC genes in the neighborhood of putative FC enhancers, as determined for different FPRs. Intergenic putative FC enhancers were associated with the closest gene, whereas intronic sequences were associated with their host gene. P-values were computed using the binomial test.

To verify that the orthologous sequences function as FC enhancers, we randomly chose 5 examples to test for transcriptional activity in D. melanogaster embryos using transgenic reporter assays. Each enhancer construct was introduced into the same attP site in the D. melanogaster genome using a custom vector containing a green fluorescent protein (GFP) reporter and an attB site allowing phiC31 integrase-mediated integration ([46], [47] and B. W. Busser, L. Shokri, S. A. Jaeger, S. S. Gisselbrecht, A. Singhania, M. F. Berger, B. Zhou, M. L. Bulyk and A. M. Michelson, unpublished data). All of the tested sequences drove similar, although not always identical, expression patterns as their orthologous D. melanogaster enhancers (Figure 3).

Figure 3. Orthologous sequences are functional enhancers.

GFP (green) expression in transgenic stage 11 D. melanogaster embryos containing the indicated GFP reporter constructs driven by the D. ananassae lbl (A), D. mojavensis ap (B), D. persimilis Ndg (C), D. ananassae Ndg (D), and D. persimilis eve (E) enhancers. Co-expression of GFP driven by the D. ananassae lbl enhancer with endogenous Lbl protein (magenta, A′) and D. persimilis eve enhancer with endogenous Eve protein (magenta, E′). β-Gal driven by the D. melanogaster versions of the Ndg (C′, D′) and ap (B′) enhancer co-expresses in some but not all mesodermal cells with GFP driven by the orthologous sequences.

Of note, in several cases, we observed differences in the organization of TFBSs within D. melanogaster FC enhancers and their orthologs, which did not appear to affect their transcriptional activities. For example, the D. melanogaster lbl FC enhancer contains multiple binding sites for each of Pnt, Twi and Tin [5], whereas there are several Pnt, only one Twi and no Tin binding sites in the candidate D. ananassae lbl enhancer (Figure S3A). Nevertheless, both the D. melanogaster and D. ananassae enhancers direct reporter expression in the same two adult muscle precursors and single embryonic muscle FC in which endogenous lbl is expressed (Figure 3A). In this case, the cellular specificity achieved by the orthologous enhancer might be accounted for by the perfect conservation of a single binding site that is preferred by the Slouch (Slou) homeodomain TF, which we have recently shown to be critical in repressing activity of the D. melanogaster lbl enhancer in two Slou-expressing FCs (B. W. Busser, L. Shokri, S. A. Jaeger, S. S. Gisselbrecht, A. Singhania, M. F. Berger, B. Zhou, M. L. Bulyk and A. M. Michelson, unpublished data).

In other examples, the expression patterns driven by orthologous enhancers were similar but did not precisely replicate those of their D. melanogaster counterparts. For example, the ap muscle enhancer is active in a subset of endogenous ap-expressing muscles and was previously shown to depend on the input of Hox TFs [35]. Interestingly, only 3 out of the 5 known functional Hox binding sites are conserved between the D. melanogaster and the D. mojavensis orthologous sequences (Figure S3B). To compare activities of the orthologous enhancers, we generated a D. melanogaster transgenic line containing a D. mojavensis ap-GFP reporter construct and crossed it to a D. melanogaster ap-lacZ reporter strain. This experiment revealed that the candidate D. mojavensis ap enhancer is indeed active in muscle FCs, but only in a subset of the cells that express the reporter driven by the D. melanogaster enhancer (Figure 3B).

We also observed interesting patterns of TFBS reshuffling between the orthologs of some FC enhancers. For example, a 643 bp sequence in the first intron of the D. melanogaster Nidogen (Ndg) gene activates reporter expression in a subset of muscle FCs, pericardial and cardial cells of the heart, and cells of the central nervous system (Figure 3C, 3D and data not shown), and was originally identified based on the presence of binding sites for Pnt, Twi and Tin [5]. GFP reporter constructs of Ndg enhancer candidates from D. persimilis and D. ananassae were tested in transgenic D. melanogaster embryos. To compare the activities of the ortholgous enhancers, we crossed D. persimilis Ndg-GFP or D. ananassae Ndg-GFP reporter constructs to a D. melanogaster Ndg-lacZ reporter strain (Figure 3C and 3D). The orthologous enhancers co-activate their respective reporters in D. melanogaster Ndg-expressing FCs, albeit a minority, with extensive additional activity evident in other mesodermal cells. The finding of distinct expression patterns for all tested Ndg enhancer sequences is noteworthy as there is significant conservation of Pnt, Twi and Tin binding sites between D. melanogaster and D. ananassae but not D. persimilis versions of the Ndg enhancer (Figure S3C). This finding suggests that different ordering and spacing of TF binding sequences (both conserved and non-conserved) can be employed by an enhancer to activate gene expression in FCs and other mesodermal cells [41], although precise cellular specificity is dependent on a fixed arrangement of binding sites. We note, however, that such inferences are based entirely on sequence comparisons, and that a more detailed understanding of the significance of the apparent evolutionary shuffling of TFBSs would require extensive in vivo functional testing.

Finally, we observed variable ordering and distances between individual TFBSs among the orthologs of FC enhancers, as exemplified by even skipped (eve). This gene is expressed in two pericardial cells of the heart and a single dorsal somatic muscle FC [48]. Eve expression is positively regulated by the Wingless (Wg), Decapentapalegic (Dpp) and receptor tyrosine kinase (RTK)/Ras signaling pathways, and the gene is active in domains of the mesoderm in which Twi and Tin are critical [28], [49]. An enhancer that integrates these convergent inputs was isolated and shown to contain clusters of binding sites for T cell factor (Tcf), Mothers against dpp (Mad), and Pointed (Pnt), TFs acting downstream of Wg, Dpp and RTK/Ras signals, respectively, as well as binding sites for Twi and Tin [28]. Here we show that the orthologous D. persimilis sequence is expressed in an identical pattern (Figure 3E). Interestingly, the D. persimilis eve muscle and heart enhancer contains clusters of Tcf, Mad, Pnt, Twi and Tin binding sites, but the precise positions of these sites are generally not well conserved (Figure S3D). The orthologous D. virilis eve enhancer has a similar structure in which all 5 of these TF binding site classes are present [29].

In total, 5 out of 5 tested orthologous sequences drove expression in a pattern that is similar (eve and lbl), though often not identical (Ndg), to the D. melanogaster enhancer. The imprecise activities of some of the orthologous enhancers may reflect the partial level of sequence identity that could affect as yet unidentified binding sites, may result from the extensive shuffling of known binding sites for co-regulatory TFs, or might simply be a reflection of differential gene expression in the orthologous flies [26], [27], [40], [50]. Importantly, the general preservation of enhancer activity in the absence of extensive sequence conservation—a point which is further confirmed by the apparent shuffling of binding sites for known co-regulatory TF binding sites—suggests that these elements share other common sequence features. Thus, increasing the training set with orthologous sequences should minimize potential over-fitting caused by training on an otherwise small set of validated enhancers.

Machine Learning of the FC Enhancer Code Results in an Accurate FC Enhancer Classifier

The FC training set consisted of 16 D. melanogaster FC enhancers plus 24 orthologous sequences. However, as previously noted, the activity of these enhancers is not restricted to FCs, with only 2 out of 16 tested enhancers displaying such localized activity (Table S1). Therefore, any computational model for FC enhancer classification will likely predict enhancers having broad mesodermal expression patterns that include but are not restricted to FCs. As a control set, we randomly sampled 1000 non-coding D. melanogaster sequences with length, GC- and repeat-content distributions similar to those of the FC training set. To discriminate between FC enhancers and other non-coding sequences, we modified a machine learning approach that was previously developed for the prediction of mammalian heart enhancers, with many of those results validated in vivo [7]. This method captures sequence patterns specific to a set of similarly acting non-coding sequences, relying on known TFBSs, as well as de novo motif discovery, to account for unascertained TF binding specificities. Known TFBSs were obtained from the literature and available databases (see Materials and Methods). De novo motif discovery was performed using PRIORITY [51], a Gibbs sampling approach that searches for over-represented motifs in a set of sequences.

With the aim of discovering TFs with critical roles in FC co-regulation, we assumed no prior knowledge of active TFs. Each sequence in the training and control set was represented by the number of occurrences per base pair of each of the 945 considered motifs. A linear Support Vector Machine (SVM) was trained to distinguish between FC enhancers and control sequences based on TFBS occurrences. The ability of the classifier to accurately predict regulatory activity was assessed by a 10-fold cross-validation procedure. The performance of the classifier was evaluated using the AUC, a value ranging from 0.5 (random classification) to 1.0 (perfect classification). The obtained AUC value of 0.89 indicates reliable detection of FC enhancers by the developed classifier (see Materials and Methods and Figure 2B).

We next applied the classifier for de novo discovery of FC enhancers in the D. melanogaster genome. We used a sliding window approach to score ∼140,000 overlapping non-coding 1000 base pair-long sequences spanning the complete genome. Keeping a low false-positive prediction rate (FPR) of 5%, approximately 5,500 sequences were annotated as putative FC enhancers (Table S3). Similar to what we observed for the training set, the individual conservation profile of the D. melanogaster putative FC enhancers generally reflects the phylogenetic distances of the species involved in the analysis, with most orthologs in the 50–80% sequence identity range in D. yakuba, D. erecta, D. ananassae, D. pseudoobscura and D. persimillis. However, putative FC enhancer sequences tend to be more deeply conserved than background genomic sequence (P-value<0.05, computed using the Binomial test, corrected for multiple testing using Bonferroni's method), and thus, probably functional (see Text S1). Although it was not surprising that the scores of the FC enhancers in the training set were positively-skewed (Figure 2C), it was reassuring to find that putative FC enhancers are strongly associated with genes that are expressed in FCs. For example, we found that at a FPR of 5%, 222 enhancer predictions are associated with 77 genes expressed in FCs, a number that is 1.5-fold higher than would be expected by chance (P-value = 5.8×10−10; Figure 2D). The latter result suggests that the sequence features learned by the classifier have specificity for FC enhancer function.

Functional Assessment of Enhancers Predicted by the Classifier

To test the functions of the classifier-predicted enhancers, we first asked if the presence of a high-scoring putative FC enhancer could be used to predict expression in FCs [52]. To more readily associate an enhancer with its putative target gene, we examined the expression patterns of genes with a high-scoring intronic enhancer, which was assumed to control the gene in which it is located. In total, 5 genes out of 20 tested (25%) were actually expressed in FCs (Table S3). This is 8-times higher than would be predicted by chance (P<0.002), given that only 3% of Drosophila genes have been estimated to be expressed in FCs [22]. As an example, defective proventriculus (dve) was identified and validated as a novel FC gene using this approach (Figure 4A). In summary, since the presence of putative FC enhancers is strongly associated with FC gene expression, it is likely that a large fraction of FC enhancer predictions represent authentic FC regulatory sequences, including FC-specific enhancers and possibly silencers and insulators [2].

Figure 4. Candidate enhancers predicted by the classifier are active in FCs.

In situ hybridization of dve in wild-type (WT) embryos and embryos over-expressing Ras (Twi>Ras) in the mesoderm (A). Note the increased activity of dve in Twi>Ras embryos, indicative of a FC gene [22]. GFP driven by the classifier-predicted enhancers associated with the upstream sequences of slou (arrows in B) and slp1 (arrows in C). Slou protein (magenta) co-expresses with GFP (green) in slou-GFP embryos (B). Duf (magenta), which marks all FCs, co-expresses with slp1-GFP (green) (C). GFP (D) driven by the classifier-predicted intronic sequence associated with the dve gene co-expresses with Mef2 (D′) in myotubes at stage 15 in dve-GFP embryos.

To directly assess the in vivo functions of these candidate enhancers, we used site-specific transgenic reporter assays to test 12 enhancer predictions associated with known FC genes. We assayed the activities of genomic regions with varying scores in the classifier ranking (Table S3). Whereas 9 out of the 12 candidates were found to have enhancer activity, 4 of these were functional in the mesoderm, with 2 directing reporter expression in muscle FCs (Figure 4). Forty-four percent (4/9) of enhancers driving expression in mesoderm represents a validation rate comparable with p300 based ChIP-Seq discovery of tissue-specific enhancers [53], while 2/9 FC enhancers in the set was below expected. These findings presumably reflect the limitations of the training set which, as previously noted, contain only 2 enhancers with specificity restricted only to FCs. Other factors contributing to this outcome are considered in the Discussion.

One informative example of a newly identified FC enhancer is that associated with slou (Figure 4B). This enhancer is found upstream of the gene in a region previously shown to recapitulate the complete FC expression of slou [54], but it is active in only a subset of all slou-expressing cells (in particular, those which correspond to the lateral oblique 1 (LO1) and ventral transverse 1 (VT1) muscles). This result suggests that additional regulatory elements must account for the complete expression pattern of this FC gene [55], unlike the situation for the majority of FC enhancers. The predicted enhancer associated with slp1 is also located upstream of the gene and directs reporter activity both to FCs (Figure 4C) and to mesodermal and ectodermal stripes which are known to express slp1 [56]. Of note, the intronic enhancer for dve, a gene which was tested for expression in FCs based on the presence of this predicted FC enhancer (Figure 4A), was not active during the FC stage of myogenesis but did direct reporter expression slightly later when myotubes develop (Figure 4D). It remains possible that the activity of this element occurs at the FC stage but is insufficiently strong to be detected by the present assay. Alternatively, a separate enhancer may be directing the early FC activity of dve, consistent with the additional candidate enhancers associated with this gene (Table S3). In this case, the classifier appears to be detecting features shared by early- and late-acting muscle enhancers without discriminating FC-specific elements, which is not surprising given that many TFs are expressed and active in the same cell types at different stages of development [20], [54]. Thus, while the classifier has some predictive value for FC enhancers, the regulatory network specifying these cells is sufficiently diverse and complex that the available training set is insufficient to provide a higher success rate for identifying new FC enhancers. To begin unraveling the complexities of this network, we need to define a more extensive collection of myogenic transcription factors and the DNA sequences to which they bind. To this end, we turned to an examination and validation of the novel sequence motifs detected by the classifier.

Identification of Novel Sequence Motifs within FC Enhancers

To begin constructing a more comprehensive myogenic network, we examined the sequence features associated with the computational classification of FC enhancers. These features included position weight matrices of known TF binding specificities found within the TRANSFAC database, as well as motifs not represented in this database that can be identified by the PRIORITY algorithm [51]. In the case of linear SVMs, features irrelevant to the classification receive zero weight, whereas those associated with the signal and control set receive positive and negative weights, respectively (see Materials and Methods). Since a finite number of TFs is expected to regulate FC gene expression, only some of all possible motifs will be relevant to the classification. Indeed, out of the original 945 features, 200 contributed to approximately 50% of the weights in the decision function of the classifier, suggesting their importance in the prediction of FC enhancers. Sixty-percent of these 200 motifs were associated with positive weights and correspond to almost 60 distinct TFs (Figure S4 and Table S4). Most of these TFs belong to only a few families having similar binding profiles, which we are unable to individualize (Figure 5).

Figure 5. DNA binding domains of the TFs most relevant to FC enhancer classification.

Only DNA binding domains for the fifty most relevant TFs have been included. TFs were ranked according to the SVM weights of their respective motifs, which represent their discriminating power. Only the highest scoring motif for each TF was considered (median ranks computed across 10 random partitions of the training data varied between 12 and 117). De novo motifs were explicitly excluded from this analysis. TF domains and sequences have been clustered using average linkage and Euclidean distance. The dendogram on top of the heatmap represents the relationships among the sequences in the training data, built on the presence/absence of TFBSs recognized by a specific class of TF DNA binding domain. The dendogram on the left of the heatmap shows the relationships among the different TF DNA binding domains.

This diverse compilation of motifs suggests that the motif signature of FC enhancers is complex. However, this interpretation should be considered with caution, since training on a set of enhancers with diverse expression (Table S1) is likely to lead to the identification of multiple enhancer signatures. In any case, we were encouraged by the fact that known myogenic regulatory motifs, including Ets, Mef2 and MyoD (due to similarities in binding preferences, E-boxes may represent motifs for Twi, MyoD or other TFs having basic-helix-loop-helix DNA binding domains), are among those with the highest discriminatory power. Other identified motifs, including those for Stat [57] and homeodomain proteins [35], [58], [59], appear to play critical roles in myogenesis. In addition to known TFBSs, de novo motifs make a key contribution to the classification and presumably account for binding sites of TFs missing from TFBS libraries, or constitute more accurate representations for the binding specificities of incompletely characterized TFs (Figure S5). In particular, we found that the most relevant de novo motif represents the binding specificity of Tin [60], consistent with the well-established mesodermal regulatory functions of this TF [61].

Predicted Motifs Regulate Enhancer Function in FCs

To determine if the newly identified motifs are functionally relevant to FC gene expression, we employed site-directed mutagenesis of such putative binding site sequences in otherwise wild-type FC enhancers. We initially concentrated on the potential role of Ets, Myb, POU homeodomain (POUHD) and Fkh binding motifs (see Figure 5, Figure 6A, and Figure S7B). Each of these motifs is over-represented in both individual FC enhancers and their orthologous sequences when compared to controls (Figure S6). Sequence matches to Myb and POUHD motifs in the wild-type Ndg enhancer and a version in which the sites are mutated are shown in Figure 6B (also see Table S4). To compare activities of the different constructs, we crossed Drosophila strains containing wild-type or mutant enhancer transgenes driving different reporters (either GFP or lacZ) to each other.

Figure 6. The wild-type activities of FC enhancers require input from classifier-defined Myb and POUHD TF binding motifs.

(A) TRANSFAC position weight matrices for Myb (V$MYB_Q6) and POUHD (V$POU1F1_Q6) enriched motifs identified by the classifier. (B) Binding site sequences in the Ndg enhancer for Myb and POUHD and versions in which those sites are selectively mutated. Motifs were defined by searching for matches to the vertebrate homologues in the UniPROBE database [99]. The identification of these binding sites and the designs of the mutant versions are described in Table S4. (C) GFP (green) and β-Gal (magenta) are co-expressed when driven by the wild-type (WT) Ndg enhancer (NdgWT-GFP and NdgWT-lacZ, respectively). (D) GFP (green) expression driven by a version of the Ndg enhancer in which POUHD sites are selectively inactivated (NdgPOUHD-GFP) is significantly reduced compared to β-Gal (magenta) driven by NdgWT-lacZ. (E) β-Gal driven by a version of the Ndg enhancer in which Myb binding sites are selectively inactivated (NdgMyb-lacZ) is de-repressed into additional somatic mesodermal cells compared to GFP driven by a WT version of the Ndg enhancer (NdgWT-GFP).

Mutagenesis of all motifs affected activity of the reporter as compared to wild-type versions of the enhancer (Figure 6C). For example, elimination of POUHD binding sites (Figure 6D) from an otherwise wild-type version of the Ndg enhancer reduced or eliminated enhancer activity in subsets of cells which express wild-type Ndg-lacZ (Figure 6D), whereas mutagenesis of Myb motifs caused an extensive de-repression of the reporter into additional somatic mesodermal cells (compare Figure 6E and 6E′). In addition, we found that the activity of Ets binding sites is critical for the full activity of the Ndg enhancer (Figure S7A), as had previously been demonstrated for another FC regulatory element [28]. Finally, mutagenesis of the Fkh binding sites in the apterous (ap) FC enhancer lead to a complete loss of reporter expression in those FCs in which the wild-type enhancer is active (compare Figure S7C and S7D). Collectively, the present experiments validating the functions of specific TFBSs in known FC enhancers document the critical role played by classifier-defined motifs in regulating specific gene expression patterns.

Identifying a Novel Myogenic Transcription Factor from Motifs Over-Represented in FC Enhancers

The preceding analyses indicate that the regulatory motifs learned by the classifier are critical for the normal functions of FC enhancers. Next, we used classifier results not only to discover a new cis-acting motif but also to identity the corresponding TF that binds to this sequence and to functionally characterize it as a previously unrecognized myogenic regulator.

One of the top-scoring classifying features of the enhancer training set was a motif that binds to T-box TFs (Figure 5, Figure 7A, Figure S4, and Figure S6). This finding could either reflect the existence of a novel myogenic regulator or, since the training set of FC enhancers also contain many elements with heart activity (Table S1), it could simply indicate the functions of known cardiogenic T-box TFs [62][64]. To distinguish between these possibilities, we first defined the expression pattern of every Drosophila T-box TF (Table S5), which confirmed that Dorsocross 3 (Doc3) and optomotor-blind-related-gene-1 (org-1) are the only T-box TFs expressed in muscle FCs [22], [62]. In particular, org-1 is co-expressed with Slou in the FCs corresponding to muscles LO1 and VT1, and with Lbl in the FC for the segment border muscle (SBM) (Figure S8).

Figure 7. The T-box TF org-1 is a regulator of the lbl and slou FC enhancers.

(A) TRANSFAC position weight matrix for Tbx5 (V$Tbx5_Q5), a vertebrate homolog of the Drosophila T-box TF org-1 and a top-scoring feature derived by the FC enhancer classifier. (B, C) In stage 11 embryos containing the lblWT-lacZ transgene, β-Gal (green) co-expresses with endogenous Lb (red) in three cells (arrow) but is absent from Slou-expressing FCs (blue, arrowhead). (D, E) Mutagenesis of T-box motifs in the lbl FC enhancer (lblTbox-lacZ) results in an attenuation of β-Gal (green) reporter activity in the three Lbl-expressing cells (red, arrow). Wild-type and mutant T-box binding sites in the lbl FC enhancer are described in Table S4. (F, G) GFP (green) co-expresses with endogenous Slou (red) in two cells (arrowhead) but not in the three Lbl- expressing cells (blue, arrow) in stage 11 embryos containig the slouWT-gfp transgene. (H, I) Mutagenesis of T-box motifs in the slou FC enhancer (slouTbox-lacZ) results in a marked attenuation of β-Gal (green, arrow) expression in two Slou-expressing cells (red, arrowhead). The asterisks denote de-repression of the lacZ reporter in cells of unknown identity. Wild-type and mutant T-box binding sites in the slou FC enhancer are described in Table S4. (J) GFP (green) fluorescence expression in living stage 14 lbl-GFP embryos is visible in the SBM (arrowhead), in two adult muscle precursors and in several cells of the central nervous system (asterisks) injected with control lacZ dsRNA. (K) Loss of GFP fluorescence from cells corresponding to the wild-type positions of the SBM and two adult muscle precursors but not in cells of the central nervous system (asterisks) in living stage 14 lbl-GFP embryos injected with org-1 dsRNA. (L) GFP (green) fluorescence expression in living stage 14 slou-GFP embryos is visible in muscles LO1 (arrow) and VT1 (arrowhead) injected with control lacZ dsRNA. (M) Loss of GFP fluorescence from cells corresponding to the wild-type positions of LO1 and VT1 in living stage 14 slou-GFP embryos injected with org-1 dsRNA. (N) Co-expression in the segment border muscle (SBM; arrowhead) of endogenous Lbl (red) and β-Gal in stage 14 lblWT-lacZ embryos containing the lblWT-lacZ transgene. (O) Panmesodermal expression of org-1 (Twi>org-1) in stage 14 lblWT-lacZ embryos induces ectopic activation of both endogenous Lb (red) and the β-Ggal reporter reporter (green). (P) Stage 16 wild-type (WT) embryo stained with antibodies directed against myosin heavy chain (MHC; green), Lb (red) and Slou (blue) showing expression of Lb in the single SBM (arrowhead) in each hemisegment. (Q) Panmesodermal expression of org-1 (Twi>org-1) induces duplication of the SBM in some but not all hemisegments (arrowheads). (R) GFP (green) fluorescence expression in living stage 16 MHC-tauGFP embryos is visible in the SBM (arrowhead) and muscle LO1 (arrow) injected with control lacZ dsRNA. (S) Loss of GFP fluorescence from cells corresponding to the wild-type positions of the SBM muscle LO1 in living stage 16 MHC-tauGFP embryos injected with org-1 dsRNA.

The previous co-expression studies raise the possibility that org-1 may directly regulate slou and lbl. To test this hypothesis, we identified potential T-box binding sites in the lbl and slou FC enhancers (Table S4). The previously described lbl muscle enhancer is active in the SBM and in two adult muscle precursor cells [5], while the slou FC enhancer identified in the present work is active in the two FCs which become muscles LO1 and VT1 (Figure 4B). Of note, the slou FC enhancer was predicted by the classifier due to the presence of a combination of motifs, including those that bind to T-box TFs. Targeted mutagenesis of the T-box sites in otherwise wild-type lbl (Figure 7D and 7E) and slou (Figure 7H and 7I) enhancers revealed that these sites are essential for full enhancer activity (compare to the wild-type versions in Figure 7B, 7C and 7F, 7G respectively). These results suggest that Org-1 is a direct activator of slou and lbl expression in these three FCs. If this is the case, then org-1 loss- and gain-of-function should lead to decreased and increased expression, respectively, of the putative target genes [65]. In agreement with this expectation, RNAi-mediated knockdown of org-1 causes loss of lbl-GFP (Figure 7K) and slou-GFP (Figure 7M) activity, whereas panmesodermal overexpression of org-1 is associated with ectopic activation of both the endogenous lbl gene and the lbl enhancer-driven reporter (Figure 7O), as well as duplication of the SBM in late-stage embryos (Figure 7Q). These results suggest that Org-1 is a direct regulator of lbl and that it also contributes to the development of the lbl-expressing muscle. Consistent with the latter prediction, RNAi-mediated knockdown of org-1 in embryos expressing tau-GFP under control of a myosin heavy chain enhancer revealed a loss of both the SBM and muscle LO1 (Figure 7S). In summary, our computational enhancer classification not only led to the discovery of a T-box regulatory motif, but also facilitated the identification of org-1 as encoding a TF critical for FC enhancer activity and for determining muscle FC identity.

TFBS Composition of FC Enhancers

Having identified and experimentally validated the functions of 4 novel TFBSs that we found to be over-represented in FC enhancers—POUHD, Myb, Fkh and T-box—we were next interested in determining the distribution of all known regulatory motifs in enhancers of this class. We reasoned that such a survey might reveal whether TF combinatorics contribute to FC enhancer specificity. Thus, we analyzed all 18 D. melanogaster FC enhancers (16 from the original training set plus 2 more enhancer predictions whose activities were validated in the current study) for the presence of a total of 11 types of TFBSs that are known to contribute to FC activity. For this purpose, we added 7 motifs from prior studies of FC enhancers to the 4 new motifs discovered here.

We had previously constructed and validated a regulatory model of FC enhancer activity which reflected the coordinated input of Tcf, Mad, Pnt, Twi and Tin [28], [29]. Subsequently, combining the clustering of FC genes based on genetic perturbation responses with a systematic in silico evaluation of candidate transcriptional regulatory models, we demonstrated that Pnt, Twi and Tin alone target a subset of highly Ras-responsive FC genes [5]. In addition to these 5 motifs, we included 2 other previously characterized myogenic regulatory sequences that are bound by Mef2 [66] and homeodomain (HD) TFs ([35], [67] and B. W. Busser, L. Shokri, S. A. Jaeger, S. S. Gisselbrecht, A. Singhania, M. F. Berger, B. Zhou, M. L. Bulyk and A. M. Michelson, unpublished data).

Using position weight matrices (PWMs) for 3 signal-activated TFs (Tcf, Mad and Pnt), the ubiquitously expressed Myb, 4 tissue-restricted TFs (Twi, Tin, Mef2 and HD, where HD in this case represents Hox factors that are widely expressed throughout the somatic mesoderm [59]), plus 4 cell type-specific TF classes (POUHD, Fkh, T-box and HD, where in this case HD refers to muscle identity TFs such as Slou, Ap, and Muscle Segment Homeobox that are expressed in various subsets of FCs [54], [68], [69]), we scanned and scored all 18 FC enhancers for at least one occurrence of each of these 11 binding site motifs (Figure 8, Figure S9 and Table S6). Interestingly, this analysis revealed that each FC enhancer has a unique combination of predicted binding sites for all 11 of these TF classes. On the other hand, the FC enhancers exhibited various overlapping TFBS combinations when subsets of the 11 motifs were considered (Figure S9 and Table S6). Of note, the only motif that is present in all 18 FC enhancers binds the MAPK-activated TF Pnt, a result that is consistent with prior evidence demonstrating that the receptor tyrosine kinase/Ras pathway is the major inductive signal for establishing all FC fates [49], [70].

Figure 8. TFBS combinatorics within FC enhancers.

(A) Distribution of Tcf, Mad, Pnt, Twi, Tin, POUHD, Tbx, Myb, Fkh, HD and Mef2 TFBSs in FC enhancers. Binding sites for Tcf, Mad, Pnt, Twi and Tin were previously published [5]. Motif matches for motifs most relevant to the classification for a given DNA binding domain class: POUHD (V$OCT_01, V$POU1F1_Q6, V$OCT4_02), Tbx (V$TBX5_01, I$BYN_Q6), Myb (V$MYB_Q6), Fkh (V$FOXO3_01, V$FOXO1_Q5, V$FREAC2_01), HD (I$ABDA_Q6, V$CDX5_Q5, V$IFP_03, V$PAX4_02), and Mef2 (V$AMEF2_Q6, V$HMEF2_Q6). These sites were mapped using MAST under default parameters [118]. (B) A generic FC enhancer receives differential input from signal-activated, ubiquitous, tissue-restricted and cell type-specific TFs. HD binding motifs are represented as both tissue-restricted and cell type-specific classes since these motifs receive input from both Hox TFs, which are widely expressed in the mesoderm [35], [59], [67], and muscle identity HD TFs—such as Slou, Msh and Ap—which are cell type-specific [54], [68], [69]. For this diagram, HD binding sites were not subdivided into the distinct binding profiles that have been identified for each individual HD TF ([83], [126] and B. W. Busser, L. Shokri, S. A. Jaeger, S. S. Gisselbrecht, A. Singhania, M. F. Berger, B. Zhou, M. L. Bulyk and A. M. Michelson, unpublished data).

A number of caveats must be considered in interpreting the above analysis of motif distributions within FC enhancers. First, except for the small number of cases where individual motifs have been functionally validated [28], [29], [35], [67], each motif occurrence corresponds to a computational prediction without a verified assignable function. Second, the probability of finding a motif match is increased in longer genomic sequences, whereas the minimally active region has not been determined for most enhancers in this set. One notable exception is the enhancer directing FC expression of eve, where a minimally active regulatory element has been defined. In the case of eve, an approximately 300 bp sequence contains multiple instances of 6 different TFBSs (Figure 8 and Table S6), all 6 of which have been functionally validated as contributing to FC activity [28], [29]. Third, PWMs, which are critically dependent on particular thresholds to limit false positives and negatives, were used to identify motifs within each enhancer. Fourth, the various PWMs have different relative information contents (Table S6), a parameter which affects the likelihood that a match will be found in any given sequence. Fifth, since many of these enhancers are active in cell types other than FCs, not all motifs that are present will necessarily contribute to FC activity. Notwithstanding these potential limitations, the present results suggest that the specificity of enhancer activities observed at the level of individual muscle FCs is reflected in the diversity of the TFBS compositions of these regulatory elements.


Prediction of Enhancers

There are three main approaches for the prediction of tissue-specific regulatory elements that are based on high-throughput sequencing coupled with chromatin immunoprecipitation (ChIP-Seq), DNA sequence pattern analysis, or hybrid methods that combine both of these strategies. ChIP-Seq for p300 using mouse embryonic tissue has proven to be an accurate means for identifying enhancers and their associated activities, with in vivo validation rates varying from 62% to 88% [53], [71]. Computational analysis of whole-genome histone modification profiles using hidden Markov models [72], [73] and machine learning techniques [74] has also been highly successful at linking chromatin signatures with regulatory elements. Finally, computational models that identify tissue-specific enhancers relying on sequence motifs and linear regression and support vector machines have been similarly effective, with in vivo validation rates of de novo predictions ranging from 62% for heart enhancers [75] to 91% for brain enhancers [Taher et al., unpublished data]. Although experimental techniques are often preferred for identifying enhancers on a genome-wide scale, ChIP-Seq has several limitations. For example, ChIP-Seq experiments are typically carried out in only one species and for individual cell types, and are currently not sufficiently precise for low-quality genome sequences. Thus, de novo prediction of regulatory elements based on ChIP-Seq data critically depends on the availability of relevant data for the species, cell type and genomic regions of interest. Currently, computational analysis of DNA sequence patterns shared by a set of regulatory elements with the same or similar biological activity remains a highly effective method for the de novo discovery of tissue-specific enhancers, and the simultaneous elucidation of cell type-specific regulatory codes. The method presented in this study further extends the usefulness of computational sequence analysis by exploring phylogenetic information that can be used to improve the classification accuracy, a strategy that promises to be advantageous in the large number of cases where comparative genomics data are available.

Computational approaches for predicting cis-regulatory modules are commonly based on machine learning of arrangements of TFBSs in enhancers that have common functions [7], [10], [11], [13], [15], [76]. These methods rely heavily on a training set of related enhancers to detect over-represented TFBS combinations. Unfortunately, in the vast majority of cases—including the present study of Drosophila muscle FC enhancers—the size of the training set is limited by the lack of experimentally validated tissue- and cell type-specific enhancers, which results in overfitting of computational models and poor accuracy of predictions. To overcome this problem, and to provide a generalizable approach for increasing the size of the training set, we developed a phylogenetic profiling strategy based on a search for diverged orthologous counterparts of available enhancers from distantly related species. Twenty-four Drosophila orthologs were identified using this approach, which more than doubled the size of the training set. We assessed the ability to accurately distinguish FC enhancers in a cross-validation framework using the extended training set, and determined that the classifier accuracy is 89% as assessed by the AUC approach. We then applied this classifier to scan the entire genome of D. melanogaster for novel FC enhancers, retrieving 5,500 high-scoring predictions at a FPR of 5%. These predictions were significantly associated with genes expressed in FCs, demonstrating that the model was able to capture essential features of FC gene co-regulation. A similar machine learning approach could be applied to a diverse array of datasets, including experimentally-verified regulatory elements from co-expressed targets at either a germ layer, organ, tissue or cellular level from invertebrate and vertebrate databases [32], [33], [77], [78]. Alternatively, a similar approach could be coupled to a training set of predicted regulatory elements derived from genome-wide analyses of chromatin marks or DNAse hypersensitive sites in active enhancers associated with a co-expressed gene set [79], [80].

Increasing a Small Training Set with Orthologous Sequences

Evolutionary constraint of functional sequences is routinely employed as an effective filter to improve the prediction of regulatory elements [13]. Furthermore, cross-species comparisons have been successfully exploited to obtain evidence for functional TFBSs. For example, Rouault et al. [76] used twelve Drosophila species to identify over-represented motifs in the regulatory elements of genes expressed in neural progenitor cells, with sequence orthologs used to enrich the training set and to give prominence to conserved motifs. However, our method extends this approach by including suitably diverged orthologous enhancers from other Drosophila species in the dataset used to train the classifier. Our purpose in designing this strategy was two-fold. First, we wanted to enrich for relevant sequence motifs in the training data, allowing for a level of variation that would improve the generalization of the model. Second, we wanted to provide a potentially wider variety of TFBS arrangements that characterize the architecture of authentic FC enhancers. In essence, the addition of orthologous sequences boosts the statistical power of the significance tests, revealing patterns of TFBSs that otherwise could have been neglected.

Of note, when 5 of these orthologous sequences were tested in transgenic reporter assays in D. melanogaster, the overall expression pattern generated was similar to the D. melanogaster counterpart despite extensive evolutionary shuffling of known TFBSs. Similar binding site reorganization has been documented for the enhancers that regulate both the segmentation and mesodermal patterns of eve expression [40]. Numerous other studies have shown that the order and spacing of TFBSs is critical for enhancer function [23][27], [50]. These results suggest that regulatory elements can direct similar expression patterns provided that the overall composition and order of collaborating TFs is maintained [40]. Our finding that enhancer function is preserved in the orthologous sequences examined here establishes the validity of the sequence conservation thresholds chosen for the present studies, and suggests that the incorporation of orthologous sequences to increase a training set without over-fitting the data will be a generally applicable approach.

In Vivo Functions of Predicted Enhancers

To assess the accuracy of our method, we selected 12 predicted FC enhancers and tested their in vivo functions. Seventy-five percent of the putative enhancers were experimentally validated as having transcriptional activity, demonstrating the effectiveness of our approach to identify regulatory sequences. However, of the sequences showing regulatory functions, only 4 of 9 were active in the mesoderm—including 2 in FCs—and 3 of 9 had nervous system activity. These data suggest that our model has been able to reliably recognize general properties of tissue-specific enhancers without specifically distinguishing an overall muscle FC code, even though numerous individual FC-specific motifs were identified (see below). The former finding is similar to the results of Sinha and colleagues [13] who found that the majority of their classifier predictions were active enhancers, but only a minority were expressed in the predicted pattern. A number of confounding factors can explain this outcome.

First, most members of the enhancer training set are active in both FCs and other cell types, including additional mesodermal cells such as the cardiac and visceral mesoderm, as well as some cells of the nervous system. For example, the enhancer responsible for the FC activity of the hunchback gene is also active in the longitudinal visceral mesoderm, and enhancers directing the FC expression of the vestigial, big brain and king-tubby genes are also active in the peripheral nervous system (Table S3). These results suggest that the regulatory networks specifying the somatic and visceral mesoderm share common features, which is consistent with both the available genetic and genomic evidence for the diverse developmental functions of key mesodermal transcription factors [81], [82]. Second, different members of a given TF family bind to similar motifs but have distinct tissue-specific expression patterns and developmental activities. Thus, combinations of motifs involved in the specification of muscle FCs and the nervous system may overlap. For example, this situation occurs with E-box and NK-homeodomain motifs [5], [58], [76], [83], [84]. Third, some TFs are expressed and functional in the derivatives of more than one germ layer [54], [85]. Fourth, the sequence features characteristic of cell type-specific enhancers, such as those active in muscle FCs, are expected to be under-represented in available training sets owing to the diversity of combinatorial TF models required to specify such a heterogeneous cell type [18], [20]. Identification of many examples of a particular cell-specific signature is a major challenge since each of the approximately 30 FCs in each Drosophila hemisegement expresses a unique combination of cell-specific muscle identity TFs and downstream target genes [18], [19]. Thus, 30 distinct cell states exist, each governed by a different but partially overlapping set of regulatory TFs. In contrast to the difficulties involved in dissecting regulatory codes at single cell resolution, shared features that direct activity to the general level of tissues and organs have been more readily identified using a machine learning approach, as was found here for enhancers having mesodermal, although not necessarily FC, activity. This likely reflects the dominant role that some TFs play in the regulatory network specifying the identities of numerous tissues [86][91]. Fifth, since there appears to be a regulatory signature for enhancers [16], [92], it is likely that these aspects of enhancer structure will be more significantly over-represented than those features that specify individual FC activity patterns. Sixth, the use of phylogenetic profiling might have expanded the biological function of the training dataset by introducing additional enhancer functions acquired by the orthologs of the original D. melanogaster sequences during their evolution. While we have been able to show that the phylogenetic profiling approach improves the accuracy of the classifier, one drawback of its use might be that the final classifier recognizes a broader biological domain than the function of the original training set of sequences derived from the reference species. Finally, classifier predictions may represent cis-regulatory elements other than enhancers, for example, silencers and insulators [2], which would not be detected by our transgenic reporter assays.

In summary, a number of confounding factors influenced our ability to identify an enhancer signature that is specific for individual muscle FCs. However, despite these challenges, our successful identification of novel TF binding motifs responsible for the cell type-specific activity of FC enhancers encourages us that this is a tractable problem that can be solved by an iterative approach to the computational analysis of this and other complex developmental systems. Thus, future studies must focus on obtaining a larger training set of sequences in which enhancers are categorized based on their activities at single cell resolution, combined with the appropriate weighting of newly validated motifs that contribute to the expression pattern of interest. In this manner, each experimental round would improve the accuracy of the classifier.

Sequence Motifs Associated with FC Enhancers Are Functional and Can Be Used to Identify Novel Trans-Acting Factors

The motifs ranked by our classifier as having the highest discriminatory power are part of a large regulatory network that is known to be critical for mesoderm specification and myogenesis. These motifs include binding sites for JAK/STAT [57], Ets [93], bHLH [94], [95], Wingless/Tcf [49], [96], [97], Mef2 [66], homeodomain ([19], [20] and B. W. Busser, L. Shokri, S. A. Jaeger, S. S. Gisselbrecht, A. Singhania, M. F. Berger, B. Zhou, M. L. Bulyk and A. M. Michelson, unpublished data) and forkhead (X. Zhu, S. M. Ahmad, A. Aboukhalil, B. W. Busser, Y. Kim, T. R. Tansey, A. Haimovich, N. Jeffries, M. L. Bulyk, and A. M. Michelson, unpublished data) proteins. Furthermore, we previously suggested that Ets is part of a transcriptional code regulating the C1 subset of FC genes [5], which we validated here using site-directed mutational analysis of the Ndg enhancer, a previously characterized regulatory element associated with a C1 FC gene.

To extend the components of the myogenic regulatory network beyond these known TFs and motifs, we examined the function of the classifier-defined sequence motifs recognized by POU homeodomain and Myb proteins, transcription factors having no previously known role in Drosophila myogenesis. Mutagenesis of POUHD motifs attenuated the activity of the Ndg enhancer in many mesodermal cells. However, a zygotic loss-of-function mutation in acj6, the only POUHD that we found to be expressed in the mesoderm, had no effect on Ndg gene expression (data not shown). Given the strong maternal contribution to this gene [98], we used RNAi to knock down both maternal and zygotic acj6 transcripts, but this manipulation had no effect on Ndg-GFP reporter activity (data not shown). These findings leave unresolved the identity of the TF that binds to the motif in question. The future characterization of this TF, including exploring the possibility that it is not a POUHD protein, will require searching functional motifs against larger TF databases [99] or with STAMP [60], combined with analysis of the embryonic expression and function of any new candidates that emerge.

Inactivating mutations of the Myb binding sites in the Ndg enhancer led to extensive de-repression of the reporter in other mesodermal cells. Myb is a ubiquitously-expressed DNA binding protein which plays a critical role in controlling regulatory decisions during proliferation and differentiation of progenitor cells [100]. Identifying a putative role for Myb in myogenesis documents the power of this approach, since functional studies tend to focus on genes with restricted expression patterns. However, a definitive assessment requires examining the effect of loss-of-function mutations in Myb. In any event, as myogenesis in Drosophila occurs through a series of asymmetric and symmetric cell divisions [101], a role for Myb in regulating FC gene expression is entirely consistent with a transcriptional regulator acting at the interface between replication and transcription [102], [103]. Alternatively, Myb may cooperate with other TFs to activate cell or tissue-specific gene expression [104].

Interestingly, T-box motifs scored well in the classification, yet no role for T-box TFs has previously been described in Drosophila somatic muscle development, despite widespread functions of this TF class in mesoderm specification and myogenesis in vertebrates [105], [106], as well as cardiogenesis in Drosophila and vertebrates [62], [63], [107]. Here we show using both cis and trans tests of TF function, along with gene co-expression, that Org-1 is a muscle identity TF. In particular, the cis effects of Org-1 were documented in the FC enhancers associated with two known muscle identity TFs, Slou and Lbl, and org-1 expression localizes to the SBM and VT1, muscles in which the lb genes and slou, respectively, are the only previously described determinants of muscle identity [54], [108]. Slou function is critical for the proper development of muscles LO1 and VT1 and is further required to repress the lb genes in these cells, suggesting a co-regulatory relationship between slou and lb [54]. It is likely that org-1 acts upstream of slou and lb in this regulatory hierarchy since org-1 expression precedes slou and lb, and the ectopic expression of org-1 causes increased expression of slou and lb (Figure 7 and data not shown). In addition, the essential role of org-1 in this regulatory network is revealed by the effects of org-1 overexpression and RNAi knockdown on development of lb- and slou-expressing muscles. Interestingly, the mouse orthologs of org-1 and lb genes, Tbx1 and Lbx1, respectively, have been suggested to regulate myogenic differentiation in the limb [109][111]. Given the high degree of sequence similarity, and the close correspondence of expression patterns and functions in Drosophila and mouse, the collaborative roles of these two TFs in myogenesis appear to have been conserved through evolution.

Motif Combinatorics in FC Enhancers

Computational prediction of regulatory elements requires a thorough understanding of the TFs and motifs that orchestrate gene co-expression patterns. In prior studies, we established that 5-way and 3-way “AND” combinations of 3 signal-activated (Tcf, Mad and Pnt) plus 2 tissue-restricted (Twi and Tin) TFs constitute distinct regulatory models for different FC enhancers [5], [28], [29]. The present study significantly extend these prior combinatorial codes for FC gene regulation by identifying four additional classes of TFBSs that are critical for accurate FC enhancer activity, namely POUHD, Myb, Fkh and T-box motifs. Moreover, these findings provided us with an opportunity to examine the complete spectrum of regulatory motif usage across a collection of regulatory elements that are active in different muscle FCs, which led to the identification of 18 unique combinations of 11 TFBSs for the entire set of 18 known FC enhancers. Thus, unlike other cases that have been studied, a single enhancer archetype does not appear to exist for this subpopulation of myoblasts [23][25], [50]. This finding likely reflects the fact that although these elements all display FC activity, with some overlap at the level of individual cells, no two FC gene expression patterns directed by this enhancer set are identical.

The marked heterogeneity of FC enhancer architecture uncovered here reflects not only distinct combinations of various TF classes (including signal-activated, ubiquitous and both tissue- and cell type-specific TFs), but also diversity at other biological levels, including the unique identities of the thirty muscle FCs and their differentiated derivatives in each abdominal hemisegment, and the different gene expression patterns exhibited by those particular cells. Thus, TFBS combinatorics provide a plausible molecular explanation for the functional complexity of enhancers having related but non-identical activites at the resolution of individual cells in the context of the developing embryo.


We have investigated the transcriptional regulatory network specifying individual muscle FCs using an integrated genomics approach that includes identification of orthologous enhancers, de novo motif discovery, classification of enhancer sequence features, empirical testing of candidate enhancers, and cis-trans tests of target gene regulation. We also have established that a small set of training sequences can be expanded with orthologous sequences [76]. Moreover, motifs learned by the classifier were empirically found to be critical for the appropriate spatio-temporal activities of FC enhancers, and suggested new candidate TFs in the myogenic regulatory network. Using this approach, we identified one such candidate TF, Org-1, as a novel muscle identity TF, and further found that no two enhancers with related activities contain the same combination of TFBSs. The tools and strategy used here can be readily applied to other cell types to identify the motifs and trans-acting factors regulating a set of co-expressed genes. Finally, we anticipate that an iterative application of this approach, which could include training on datasets of different epigenetic marks associated with active enhancers [18], [80], [112], [113] or previous ChIP studies of known mesodermally-relevant TFs [114], will lead to further refinements in the determination of cell type-specific transcriptional codes.

Materials and Methods

Fly Stocks

Drosophila stocks containing the following transgenes and mutant alleles were used: UAS-org-1 (gift of G. Pflugfelder, Univ. Wurzburg, Germany), attP40 and nos-phiC31intNLS [115] (gift of N. Perrimon, Harvard University, USA), lbl-lacZ and Ndg-lacZ [5], ap-lacZ (gift of J. Botas, Baylor College, USA) [35], acj66 (gift of J. Carlson, Yale University, USA) [116], and twi-Gal4 [49].

Analysis of Transgenic Reporter Constructs and Embryo Staining

Enhancer regions were either synthesized in vitro (Integrated DNA Technologies, Coralville, IA, USA) or PCR-amplified and sequence-verified and then subcloned into the reporter vector pWattB-GFP (B. W. Busser, L. Shokri, S. A. Jaeger, S. S. Gisselbrecht, A. Singhania, M. F. Berger, B. Zhou, M. L. Bulyk and A. M. Michelson, unpublished data) or pWattB-nlacZ. The pWattB-nlacZ vector was constructed by cloning the EcoRI-SpeI fragment from a version of pH-pelican [117] in which nuclear lacZ replaced cytoplasmic lacZ into the EcoRI-SpeI sites in the pWattB-GFP vector. All constructs were targeted to attP40 [47] with phiC31-mediated integration [46], and homozygous viable insertion lines were obtained. Whole-embryo immunohistochemistry, in situ hybridization and fluorescent in situ hybridization with tyramide signal amplification (Invitrogen, Carlsbad, CA, USA) followed standard protocols [28]. Embryo collections for twi-Gal4 UAS-org-1 were incubated at 25°C. For fluorescent staining, the following antibodies were used: mouse anti-Ladybird early (Lbe) (1∶2500, gift of K. Jagla; Lbe and Lbl are co-expressed in the same mesodermal cells), rabbit anti-Slou (1∶200, gift of M. Baylies), chicken anti-GFP (1∶2000, Abcam, Cambridge, MA), mouse anti-βgal (1∶500, Promega, Madison, WI), rabbit anti-Kirre (1∶200, gift of K. Fischbach), rabbit anti-MHC (1∶500, gift of D. Kiehart), and guinea pig anti-Eve (1∶200, gift of D. Kosman).

RNA Interference Assay

Embryo RNAi was performed as previously described [22]. Using SnapDragon (, two independent gene segments for synthesis of org-1 double-stranded RNA (dsRNA) were selected with lengths of 570 and 473 bp and with less than 20 and 22 bp of identity to any other predicted gene, respectively. These segments of the org-1 gene were PCR-amplified from primary embryonic cDNA using the primers, CGTCCAAAAAGTTCAAGGGA and GCTCGTTCTCATCCAAGGAG (570 bp) and GCTCCAACAGAGCCAGAATC and CCGAACCGTAAAAACTTGGA (473 bp), and transcribed in vitro using the MEGAscript RNAi kit (Ambion, USA). lbl-GFP, slou-GFP or MHC-tauGFP embryos were dechorionated and injected with negative control (lacZ) or org-1 dsRNA at the syncytial blastoderm stage and allowed to develop to stage 14 or 16 before examination by fluorescence microscopy for assessment of reporter GFP expression. A similar protocol was used to assess the function of acj6 in Ndg-GFP embryos.

FC Enhancer and Control Sequences

The sixteen sequences in the training set of Drosophila melanogaster FC enhancers range in length from 311 to 2068 bp (average length 1232 bp), in GC-content from 39% to 49% (average GC-content 43%), and in repeat-content from 0% to 7% (average 1.5%). The twenty-four orthologs have similar characteristics, with an average length of 1311 bp, GC-content of 43% and repeat content of 5%. The control set comprised 1000 randomly selected D. melanogaster noncoding genomic sequences with length, GC- and repeat-content matching those of the enhancer set.

Identification of TFBSs

Putative TFBSs were identified by searching the sequences with MAST [118] for motifs in TRANSFAC Release 2009.2 [119], in addition to binding sequences for Tin, Twi and Pnt from the literature [5]. MAST was run independently on each individual sequence with default setup and parameters. In particular, for the final analysis of the TFBS composition of FC enhancers, we examined the sequences for the occurrence of 11 types of TFBSs: POUHD (V$OCT_01, V$POU1F1_Q6, V$OCT4_02), Tbx (V$TBX5_01, I$BYN_Q6), Myb (V$MYB_Q6), Fkh (V$FOXO3_01, V$FOXO1_Q5, V$FREAC2_01), HD (I$ABDA_Q6, V$CDX5_Q5, V$IFP_03, V$PAX4_02), and Mef2 (V$AMEF2_Q6, V$HMEF2_Q6) and binding sites for Tcf, Mad, Ets, Twi, Tin [5]. Since the Position Weight Matrices (PWMs) for Tcf, Mad, Ets, Twi, and Tin were constructed from only a small number of sequences and we obtained few significant matches using MAST, we re-inspected the sequences manually, searching for the known binding sites of these TFs.

Over-represented TFBSs were determined by comparing the occurrence of the motifs among query sequences and background genomic sequence, and applying Fisher's exact test. We used a P-value threshold of 0.05. When indicated, we adjusted the P-values for multiple testing using the procedure suggested by Benjamini and Hochberg [120].

Classifier Training

Each nucleotide sequence in the FC enhancer and control sets was represented by the number of putative TFBSs per base pair. Putative TFBSs were identified by searching the sequences for motifs derived from three different sources: (1) 892 TF binding specificities characterized in TRANSFAC, (2) 3 binding sequences for Tin, Twi, and Pnt from the literature [5], and (3) at most 50 motifs that PRIORITY [51] found to be over-represented in the training set of FC enhancers. In order to prevent the over-representation of motifs in D. melanogaster enhancer sequences with a large number of orthologs, de novo motifs were identified on a restricted set of 34 sequences, including at most two randomly selected orthologs for each D. melanogaster FC enhancer. Features relevant for distinguishing between enhancer sequences and controls were identified using linear support vector machine (SVM). We used a standard ten-fold cross-validation procedure to assess the accuracy of the classifier. In each fold of the cross-validation procedure, the de novo motifs were extracted using the training data, only, thereby ensuring that the test data were completely unseen before the predictions were made. The cross-validation procedure should help to prevent overfitting of the classifier.

SVM Parameter Selection

We used Support Vector Machines [121] with a linear kernel, which only requires setting the penalization coefficient C. The performance of the SVM was evaluated using the area under the receiver operating characteristic (ROC) curve, which yields values between 0.5 (for a completely random guess) and 1.0 (for a perfect classifier). In order to compensate for the data unbalance, FC enhancer sequences and controls were assigned different misclassification costs (SVM soft-margin constants), giving equal overall weight to each class.

Motif Ranking

Given a training set of instances x1, …, xl with associated labels y1, …, yl, linear SVM solves the optimization problem subject to and [122]. Thus, after obtaining a linear SVM model, the weight vector w can be used to decide the relevance of each feature [123]. The larger , the more important role of feature j in the decision function. We rank features—in our case, motifs—according to . For this purpose, we trained a classifier for 100 random partitions of the training data (containing two thirds of the total training data), computed the ranking for each feature, and finally ranked the features according to their median ranking.

Genome Scan

We scanned the whole-genome of D. melanogaster (BDGP Release 5 assembly) with a sliding window of length 1000 base pairs and overlaps of 500 base pairs. The length of the window corresponds approximately to the average length of the sequences in the training data set (1280 base pairs). We scored 137,364 sequences after excluding sequences which overlap annotated coding regions by at least 50%. The cut-off for the genome scan was defined to obtain a false positive rate (FPR) of at most 5% by training and testing 100 classifiers on random partitions of the training data (containing two thirds of the total training data).

Association between TFs and Sequence Motifs

TF annotation for PWMs was obtained from TRANSFAC and the Broad Institute MsigDB database [124].

Classifier Performance with Orthologs of D. melanogaster Mesodermal Enhancers

To understand the effects of a sample size on the classifier performances, we first extracted a dataset of Drosophila melanogaster 62 enhancers active in mesoderm from the REDfly database [32]. REDfly contains 176 partially overlapping enhancers active in mesoderm. To eliminate this redundancy, we clustered together overlapping sequences, and subsequently selected the shortest enhancer sequence from each cluster; sequences longer than 2 kb as well as sequences overlapping our dataset of enhancers active in muscle founder were excluded from the final dataset. Orthologs were selected randomly among sequences from 15 insect species [125] with nucleotide identity ranging from 50 to 80%, so that at most two orthologs were selected for each Drosophila melanogaster enhancer in REDfly. As controls, we randomly sampled for each enhancer (and orthologs) 10 non-coding sequences from the Drosophila melanogaster genome with similar length, GC- and repeat-content.

Each nucleotide sequence in the enhancer and control sets was represented by the number of putative TFBSs per base pair. Putative TFBSs were identified by searching the sequences with MAST [118] for motifs derived from two sources: (1) 892 TF binding specificities characterized in TRANSFAC Release 2009.2 [119], and (2) 3 binding sequences for Tin, Twi, and Pnt from the literature [5]. Features relevant for distinguishing between enhancer sequences and controls were identified using linear SVM.

Supporting Information

Figure S1.

Empirical validation of predicted FC enhancers conforming to a previously described regulatory model. Fluorescent in situ hybridization analysis of stage 11 embryos containing RhoGEF3-lacZ (A), FBX011-lacZ (B), cib-lacZ (C) or fra-lacZ (D) transgenes using probes for endogenous RhoGEF3 (A), FBX011 (B), cib (C), and fra (D) transcripts. Panels A′ to D′ show the corresponding signals for lacZ transcripts, and panels A″ to D″ show the merged channels. All enhancers were selected from previously identified candidates [5].


Figure S2.

Variation of the classification performance with increasing sample size. Samples were randomly selected from a dataset of 62 D. melanogaster enhancers active in various mesodermal cell types. The sample size was varied from 10 to 60 by an increment of 5. Each sample was used to train a Support Vector Machine (SVM) classifier. For each sample size, we compared the performance of the classifier trained exclusively with D. melanogaster (“dm3 only”) enhancers with that of a classifier that, in addition, was trained with up to two orthologs for each D. melanogaster enhancer (“dm3 with orthologs”). All classifiers were validated on sets comprising only D. melanogaster enhancers. Control sequences were randomly selected from regions of the D. melanogaster genome with comparable length, GC- and repeat-content. The entire process was repeated a total of 1000 times. (A) Performance of each classifier, measured by its AUC, estimated in a 10-fold cross-validation. Classifiers trained on D. melanogaster enhancers and their orthologous sequences with an AUC significantly greater than that of the corresponding classifier trained exclusively on D. melanogaster enhancers (P<0.05, Wilcoxon sign rank test) are marked with a red asterisk. (B) Precision of the estimated calculated based on the Root Mean Square (RMS) error. The RMS describes how well the AUC value estimated in the cross-validation represents the true AUC of the classifier and thus, how good is our assessment of the underlying model; the true AUC of each classifier was computed using the enhancers excluded from the randomly selected sample. (C) Number of enhancers recognized as such in at least 50% of the instances in which they were tested. In the cross-validation process each sequence is used exactly once for validation. Thus, for 100 randomly selected samples and their corresponding cross-validation processes, we counted the number of times each sequence scored positively, compared this number with the number of times each sequence had been included in a random sample, and repeated the complete procedure 10 times to estimate the variance of the results. Classifiers trained on D. melanogaster enhancers and their orthologous sequences consistently recognizing a significantly higher number of sequences as compared with the respective classifiers trained only on D. melanogaster enhancers (P<0.05, Wilcoxon sign rank test) are marked with a red asterisk. (D) Concordance of prediction outcome between each pair of 1000 classifiers, for each sample size. In this graph, the line segments represent the 95% confidence intervals surrounding the means. We compared the sequences positively scoring in the 10 folds of the cross-validation experiment between each pair of classifiers. Randomly sampled training and test datasets differ. The likelihood of observing a large overlap between two samples taken from the same (finite) population increases with the size of the samples. Therefore, larger datasets produce larger overlapping outcomes. However, for the same sample size, the overlap between the outcomes of classifiers trained on D. melanogaster enhancers and their orthologous sequences is systematically significantly higher as compared to that of classifiers trained only on D. melanogaster.


Figure S3.

Binding site conservation and evolutionary flux in orthologous FC enhancers. Sequences of the lbl (A), ap (B), Ndg (C) and eve (D) enhancers were aligned against the orthologous enhancers of D. persimilis (D. per), D. ananassae (D. ana), or D. mojavensis (D. moj). Motif matches to Tcf (black), Mad (blue), Ets (red), Twi (green) and Tin (purple) for these co-regulating TFs of the eve MHE are shown. For the Ndg, lbl, and ap enhancers, motif matches to the co-regulating TFs Ets (red), Twi (green) and Tin (purple) are shown. Motifs are based on known functional binding sites (D. mel eve MHE, [28]) or matrices compiled from the literature for Tcf, Mad, Twi and Tin [5] for the other sequences. K-mer matches for protein binding microarray data for the mouse ortholog of Pnt (Ets1) are shown for Ets binding sites. For lbl, a motif match to a functional Slou-preferred binding site (blue) is shown (B. W. Busser, L. Shokri, S. A. Jaeger, S. S. Gisselbrecht, A. Singhania, M. F. Berger, B. Zhou, M. L. Bulyk and A. M. Michelson, unpublished data). For ap, Antennapedia (Antp)-protected functional binding sites are shown for D. melanogaster [35]. Similar sites predicted with protein binding microarray data for Ubx and AbdB are shown for D. mojavensis ([35] and B. W. Busser, L. Shokri, S. A. Jaeger, S. S. Gisselbrecht, A. Singhania, M. F. Berger, B. Zhou, M. L. Bulyk and A. M. Michelson, unpublished data).


Figure S4.

TFs most relevant to the FC enhancer classification. Presence (red)/absence (gray) of the fifty most relevant TF binding motifs in the set of enhancer sequences used for training. TFs were ranked according to the SVM weights of their respective motifs, which represent their discriminating power. We only considered the highest scoring motif for each TF (median ranks computed across 10 random partitions of the training data varied between 12 and 129). Control TFs were randomly chosen among TFs for which the highest scoring motif had a neutral weight (median ranks computed across 10 random partitions of the training data varied between 437 and 450). TFs and sequences have been clustered using average linkage and Euclidean distance. The phylogenetic tree represents the relations among the sequences in the training data, built on the presence/absence of the motifs for the most relevant TFs. De novo motifs were explicitly excluded from this analysis.


Figure S5.

PRIORITY motifs are representations of known motifs. Many of the de novo motifs exhibiting the highest power discriminating FC enhancers from background sequence resemble motifs of known transcription factors with roles in mesoderm and FC development. The identity of the transcription factors binding to the de novo motifs was queried using STAMP [60] and the data set of binding affinities FlyReg [32].


Figure S6.

Motifs identified by the classifier that are overrepresented in FC enhancers and their orthologs. Graphs comparing the representation of V$ETS_Q4 (A), V$POU1F1_Q6 (B), V$MYB_Q6 (C) V$TBX5_01 (D) and V$FOX03_01 (E) motifs in D. melanogaster FC enhancers (dm3) and orthologous and control sequences. Position weight matrices for each of these TFs are also shown.


Figure S7.

The wild-type activities of FC enhancers require input from classifier-defined Ets and Fkh TF binding motifs. (A) GFP (green) expression driven by a version of the Ndg enhancer in which Ets sites are selectively inactivated (NdgETS-GFP) is extinguished compared to β-Gal (magenta) driven by NdgWT-lacZ. We have previously demonstrated the activity of this enhancer in a subset of FCs, two pericardial and two cardial cells of the heart, the gut musculature and two cells of the central nervous system ([5] and X. Zhu, S. M. Ahmad, A. Aboukhalil, B. W. Busser, Y. Kim, T. R. Tansey, A. Haimovich, N. Jeffries, M. L. Bulyk, and A. M. Michelson, unpublished data). Of note, the entirety of this expression pattern is extinguished in the absence of Ets binding sites, while the reporter is de-repressed into additional cells of the central nervous system (Figure S7A and data not shown). The locations of Ets binding sites in the Ndg enhancer are indicated in Figure 6B and Table S4. (B) TRANSFAC position weight matrix for the Fkh (V$FOX03_01) enriched motif identified by the classifier, and locations of Fkh binding sites in the ap muscle FC enhancer. Although the Ndg enhancer contains several examples of this motif, mutagenesis studies revealed that Fkh binding sites are not required for the expression of Ndg in muscle FCs (X. Zhu, S. M. Ahmad, A. Aboukhalil, B. W. Busser, Y. Kim, T. R. Tansey, A. Haimovich, N. Jeffries, M. L. Bulyk, and A. M. Michelson, unpublished data). (C) Activity of the wild-type ap enhancer in lateral transverse muscles, as revealed by GFP expression driven by the apWT-GFP transgene. (D) Complete loss of ap enhancer activity after Fkh binding sites are inactivated (apFkh-GFP).


Figure S8.

Co-expression of org-1 with Slou and Lbl. Expression of org-1 RNA in stage 11 (A) and stage 13 (B) embryos detected by in situ hybridization. Co-expression of org-1 RNA (purple) with Lbl protein (brown) in the Lbl-expressing SBM FC (stage 11; C) and myotube (stage 13; D). Co-expression of org-1 RNA (purple) with Slou protein (brown) in the LO1 and VT1 FCs (stage 11; E) and myotubes (stage 13; F). CVM: circular visceral muscle which expresses org-1 but neither lbl nor slou.


Figure S9.

Motif distribution in FC enhancers. (A) The heatmap illustrates the occurrence of 11 motifs that have been shown to be relevant for FC regulation in the 18 sequences that have been positively assayed for FC enhancer activity. Columns and rows are clustered using Ward's method and binary distances. (B) Maximum fraction of the 18 assayed FC enhancer sequences sharing N motifs that have been shown to be relevant for FC regulation, for N in {1, 2, …, 11}.


Table S1.

Expression and genomic coordinates of D. melanogaster and orthologous enhancer regions used for training, and the list of FC genes considered in this study.


Table S2.

Genomic coordinates and ontology of REDfly D. melanogaster mesodermal enhancers. The majority of these enhancers have multiple activities.


Table S3.

Classifier predictions and the activity and genomic coordinates of the tested enhancer predictions.


Table S4.

Motifs identified by the classifier and the mapping of TFBSs in the Ndg, lbl, slou and ap FC enhancers.


Table S5.

Summary of in situ hybridization analysis of T-box and POUHD family members.


Table S6.

Mapping of TFBSs in all FC enhancers.


Text S1.

Conservation Profile of Candidate FC Enhancers and TFBS Distribution Among Orthologs of Candidate FC Enhancers.



We thank N. Perrimon, G. Pflugfelder, J. Botas, M. Baylies, K. Fischbach, and K. Jagla for providing fly strains and antibodies; S. Gisselbrecht for the pWattB-GFP vector; and C. Sonnenbrot for technical assistance.

Author Contributions

Conceived and designed the experiments: BWB LT YK TT IO AMM. Performed the experiments: BWB LT YK TT. Analyzed the data: BWB LT YK TT IO AMM. Contributed reagents/materials/analysis tools: MJB. Wrote the paper: BWB LT IO AMM.


  1. 1. Carroll SB, Grenier JK, Weatherbee SD (2005) From DNA to Diversity. Molecular Genetics and the Evolution of Animal Design. Malden, Massachusetts: Blackwell Publishing. SB CarrollJK GrenierSD Weatherbee2005From DNA to Diversity. Molecular Genetics and the Evolution of Animal DesignMalden, MassachusettsBlackwell Publishing
  2. 2. Davidson E (2006) 304 p.E. Davidson2006The Regulatory Genome: Gene Regulatory Networks In Development And Evolution: Academic Press. 304 The Regulatory Genome: Gene Regulatory Networks In Development And Evolution: Academic Press.
  3. 3. Berman BP, Nibu Y, Pfeiffer BD, Tomancak P, Celniker SE, et al. (2002) Exploiting transcription factor binding site clustering to identify cis-regulatory modules involved in pattern formation in the Drosophila genome. Proc Natl Acad Sci U S A 99: 757–762.BP BermanY. NibuBD PfeifferP. TomancakSE Celniker2002Exploiting transcription factor binding site clustering to identify cis-regulatory modules involved in pattern formation in the Drosophila genome.Proc Natl Acad Sci U S A99757762
  4. 4. Markstein M, Markstein P, Markstein V, Levine M (2002) Genome-wide analysis of clustered Dorsal binding sites identifies putative target genes in the Drosophila embryo. Proc Natl Acad Sci U S A 99: 763–768.M. MarksteinP. MarksteinV. MarksteinM. Levine2002Genome-wide analysis of clustered Dorsal binding sites identifies putative target genes in the Drosophila embryo.Proc Natl Acad Sci U S A99763768
  5. 5. Philippakis AA, Busser BW, Gisselbrecht SS, He FS, Estrada B, et al. (2006) Expression-guided in silico evaluation of candidate cis regulatory codes for Drosophila muscle founder cells. PLoS Comput Biol 2: e53.AA PhilippakisBW BusserSS GisselbrechtFS HeB. Estrada2006Expression-guided in silico evaluation of candidate cis regulatory codes for Drosophila muscle founder cells.PLoS Comput Biol2e53
  6. 6. Mahaffey JW (2005) Assisting Hox proteins in controlling body form: are there new lessons from flies (and mammals)? Curr Opin Genet Dev 15: 422–429.JW Mahaffey2005Assisting Hox proteins in controlling body form: are there new lessons from flies (and mammals)?Curr Opin Genet Dev15422429
  7. 7. Narlikar L, Sakabe NJ, Blanski AA, Arimura FE, Westlund JM, et al. (2010) Genome-wide discovery of human heart enhancers. Genome Res 20: 381–392.L. NarlikarNJ SakabeAA BlanskiFE ArimuraJM Westlund2010Genome-wide discovery of human heart enhancers.Genome Res20381392
  8. 8. MacArthur S, Li XY, Li J, Brown JB, Chu HC, et al. (2009) Developmental roles of 21 Drosophila transcription factors are determined by quantitative differences in binding to an overlapping set of thousands of genomic regions. Genome Biol 10: R80.S. MacArthurXY LiJ. LiJB BrownHC Chu2009Developmental roles of 21 Drosophila transcription factors are determined by quantitative differences in binding to an overlapping set of thousands of genomic regions.Genome Biol10R80
  9. 9. Biggin MD, McGinnis W (1997) Regulation of segmentation and segmental identity by Drosophila homeoproteins: the role of DNA binding in functional activity and specificity. Development 124: 4425–4433.MD BigginW. McGinnis1997Regulation of segmentation and segmental identity by Drosophila homeoproteins: the role of DNA binding in functional activity and specificity.Development12444254433
  10. 10. Ivan A, Halfon MS, Sinha S (2008) Computational discovery of cis-regulatory modules in Drosophila without prior knowledge of motifs. Genome Biol 9: R22.A. IvanMS HalfonS. Sinha2008Computational discovery of cis-regulatory modules in Drosophila without prior knowledge of motifs.Genome Biol9R22
  11. 11. Leung G, Eisen MB (2009) Identifying cis-regulatory sequences by word profile similarity. PLoS ONE 4: e6901.G. LeungMB Eisen2009Identifying cis-regulatory sequences by word profile similarity.PLoS ONE4e6901
  12. 12. Nazina AG, Papatsenko DA (2003) Statistical extraction of Drosophila cis-regulatory modules using exhaustive assessment of local word frequency. BMC Bioinformatics 4: 65.AG NazinaDA Papatsenko2003Statistical extraction of Drosophila cis-regulatory modules using exhaustive assessment of local word frequency.BMC Bioinformatics465
  13. 13. Kantorovitz MR, Kazemian M, Kinston S, Miranda-Saavedra D, Zhu Q, et al. (2009) Motif-blind, genome-wide discovery of cis-regulatory modules in Drosophila and mouse. Dev Cell 17: 568–579.MR KantorovitzM. KazemianS. KinstonD. Miranda-SaavedraQ. Zhu2009Motif-blind, genome-wide discovery of cis-regulatory modules in Drosophila and mouse.Dev Cell17568579
  14. 14. Abnizova I, te Boekhorst R, Walter K, Gilks WR (2005) Some statistical properties of regulatory DNA sequences, and their use in predicting regulatory regions in the Drosophila genome: the fluffy-tail test. BMC Bioinformatics 6: 109.I. AbnizovaR. te BoekhorstK. WalterWR Gilks2005Some statistical properties of regulatory DNA sequences, and their use in predicting regulatory regions in the Drosophila genome: the fluffy-tail test.BMC Bioinformatics6109
  15. 15. Nazina AG, Papatsenko DA (2003) Statistical extraction of Drosophila cis-regulatory modules using exhaustive assessment of local word frequency. BMC Bioinformatics 4: 65.AG NazinaDA Papatsenko2003Statistical extraction of Drosophila cis-regulatory modules using exhaustive assessment of local word frequency.BMC Bioinformatics465
  16. 16. Li L, Zhu Q, He X, Sinha S, Halfon MS (2007) Large-scale analysis of transcriptional cis-regulatory modules reveals both common features and distinct subclasses. Genome Biol 8: R101.L. LiQ. ZhuX. HeS. SinhaMS Halfon2007Large-scale analysis of transcriptional cis-regulatory modules reveals both common features and distinct subclasses.Genome Biol8R101
  17. 17. Busser BW, Bulyk ML, Michelson AM (2008) Toward a systems-level understanding of developmental regulatory networks. Curr Opin Genet Dev 18: 521–529.BW BusserML BulykAM Michelson2008Toward a systems-level understanding of developmental regulatory networks.Curr Opin Genet Dev18521529
  18. 18. Ruiz-Gomez M (1998) Muscle patterning and specification in Drosophila. Int J Dev Biol 42: 283–290.M. Ruiz-Gomez1998Muscle patterning and specification in Drosophila.Int J Dev Biol42283290
  19. 19. Baylies MK, Bate M, Ruiz Gomez M (1998) Myogenesis: a view from Drosophila. Cell 93: 921–927.MK BayliesM. BateM. Ruiz Gomez1998Myogenesis: a view from Drosophila.Cell93921927
  20. 20. Tixier V, Bataille L, Jagla K (2010) Diversification of muscle types: recent insights from Drosophila. Exp Cell Res 316: 3019–3027.V. TixierL. BatailleK. Jagla2010Diversification of muscle types: recent insights from Drosophila.Exp Cell Res31630193027
  21. 21. Berkes CA, Tapscott SJ (2005) MyoD and the transcriptional control of myogenesis. Semin Cell Dev Biol 16: 585–595.CA BerkesSJ Tapscott2005MyoD and the transcriptional control of myogenesis.Semin Cell Dev Biol16585595
  22. 22. Estrada B, Choe SE, Gisselbrecht SS, Michaud S, Raj L, et al. (2006) An Integrated Strategy for Analyzing the Unique Developmental Programs of Different Myoblast Subtypes. PLoS Genet 2: e16.B. EstradaSE ChoeSS GisselbrechtS. MichaudL. Raj2006An Integrated Strategy for Analyzing the Unique Developmental Programs of Different Myoblast Subtypes.PLoS Genet2e16
  23. 23. Crocker J, Potter N, Erives A (2010) Dynamic evolution of precise regulatory encodings creates the clustered site signature of enhancers. Nature communications 1: 99.J. CrockerN. PotterA. Erives2010Dynamic evolution of precise regulatory encodings creates the clustered site signature of enhancers.Nature communications199
  24. 24. Crocker J, Tamori Y, Erives A (2008) Evolution acts on enhancer organization to fine-tune gradient threshold readouts. PLoS Biol 6: e263.J. CrockerY. TamoriA. Erives2008Evolution acts on enhancer organization to fine-tune gradient threshold readouts.PLoS Biol6e263
  25. 25. Erives A, Levine M (2004) Coordinate enhancers share common organizational features in the Drosophila genome. Proc Natl Acad Sci USA 101: 3851–3856.A. ErivesM. Levine2004Coordinate enhancers share common organizational features in the Drosophila genome.Proc Natl Acad Sci USA10138513856
  26. 26. Ludwig M, Bergman C, Patel N, Kreitman M (2000) Evidence for stabilizing selection in a eukaryotic enhancer element. Nature 403: 564–567.M. LudwigC. BergmanN. PatelM. Kreitman2000Evidence for stabilizing selection in a eukaryotic enhancer element.Nature403564567
  27. 27. Swanson CI, Evans NC, Barolo S (2010) Structural rules and complex regulatory circuitry constrain expression of a Notch- and EGFR-regulated eye enhancer. Dev Cell 18: 359–370.CI SwansonNC EvansS. Barolo2010Structural rules and complex regulatory circuitry constrain expression of a Notch- and EGFR-regulated eye enhancer.Dev Cell18359370
  28. 28. Halfon MS, Carmena A, Gisselbrecht S, Sackerson CM, Jiménez F, et al. (2000) Ras pathway specificity is determined by the integration of multiple signal-activated and tissue-restricted transcription factors. Cell 103: 63–74.MS HalfonA. CarmenaS. GisselbrechtCM SackersonF. Jiménez2000Ras pathway specificity is determined by the integration of multiple signal-activated and tissue-restricted transcription factors.Cell1036374
  29. 29. Halfon MS, Grad Y, Church GM, Michelson AM (2002) Computation-based discovery of related transcriptional regulatory modules and motifs using an experimentally validated combinatorial model. Genome Res 12: 1019–1028.MS HalfonY. GradGM ChurchAM Michelson2002Computation-based discovery of related transcriptional regulatory modules and motifs using an experimentally validated combinatorial model.Genome Res1210191028
  30. 30. Han Z, Fujioka M, Su M, Liu M, Jaynes JB, et al. (2002) Transcriptional integration of competence modulated by mutual repression generates cell-type specificity within the cardiogenic mesoderm. Dev Biol 252: 225–240.Z. HanM. FujiokaM. SuM. LiuJB Jaynes2002Transcriptional integration of competence modulated by mutual repression generates cell-type specificity within the cardiogenic mesoderm.Dev Biol252225240
  31. 31. Knirr S, Frasch M (2001) Molecular integration of inductive and mesoderm-intrinsic inputs governs even-skipped enhancer activity in a subset of pericardial and dorsal muscle progenitors. Developmental Biology 238: 13–26.S. KnirrM. Frasch2001Molecular integration of inductive and mesoderm-intrinsic inputs governs even-skipped enhancer activity in a subset of pericardial and dorsal muscle progenitors.Developmental Biology2381326
  32. 32. Gallo SM, Gerrard DT, Miner D, Simich M, Des Soye B, et al. (2011) REDfly v3.0: toward a comprehensive database of transcriptional regulatory elements in Drosophila. Nucleic Acids Res 39: D118–123.SM GalloDT GerrardD. MinerM. SimichB. Des Soye2011REDfly v3.0: toward a comprehensive database of transcriptional regulatory elements in Drosophila.Nucleic Acids Res39D118123
  33. 33. Visel A, Minovitsky S, Dubchak I, Pennacchio LA (2007) VISTA Enhancer Browser–a database of tissue-specific human enhancers. Nucleic acids research 35: D88–92.A. ViselS. MinovitskyI. DubchakLA Pennacchio2007VISTA Enhancer Browser–a database of tissue-specific human enhancers.Nucleic acids research35D8892
  34. 34. Woolfe A, Goodson M, Goode DK, Snell P, McEwen GK, et al. (2005) Highly conserved non-coding sequences are associated with vertebrate development. PLoS Biol 3: e7.A. WoolfeM. GoodsonDK GoodeP. SnellGK McEwen2005Highly conserved non-coding sequences are associated with vertebrate development.PLoS Biol3e7
  35. 35. Capovilla M, Kambris Z, Botas J (2001) Direct regulation of the muscle-identity gene apterous by a Hox protein in the somatic mesoderm. Development 128: 1221–1230.M. CapovillaZ. KambrisJ. Botas2001Direct regulation of the muscle-identity gene apterous by a Hox protein in the somatic mesoderm.Development12812211230
  36. 36. Dubois L, Enriquez J, Daburon V, Crozet F, Lebreton G, et al. (2007) Collier transcription in a single Drosophila muscle lineage: the combinatorial control of muscle identity. Development 134: 4347–4355.L. DuboisJ. EnriquezV. DaburonF. CrozetG. Lebreton2007Collier transcription in a single Drosophila muscle lineage: the combinatorial control of muscle identity.Development13443474355
  37. 37. Holloway AK, Begun DJ, Siepel A, Pollard KS (2008) Accelerated sequence divergence of conserved genomic elements in Drosophila melanogaster. Genome Res 18: 1592–1601.AK HollowayDJ BegunA. SiepelKS Pollard2008Accelerated sequence divergence of conserved genomic elements in Drosophila melanogaster.Genome Res1815921601
  38. 38. Loots GG, Locksley RM, Blankespoor CM, Wang ZE, Miller W, et al. (2000) Identification of a coordinate regulator of interleukins 4, 13, and 5 by cross-species sequence comparisons. Science 288: 136–140.GG LootsRM LocksleyCM BlankespoorZE WangW. Miller2000Identification of a coordinate regulator of interleukins 4, 13, and 5 by cross-species sequence comparisons.Science288136140
  39. 39. Ovcharenko I, Loots GG, Hardison RC, Miller W, Stubbs L (2004) zPicture: dynamic alignment and visualization tool for analyzing conservation profiles. Genome research 14: 472–477.I. OvcharenkoGG LootsRC HardisonW. MillerL. Stubbs2004zPicture: dynamic alignment and visualization tool for analyzing conservation profiles.Genome research14472477
  40. 40. Hare EE, Peterson BK, Iyer VN, Meier R, Eisen MB (2008) Sepsid even-skipped enhancers are functionally conserved in Drosophila despite lack of sequence conservation. PLoS Genet 4: e1000106.EE HareBK PetersonVN IyerR. MeierMB Eisen2008Sepsid even-skipped enhancers are functionally conserved in Drosophila despite lack of sequence conservation.PLoS Genet4e1000106
  41. 41. Arnosti DN, Kulkarni MM (2005) Transcriptional enhancers: Intelligent enhanceosomes or flexible billboards? J Cell Biochem 94: 890–898.DN ArnostiMM Kulkarni2005Transcriptional enhancers: Intelligent enhanceosomes or flexible billboards?J Cell Biochem94890898
  42. 42. Bryson-Richardson RJ, Currie PD (2008) The genetics of vertebrate myogenesis. Nat Rev Genet 9: 632–646.RJ Bryson-RichardsonPD Currie2008The genetics of vertebrate myogenesis.Nat Rev Genet9632646
  43. 43. Kim SY (2009) Effects of sample size on robustness and prediction accuracy of a prognostic gene signature. BMC bioinformatics 10: 147.SY Kim2009Effects of sample size on robustness and prediction accuracy of a prognostic gene signature.BMC bioinformatics10147
  44. 44. Hanczar B, Hua J, Sima C, Weinstein J, Bittner M, et al. (2010) Small-sample precision of ROC-related estimates. Bioinformatics 26: 822–830.B. HanczarJ. HuaC. SimaJ. WeinsteinM. Bittner2010Small-sample precision of ROC-related estimates.Bioinformatics26822830
  45. 45. Raudys SJ, Jain AK (1991) Small sample size effects in statistical pattern recognition: recommendations for practitioners. IEEE Transactions on Pattern Analysis and Machine Intelligence 13: 252–264.SJ RaudysAK Jain1991Small sample size effects in statistical pattern recognition: recommendations for practitioners.IEEE Transactions on Pattern Analysis and Machine Intelligence13252264
  46. 46. Groth AC, Fish M, Nusse R, Calos MP (2004) Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. Genetics 166: 1775–1782.AC GrothM. FishR. NusseMP Calos2004Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31.Genetics16617751782
  47. 47. Markstein M, Pitsouli C, Villalta C, Celniker SE, Perrimon N (2008) Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat Genet 40: 476–483.M. MarksteinC. PitsouliC. VillaltaSE CelnikerN. Perrimon2008Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes.Nat Genet40476483
  48. 48. Frasch M, Hoey T, Rushlow C, Doyle H, Levine M (1987) Characterization and localization of the even-skipped protein of Drosophila. EMBO J 6: 749–759.M. FraschT. HoeyC. RushlowH. DoyleM. Levine1987Characterization and localization of the even-skipped protein of Drosophila.EMBO J6749759
  49. 49. Carmena A, Gisselbrecht S, Harrison J, Jiménez F, Michelson AM (1998) Combinatorial signaling codes for the progressive determination of cell fates in the Drosophila embryonic mesoderm. Genes Dev 12: 3910–3922.A. CarmenaS. GisselbrechtJ. HarrisonF. JiménezAM Michelson1998Combinatorial signaling codes for the progressive determination of cell fates in the Drosophila embryonic mesoderm.Genes Dev1239103922
  50. 50. Senger K, Armstrong GW, Rowell WJ, Kwan JM, Markstein M, et al. (2004) Immunity regulatory DNAs share common organizational features in Drosophila. Mol Cell 13: 19–32.K. SengerGW ArmstrongWJ RowellJM KwanM. Markstein2004Immunity regulatory DNAs share common organizational features in Drosophila.Mol Cell131932
  51. 51. Narlikar L, Gordan R, Ohler U, Hartemink AJ (2006) Informative priors based on transcription factor structural class improve de novo motif discovery. Bioinformatics 22: e384–392.L. NarlikarR. GordanU. OhlerAJ Hartemink2006Informative priors based on transcription factor structural class improve de novo motif discovery.Bioinformatics22e384392
  52. 52. Beer MA, Tavazoie S (2004) Predicting gene expression from sequence. Cell 117: 185–198.MA BeerS. Tavazoie2004Predicting gene expression from sequence.Cell117185198
  53. 53. Blow MJ, McCulley DJ, Li Z, Zhang T, Akiyama JA, et al. (2010) ChIP-Seq identification of weakly conserved heart enhancers. Nature genetics 42: 806–810.MJ BlowDJ McCulleyZ. LiT. ZhangJA Akiyama2010ChIP-Seq identification of weakly conserved heart enhancers.Nature genetics42806810
  54. 54. Knirr S, Azpiazu N, Frasch M (1999) The role of the NK-homeobox gene slouch (S59) in somatic muscle patterning. Development 126: 4525–4535.S. KnirrN. AzpiazuM. Frasch1999The role of the NK-homeobox gene slouch (S59) in somatic muscle patterning.Development12645254535
  55. 55. Arnone MI, Davidson EH (1997) The hardwiring of development: organization and function of genomic regulatory systems. Development 124: 1851–1864.MI ArnoneEH Davidson1997The hardwiring of development: organization and function of genomic regulatory systems.Development12418511864
  56. 56. Grossniklaus U, Pearson RK, Gehring WJ (1992) The Drosophila sloppy paired locus encodes two proteins involved in segmentation that show homology to mammalian transcription factors. Genes Dev 6: 1030–1051.U. GrossniklausRK PearsonWJ Gehring1992The Drosophila sloppy paired locus encodes two proteins involved in segmentation that show homology to mammalian transcription factors.Genes Dev610301051
  57. 57. Liu YH, Jakobsen JS, Valentin G, Amarantos I, Gilmour DT, et al. (2009) A systematic analysis of Tinman function reveals Eya and JAK-STAT signaling as essential regulators of muscle development. Dev Cell 16: 280–291.YH LiuJS JakobsenG. ValentinI. AmarantosDT Gilmour2009A systematic analysis of Tinman function reveals Eya and JAK-STAT signaling as essential regulators of muscle development.Dev Cell16280291
  58. 58. Jagla K, Bellard M, Frasch M (2001) A cluster of Drosophila homeobox genes involved in mesoderm differentiation programs. Bioessays 23: 125–133.K. JaglaM. BellardM. Frasch2001A cluster of Drosophila homeobox genes involved in mesoderm differentiation programs.Bioessays23125133
  59. 59. Michelson AM (1994) Muscle pattern diversification in Drosophila is determined by the autonomous function of homeotic genes in the embryonic mesoderm. Development 120: 755–768.AM Michelson1994Muscle pattern diversification in Drosophila is determined by the autonomous function of homeotic genes in the embryonic mesoderm.Development120755768
  60. 60. Mahony S, Benos PV (2007) STAMP: a web tool for exploring DNA-binding motif similarities. Nucleic Acids Res 35: W253–258.S. MahonyPV Benos2007STAMP: a web tool for exploring DNA-binding motif similarities.Nucleic Acids Res35W253258
  61. 61. Bodmer R (1993) The gene tinman is required for specification of the heart and visceral muscles in Drosophila. Development 118: 719–729.R. Bodmer1993The gene tinman is required for specification of the heart and visceral muscles in Drosophila.Development118719729
  62. 62. Reim I, Frasch M (2005) The Dorsocross T-box genes are key components of the regulatory network controlling early cardiogenesis in Drosophila. Development 132: 4911–4925.I. ReimM. Frasch2005The Dorsocross T-box genes are key components of the regulatory network controlling early cardiogenesis in Drosophila.Development13249114925
  63. 63. Reim I, Mohler JP, Frasch M (2005) Tbx20-related genes, mid and H15, are required for tinman expression, proper patterning, and normal differentiation of cardioblasts in Drosophila. Mech Dev 122: 1056–1069.I. ReimJP MohlerM. Frasch2005Tbx20-related genes, mid and H15, are required for tinman expression, proper patterning, and normal differentiation of cardioblasts in Drosophila.Mech Dev12210561069
  64. 64. Olson EN (2006) Gene regulatory networks in the evolution and development of the heart. Science 313: 1922–1927.EN Olson2006Gene regulatory networks in the evolution and development of the heart.Science31319221927
  65. 65. Porsch M, Sauer M, Schulze S, Bahlo A, Roth M, et al. (2005) The relative role of the T-domain and flanking sequences for developmental control and transcriptional regulation in protein chimeras of Drosophila OMB and ORG-1. Mech Dev 122: 81–96.M. PorschM. SauerS. SchulzeA. BahloM. Roth2005The relative role of the T-domain and flanking sequences for developmental control and transcriptional regulation in protein chimeras of Drosophila OMB and ORG-1.Mech Dev1228196
  66. 66. Black BL, Olson EN (1998) Transcriptional control of muscle development by myocyte enhancer factor-2 MEF-2 proteins. Annu Rev Cell Dev Biol 14: 167–196.BL BlackEN Olson1998Transcriptional control of muscle development by myocyte enhancer factor-2 MEF-2 proteins.Annu Rev Cell Dev Biol14167196
  67. 67. Enriquez J, Boukhatmi H, Dubois L, Philippakis AA, Bulyk ML, et al. (2010) Multi-step control of muscle diversity by Hox proteins in the Drosophila embryo. Development 137: 457–466.J. EnriquezH. BoukhatmiL. DuboisAA PhilippakisML Bulyk2010Multi-step control of muscle diversity by Hox proteins in the Drosophila embryo.Development137457466
  68. 68. Bourgouin C, Lundgren SE, Thomas JB (1992) apterous is a Drosophila LIM domain gene required for the development of a subset of embryonic muscles. Neuron 9: 549–561.C. BourgouinSE LundgrenJB Thomas1992apterous is a Drosophila LIM domain gene required for the development of a subset of embryonic muscles.Neuron9549561
  69. 69. Nose A, Isshiki T, Takeichi M (1998) Regional specification of muscle progenitors in Drosophila: the role of the msh homeobox gene. Development 125: 215–223.A. NoseT. IsshikiM. Takeichi1998Regional specification of muscle progenitors in Drosophila: the role of the msh homeobox gene.Development125215223
  70. 70. Carmena A, Buff E, Halfon MS, Gisselbrecht S, Jimenez F, et al. (2002) Reciprocal regulatory interactions between the Notch and Ras signaling pathways in the Drosophila embryonic mesoderm. Dev Biol 244: 226–242.A. CarmenaE. BuffMS HalfonS. GisselbrechtF. Jimenez2002Reciprocal regulatory interactions between the Notch and Ras signaling pathways in the Drosophila embryonic mesoderm.Dev Biol244226242
  71. 71. Visel A, Blow MJ, Li Z, Zhang T, Akiyama JA, et al. (2009) ChIP-seq accurately predicts tissue-specific activity of enhancers. Nature 457: 854–858.A. ViselMJ BlowZ. LiT. ZhangJA Akiyama2009ChIP-seq accurately predicts tissue-specific activity of enhancers.Nature457854858
  72. 72. Ernst J, Kheradpour P, Mikkelsen TS, Shoresh N, Ward LD, et al. (2011) Mapping and analysis of chromatin state dynamics in nine human cell types. Nature 473: 43–49.J. ErnstP. KheradpourTS MikkelsenN. ShoreshLD Ward2011Mapping and analysis of chromatin state dynamics in nine human cell types.Nature4734349
  73. 73. Negre N, Brown CD, Ma L, Bristow CA, Miller SW, et al. (2011) A cis-regulatory map of the Drosophila genome. Nature 471: 527–531.N. NegreCD BrownL. MaCA BristowSW Miller2011A cis-regulatory map of the Drosophila genome.Nature471527531
  74. 74. Hon G, Ren B, Wang W (2008) ChromaSig: a probabilistic approach to finding common chromatin signatures in the human genome. PLoS Comput Biol 4: e1000201.G. HonB. RenW. Wang2008ChromaSig: a probabilistic approach to finding common chromatin signatures in the human genome.PLoS Comput Biol4e1000201
  75. 75. Narlikar L, Sakabe NJ, Blanski AA, Arimura FE, Westlund JM, et al. (2010) Genome-wide discovery of human heart enhancers. Genome research 20: 381–392.L. NarlikarNJ SakabeAA BlanskiFE ArimuraJM Westlund2010Genome-wide discovery of human heart enhancers.Genome research20381392
  76. 76. Rouault H, Mazouni K, Couturier L, Hakim V, Schweisguth F (2010) Genome-wide identification of cis-regulatory motifs and modules underlying gene coregulation using statistics and phylogeny. Proc Natl Acad Sci U S A 107: 14615–14620.H. RouaultK. MazouniL. CouturierV. HakimF. Schweisguth2010Genome-wide identification of cis-regulatory motifs and modules underlying gene coregulation using statistics and phylogeny.Proc Natl Acad Sci U S A1071461514620
  77. 77. Griffith OL, Montgomery SB, Bernier B, Chu B, Kasaian K, et al. (2008) ORegAnno: an open-access community-driven resource for regulatory annotation. Nucleic acids research 36: D107–113.OL GriffithSB MontgomeryB. BernierB. ChuK. Kasaian2008ORegAnno: an open-access community-driven resource for regulatory annotation.Nucleic acids research36D107113
  78. 78. Jiang C, Xuan Z, Zhao F, Zhang MQ (2007) TRED: a transcriptional regulatory element database, new entries and other development. Nucleic acids research 35: D137–140.C. JiangZ. XuanF. ZhaoMQ Zhang2007TRED: a transcriptional regulatory element database, new entries and other development.Nucleic acids research35D137140
  79. 79. Crawford GE, Holt IE, Whittle J, Webb BD, Tai D, et al. (2006) Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS). Genome research 16: 123–131.GE CrawfordIE HoltJ. WhittleBD WebbD. Tai2006Genome-wide mapping of DNase hypersensitive sites using massively parallel signature sequencing (MPSS).Genome research16123131
  80. 80. Pederson JA, LaFollette JW, Gross C, Veraksa A, McGinnis W, et al. (2000) Regulation by homeoproteins: a comparison of deformed-responsive elements. Genetics 156: 677–686.JA PedersonJW LaFolletteC. GrossA. VeraksaW. McGinnis2000Regulation by homeoproteins: a comparison of deformed-responsive elements.Genetics156677686
  81. 81. Taylor MV (2006) Comparison of muscle development in Drosophila and vertebrates. In: H , editor. Muscle development in Drosophila: Landes BIoscience. MV Taylor2006Comparison of muscle development in Drosophila and vertebrates.H SMuscle development in Drosophila: Landes BIoscience
  82. 82. Zinzen RP, Girardot C, Gagneur J, Braun M, Furlong EE (2009) Combinatorial binding predicts spatio-temporal cis-regulatory activity. Nature 462: 65–70.RP ZinzenC. GirardotJ. GagneurM. BraunEE Furlong2009Combinatorial binding predicts spatio-temporal cis-regulatory activity.Nature4626570
  83. 83. Noyes MB, Christensen RG, Wakabayashi A, Stormo GD, Brodsky MH, et al. (2008) Analysis of homeodomain specificities allows the family-wide prediction of preferred recognition sites. Cell 133: 1277–1289.MB NoyesRG ChristensenA. WakabayashiGD StormoMH Brodsky2008Analysis of homeodomain specificities allows the family-wide prediction of preferred recognition sites.Cell13312771289
  84. 84. Reeves N, Posakony JW (2005) Genetic programs activated by proneural proteins in the developing Drosophila PNS. Dev Cell 8: 413–425.N. ReevesJW Posakony2005Genetic programs activated by proneural proteins in the developing Drosophila PNS.Dev Cell8413425
  85. 85. Carmena A, Bate M, Jiménez F (1995) lethal of scute, a proneural gene, participates in the specification of muscle progenitors during Drosophila embryogenesis. Genes Dev 9: 2373–2383.A. CarmenaM. BateF. Jiménez1995lethal of scute, a proneural gene, participates in the specification of muscle progenitors during Drosophila embryogenesis.Genes Dev923732383
  86. 86. Jakobsen JS, Braun M, Astorga J, Gustafson EH, Sandmann T, et al. (2007) Temporal ChIP-on-chip reveals Biniou as a universal regulator of the visceral muscle transcriptional network. Genes Dev 21: 2448–2460.JS JakobsenM. BraunJ. AstorgaEH GustafsonT. Sandmann2007Temporal ChIP-on-chip reveals Biniou as a universal regulator of the visceral muscle transcriptional network.Genes Dev2124482460
  87. 87. Junion G, Jagla T, Duplant S, Tapin R, Da Ponte JP, et al. (2005) Mapping Dmef2-binding regulatory modules by using a ChIP-enriched in silico targets approach. Proc Natl Acad Sci U S A 102: 18479–18484.G. JunionT. JaglaS. DuplantR. TapinJP Da Ponte2005Mapping Dmef2-binding regulatory modules by using a ChIP-enriched in silico targets approach.Proc Natl Acad Sci U S A1021847918484
  88. 88. Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, et al. (2004) Control of pancreas and liver gene expression by HNF transcription factors. Science 303: 1378–1381.DT OdomN. ZizlspergerDB GordonGW BellNJ Rinaldi2004Control of pancreas and liver gene expression by HNF transcription factors.Science30313781381
  89. 89. Sandmann T, Girardot C, Brehme M, Tongprasit W, Stolc V, et al. (2007) A core transcriptional network for early mesoderm development in Drosophila melanogaster. Genes Dev 21: 436–449.T. SandmannC. GirardotM. BrehmeW. TongprasitV. Stolc2007A core transcriptional network for early mesoderm development in Drosophila melanogaster.Genes Dev21436449
  90. 90. Sandmann T, Jensen LJ, Jakobsen JS, Karzynski MM, Eichenlaub MP, et al. (2006) A temporal map of transcription factor activity: mef2 directly regulates target genes at all stages of muscle development. Dev Cell 10: 797–807.T. SandmannLJ JensenJS JakobsenMM KarzynskiMP Eichenlaub2006A temporal map of transcription factor activity: mef2 directly regulates target genes at all stages of muscle development.Dev Cell10797807
  91. 91. Zeitlinger J, Zinzen RP, Stark A, Kellis M, Zhang H, et al. (2007) Whole-genome ChIP-chip analysis of Dorsal, Twist, and Snail suggests integration of diverse patterning processes in the Drosophila embryo. Genes Dev 21: 385–390.J. ZeitlingerRP ZinzenA. StarkM. KellisH. Zhang2007Whole-genome ChIP-chip analysis of Dorsal, Twist, and Snail suggests integration of diverse patterning processes in the Drosophila embryo.Genes Dev21385390
  92. 92. Ong CT, Corces VG (2011) Enhancer function: new insights into the regulation of tissue-specific gene expression. Nat Rev Genet 12: 283–293.CT OngVG Corces2011Enhancer function: new insights into the regulation of tissue-specific gene expression.Nat Rev Genet12283293
  93. 93. Klämbt C (1993) The Drosophila gene pointed encodes two ETS-like proteins which are involved in the development of midline glial cells. Development 117: 163–176.C. Klämbt1993The Drosophila gene pointed encodes two ETS-like proteins which are involved in the development of midline glial cells.Development117163176
  94. 94. Baylies MK, Bate M (1996) Twist: A myogenic switch in Drosophila. Science 272: 1481–1484.MK BayliesM. Bate1996Twist: A myogenic switch in Drosophila.Science27214811484
  95. 95. Michelson AM, Abmayr SM, Bate M, Martinez Arias A, Maniatis T (1990) Expression of a MyoD family member prefigures muscle pattern in Drosophila embryos. Genes Dev 4: 2086–2097.AM MichelsonSM AbmayrM. BateA. Martinez AriasT. Maniatis1990Expression of a MyoD family member prefigures muscle pattern in Drosophila embryos.Genes Dev420862097
  96. 96. Baylies MK, Arias AM, Bate M (1995) wingless is required for the formation of a subset of muscle founder cells during Drosophila embryogenesis. Development 121: 3829–3837.MK BayliesAM AriasM. Bate1995wingless is required for the formation of a subset of muscle founder cells during Drosophila embryogenesis.Development12138293837
  97. 97. Ranganayakulu G, Schulz RA, Olson EN (1996) Wingless signaling induces nautilus expression in the ventral mesoderm of the Drosophila embryo. Dev Biol 176: 143–148.G. RanganayakuluRA SchulzEN Olson1996Wingless signaling induces nautilus expression in the ventral mesoderm of the Drosophila embryo.Dev Biol176143148
  98. 98. Tomancak P, Berman BP, Beaton A, Weiszmann R, Kwan E, et al. (2007) Global analysis of patterns of gene expression during Drosophila embryogenesis. Genome Biol 8: R145.P. TomancakBP BermanA. BeatonR. WeiszmannE. Kwan2007Global analysis of patterns of gene expression during Drosophila embryogenesis.Genome Biol8R145
  99. 99. Robasky K, Bulyk ML (2011) UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res 39: D124–128.K. RobaskyML Bulyk2011UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.Nucleic Acids Res39D124128
  100. 100. Ramsay RG (2005) c-Myb a stem-progenitor cell regulator in multiple tissue compartments. Growth Factors 23: 253–261.RG Ramsay2005c-Myb a stem-progenitor cell regulator in multiple tissue compartments.Growth Factors23253261
  101. 101. Paululat A, Breuer S, Renkawitz-Pohl R (1999) Determination and development of the larval muscle pattern in Drosophila melanogaster. Cell Tissue Res 296: 151–160.A. PaululatS. BreuerR. Renkawitz-Pohl1999Determination and development of the larval muscle pattern in Drosophila melanogaster.Cell Tissue Res296151160
  102. 102. Claycomb JM, Orr-Weaver TL (2005) Developmental gene amplification: insights into DNA replication and gene expression. Trends Genet 21: 149–162.JM ClaycombTL Orr-Weaver2005Developmental gene amplification: insights into DNA replication and gene expression.Trends Genet21149162
  103. 103. Schwaiger M, Schubeler D (2006) A question of timing: emerging links between transcription and replication. Curr Opin Genet Dev 16: 177–183.M. SchwaigerD. Schubeler2006A question of timing: emerging links between transcription and replication.Curr Opin Genet Dev16177183
  104. 104. Ness SA (2003) Myb protein specificity: evidence of a context-specific transcription factor code. Blood Cells Mol Dis 31: 192–200.SA Ness2003Myb protein specificity: evidence of a context-specific transcription factor code.Blood Cells Mol Dis31192200
  105. 105. Shih HP, Gross MK, Kioussi C (2008) Muscle development: forming the head and trunk muscles. Acta Histochem 110: 97–108.HP ShihMK GrossC. Kioussi2008Muscle development: forming the head and trunk muscles.Acta Histochem11097108
  106. 106. Wardle FC, Papaioannou VE (2008) Teasing out T-box targets in early mesoderm. Curr Opin Genet Dev 18: 418–425.FC WardleVE Papaioannou2008Teasing out T-box targets in early mesoderm.Curr Opin Genet Dev18418425
  107. 107. Costello I, Pimeisl IM, Drager S, Bikoff EK, Robertson EJ, et al. (2011) The T-box transcription factor Eomesodermin acts upstream of Mesp1 to specify cardiac mesoderm during mouse gastrulation. Nature cell biology 13: 1084–1091.I. CostelloIM PimeislS. DragerEK BikoffEJ Robertson2011The T-box transcription factor Eomesodermin acts upstream of Mesp1 to specify cardiac mesoderm during mouse gastrulation.Nature cell biology1310841091
  108. 108. Jagla T, Bellard F, Lutz Y, Dretzen G, Bellard M, et al. (1998) ladybird determines cell fate decisions during diversification of Drosophila somatic muscles. Development 125: 3699–3708.T. JaglaF. BellardY. LutzG. DretzenM. Bellard1998ladybird determines cell fate decisions during diversification of Drosophila somatic muscles.Development12536993708
  109. 109. Dastjerdi A, Robson L, Walker R, Hadley J, Zhang Z, et al. (2007) Tbx1 regulation of myogenic differentiation in the limb and cranial mesoderm. Dev Dyn 236: 353–363.A. DastjerdiL. RobsonR. WalkerJ. HadleyZ. Zhang2007Tbx1 regulation of myogenic differentiation in the limb and cranial mesoderm.Dev Dyn236353363
  110. 110. Brohmann H, Jagla K, Birchmeier C (2000) The role of Lbx1 in migration of muscle precursor cells. Development 127: 437–445.H. BrohmannK. JaglaC. Birchmeier2000The role of Lbx1 in migration of muscle precursor cells.Development127437445
  111. 111. Gross MK, Moran-Rivard L, Velasquez T, Nakatsu MN, Jagla K, et al. (2000) Lbx1 is required for muscle precursor migration along a lateral pathway into the limb. Development 127: 413–424.MK GrossL. Moran-RivardT. VelasquezMN NakatsuK. Jagla2000Lbx1 is required for muscle precursor migration along a lateral pathway into the limb.Development127413424
  112. 112. Pederson JD, Kiehart DP, Mahaffey JW (1996) The role of HOM-C genes in segmental transformations: reexamination of the Drosophila Sex combs reduced embryonic phenotype. Dev Biol 180: 131–142.JD PedersonDP KiehartJW Mahaffey1996The role of HOM-C genes in segmental transformations: reexamination of the Drosophila Sex combs reduced embryonic phenotype.Dev Biol180131142
  113. 113. Weatherbee SD, Nijhout HF, Grunert LW, Halder G, Galant R, et al. (1999) Ultrabithorax function in butterfly wings and the evolution of insect wing patterns. Curr Biol 9: 109–115.SD WeatherbeeHF NijhoutLW GrunertG. HalderR. Galant1999Ultrabithorax function in butterfly wings and the evolution of insect wing patterns.Curr Biol9109115
  114. 114. Galant R, Carroll SB (2002) Evolution of a transcriptional repression domain in an insect Hox protein. Nature 415: 910–913.R. GalantSB Carroll2002Evolution of a transcriptional repression domain in an insect Hox protein.Nature415910913
  115. 115. Bischof J, Maeda RK, Hediger M, Karch F, Basler K (2007) An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc Natl Acad Sci U S A 104: 3312–3317.J. BischofRK MaedaM. HedigerF. KarchK. Basler2007An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases.Proc Natl Acad Sci U S A10433123317
  116. 116. Clyne PJ, Certel SJ, de Bruyne M, Zaslavsky L, Johnson WA, et al. (1999) The odor specificities of a subset of olfactory receptor neurons are governed by Acj6, a POU-domain transcription factor. Neuron 22: 339–347.PJ ClyneSJ CertelM. de BruyneL. ZaslavskyWA Johnson1999The odor specificities of a subset of olfactory receptor neurons are governed by Acj6, a POU-domain transcription factor.Neuron22339347
  117. 117. Barolo S, Carver LA, Posakony JW (2000) GFP and beta-galactosidase transformation vectors for promoter/enhancer analysis in Drosophila. Biotechniques 29: 726.728730732S. BaroloLA CarverJW Posakony2000GFP and beta-galactosidase transformation vectors for promoter/enhancer analysis in Drosophila.Biotechniques29726728730732
  118. 118. Bailey TL, Elkan C (1994) Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2: 28–36.TL BaileyC. Elkan1994Fitting a mixture model by expectation maximization to discover motifs in biopolymers.Proc Int Conf Intell Syst Mol Biol22836
  119. 119. Matys V, Kel-Margoulis OV, Fricke E, Liebich I, Land S, et al. (2006) TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes. Nucleic Acids Res 34: D108–110.V. MatysOV Kel-MargoulisE. FrickeI. LiebichS. Land2006TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes.Nucleic Acids Res34D108110
  120. 120. Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. J Roy Statist Soc Ser B 57: 289–300.Y. BenjaminiY. Hochberg1995Controlling the false discovery rate: a practical and powerful approach to multiple testing.J Roy Statist Soc Ser B57289300
  121. 121. Chang C, Lin C (2011) LIBSVM: a library for support vector machines. ACM Transactions on Intelligent Systems and Technology 2: 27:1–27:27.C. ChangC. Lin2011LIBSVM: a library for support vector machines.ACM Transactions on Intelligent Systems and Technology227:127:27
  122. 122. Shawe-Taylor J, Cristianini N (2002) On the Generalization of Soft Margin Algorithms. IEEE Transactions on Information Theory 48: 2721–2735.J. Shawe-TaylorN. Cristianini2002On the Generalization of Soft Margin Algorithms.IEEE Transactions on Information Theory4827212735
  123. 123. Guyon I, Weston J, Barnhill S, Vapnik V (2002) Gene Selection for Cancer Classification using Support Vector Machines. Machine Learning 46: 389–422.I. GuyonJ. WestonS. BarnhillV. Vapnik2002Gene Selection for Cancer Classification using Support Vector Machines.Machine Learning46389422
  124. 124. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, et al. (2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102: 15545–15550.A. SubramanianP. TamayoVK MoothaS. MukherjeeBL Ebert2005Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles.Proc Natl Acad Sci U S A1021554515550
  125. 125. Siepel A, Bejerano G, Pedersen JS, Hinrichs AS, Hou M, et al. (2005) Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes. Genome research 15: 1034–1050.A. SiepelG. BejeranoJS PedersenAS HinrichsM. Hou2005Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomes.Genome research1510341050
  126. 126. Berger MF, Badis G, Gehrke AR, Talukder S, Philippakis AA, et al. (2008) Variation in homeodomain DNA binding revealed by high-resolution analysis of sequence preferences. Cell 133: 1266–1276.MF BergerG. BadisAR GehrkeS. TalukderAA Philippakis2008Variation in homeodomain DNA binding revealed by high-resolution analysis of sequence preferences.Cell13312661276