Command line Training Set First Motif Summary of Motifs Termination Explanation


Search sequence databases with these motifs using MAST.
Submit these motifs to BLOCKS multiple alignment processor.
Build and use a motif-based hidden Markov model (HMM) using Meta-MEME.


MEME - Motif discovery tool

MEME version 3.5.7 (Release date: 2007-12-17 16:56:19 -0800 (Mon, 17 Dec 2007))

For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.

This file may be used as input to the MAST algorithm for searching sequence databases for matches to groups of motifs. MAST is available for interactive use and downloading at http://meme.nbcr.net.


REFERENCE

If you use this program in your research, please cite:

Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994.


TRAINING SET

DATAFILE= msl1_as_top20.fasta
ALPHABET= ACGT
Sequence name            Weight Length  Sequence name            Weight Length  
-------------            ------ ------  -------------            ------ ------  
chr3R_14070286_14070634  1.0000    349  chr2L_4973579_4974189    1.0000    611  
chr3L_9331880_9332156    1.0000    277  chr2R_1749168_1749692    1.0000    525  
chr3R_27573369_27573630  1.0000    262  chr2L_2129234_2129659    1.0000    426  
chr3R_17486358_17486706  1.0000    349  chr3R_14409892_14410427  1.0000    536  
chr2L_2196643_2196904    1.0000    262  chr2R_3428309_3428737    1.0000    429  
chr2L_2884920_2885214    1.0000    295  chr3R_18193983_18194441  1.0000    459  
chr2R_4641252_4641965    1.0000    714  chr3R_17848559_17848922  1.0000    364  
chr3R_11619615_11620249  1.0000    635  chr3R_20596837_20597185  1.0000    349  
chr2L_2038465_2038988    1.0000    524  chr2R_2383963_2384959    1.0000    997  
chr2L_15742624_15743270  1.0000    647  chr3R_11234319_11234687  1.0000    369  

COMMAND LINE SUMMARY

This information can also be useful in the event you wish to report a
problem with the MEME software.

command: meme msl1_as_top20.fasta -dna -mod anr -nmotifs 5 -minw 6 -maxw 50 -dir /Users/tobiasst 

model:  mod=           anr    nmotifs=         5    evt=           inf
object function=  E-value of product of p-values
width:  minw=            6    maxw=           50    minic=        0.00
width:  wg=             11    ws=              1    endgaps=       yes
nsites: minsites=        2    maxsites=       50    wnsites=       0.8
theta:  prob=            1    spmap=         uni    spfuzz=        0.5
em:     prior=   dirichlet    b=            0.01    maxiter=        50
        distance=    1e-05
data:   n=            9379    N=              20
strands: +
sample: seed=            0    seqfrac=         1
Letter frequencies in dataset:
A 0.276 C 0.223 G 0.218 T 0.284 
Background letter frequencies (from dataset with add-one prior applied):
A 0.276 C 0.223 G 0.218 T 0.283 

P N
MOTIF 1     width = 21     sites = 10     llr = 172     E-value = 5.0e-007

SimplifiedA2:5:2:2:1:::21:::2::5
pos.-specificC1a:::2:3:22::3:::::::
probabilityG7:325:7:8:83718:a:914
matrixT::28381718:7152a:8191
bits 2.2  
2.0  
1.8    
1.5     
Information 1.3       
content 1.1              
(24.8 bits)0.9                 
0.7                  
0.4                    
0.2                     
0.0
Multilevel GCATGTGTGTGTGTGTGTGTA
consensus AGGTCACCCGACTAG
sequence TA
NAME   START P-VALUE    SITES 
chr3R_14409892_144104275167.22e-13 CCAAACGTGTGCGTGTGTGTGTGTGTGTGTA
chr3R_11619615_116202493591.92e-12 GTGTGTGCTAGCATGTGCGTGTGTGTGTGTAAAGGCGCGAG
chr3R_17486358_17486706593.26e-10 GACCAACTGGCCGTTTGTGTGTGCGTGTGTGTCCGCGGGCT
chr3R_11619615_116202495663.63e-10 GTCAGTCCCTGCATATGTTTGTGTGTGTGTGTTCTATACAG
chr2R_1749168_17496921524.55e-09 GTACGTATCTGCATGTATGTGTATGTGTTTGGACTGTCTCG
chr3R_11619615_116202493352.89e-08 AGTGGCGCATACAGTTGCACGTGTGTGTGTGCTAGCATGTG
chr2L_2038465_20389883625.98e-08 TAACAAAATAACTTATTTGTGGGCTTGTGTATCGCCATATC
chr3R_11619615_116202491487.63e-08 GTGTGTTCTTGCTTGCATGTGTTAGTGAGTACGATTACTTT
chr3R_14409892_144104273599.10e-08 GACACTAGTCGCAGTCGCGCCGGCGTGTGGAGCAGAATACA
chr3R_27573369_275736302331.41e-07 GCGAAGCGTGGCGTGTGTGTCGAGTTGAGTTACCTGTAAT

Motif 1 block diagrams

NameLowest
p-value
   Motifs
chr3R_14409892_14410427 9.1e-08

1
1
chr3R_11619615_11620249 7.6e-08

1
1
1
1
chr3R_17486358_17486706 3.3e-10

1
chr2R_1749168_1749692 4.5e-09

1
chr2L_2038465_2038988 6e-08

1
chr3R_27573369_27573630 1.4e-07

1
SCALE
| | | | | | | | | | | | | | | | | | | | | | | | | |
1 25 50 75 100 125 150 175 200 225 250 275 300 325 350 375 400 425 450 475 500 525 550 575 600 625

Motif 1 in BLOCKS format


to BLOCKS multiple alignment processor.
Motif 1 position-specific scoring matrix


Motif 1 position-specific probability matrix


to known motifs in JASPAR database:
Motif 1 regular expression

[GA]C[AGT][TG][GTA][TC][GA][TC]G[TC][GC][TG][GA][TC][GT]TG[TA]GT[AG]




Time 16.01 secs.


P N
MOTIF 2     width = 21     sites = 12     llr = 180     E-value = 5.9e-004

SimplifiedA1812:8:8:328:8233319:
pos.-specificC8382a27:918:3:8:618:8
probabilityG::23:1:1:213:21326::2
matrixT2::3::3215::7::4::111
bits 2.2 
2.0 
1.8  
1.5   
Information 1.3     
content 1.1              
(21.6 bits)0.9                 
0.7                  
0.4                   
0.2                    
0.0
Multilevel CACGCACACTCATACTCGCAC
consensus CTTAGCGAA
sequence A
NAME   START P-VALUE    SITES 
chr3R_20596837_205971852345.79e-13 ACACTACCACCACTCACACTCATACTCGCACTGGCACTCGC
chr3R_17848559_178489222746.33e-10 CCATTCCCCACACTCCCACGCACACGCACACGAGTCCTGCG
chr2R_2383963_2384959934.29e-09 ACACTCGGCGCACACATGCTCACACGCACACACACGTATGG
chr3R_18193983_181944413855.94e-09 TTTTGTTTACCACGCACACACATACTGACATCACGTGTCCA
chr2R_2383963_2384959592.41e-08 CACAAGAAAGCACGCACACCAGCGCACGCACGCCACACTCG
chr3R_17486358_174867062575.38e-08 TGCACGCACGCACCCACACAAATACAAGAACGGGCCCATAT
chr3R_20596837_205971852138.19e-08 GCGTGAGCGGACCACACACTCACACTACCACCACTCACACT
chr2L_2196643_21969041782.41e-07 ACTATTCACTCACTCGTACTCGTAGTCGTACTCGTATCCTC
chr2L_4973579_49741893952.41e-07 CCCTGGCTGCCAGCCATTCACATACGAACAGCTGTTTTTTC
chr3R_17486358_174867062352.78e-07 CAAGGAAAAATCATCATACTCGTGCACGCACGCACCCACAC
chr3R_18193983_181944411894.51e-07 AGTAGATGCTCACGCACTTGCATAATGGCAGTGCGAGCGAG
chr2L_2038465_2038988272.25e-06 CCTTTGTTCATCGGCCCACTGATAAGCGCTCGAATGATAGG

Motif 2 block diagrams

NameLowest
p-value
   Motifs
chr3R_20596837_20597185 8.2e-08

2 2
chr3R_17848559_17848922 6.3e-10

2
chr2R_2383963_2384959 4.3e-09

2
2
chr3R_18193983_18194441 4.5e-07

2
2
chr3R_17486358_17486706 5.4e-08

2
2
chr2L_2196643_2196904 2.4e-07

2
chr2L_4973579_4974189 2.4e-07

2
chr2L_2038465_2038988 2.2e-06

2
SCALE
| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
1 25 50 75 100 125 150 175 200 225 250 275 300 325 350 375 400 425 450 475 500 525 550 575 600 625 650 675 700 725 750 775 800 825 850 875 900 925 950 975

Motif 2 in BLOCKS format


to BLOCKS multiple alignment processor.
Motif 2 position-specific scoring matrix


Motif 2 position-specific probability matrix


to known motifs in JASPAR database:
Motif 2 regular expression

C[AC]C[GT]CA[CT]AC[TA]C[AG][TC]AC[TGA][CA][GA]CAC




Time 31.70 secs.


P N
MOTIF 3     width = 28     sites = 5     llr = 125     E-value = 1.5e-001

SimplifiedA:6:4:aaa26:4282:4268:a:68a6:
pos.-specificC:::4:::::4:4:2262::2:::2:::4
probabilityG82a:a:::8:a26:64484:a:622:26
matrixT22:2::::::::2:::::::::4:::2:
bits 2.2    
2.0    
1.8         
1.5         
Information 1.3              
content 1.1                    
(36.1 bits)0.9                    
0.7                       
0.4                            
0.2                            
0.0
Multilevel GAGAGAAAGAGAGAGCAGAAGAGAAAAG
consensus TGCACCACAGGAGCTCGGC
sequence TTGTCCGT
NAME   START P-VALUE    SITES 
chr3R_18193983_181944411486.03e-16 CACTCACGATGAGCGAAAGAGAGAGCGGAAGATAAAAGGAAAGTAGAT
chr3R_11234319_112346873379.36e-13 CAGCAGAAACGGGCGAAAGAGGAAACAGAAGAGAAAAGAAGCA
chr3R_14070286_14070634831.27e-12 CGCGCGAAGAGAGAGAAAGAGCGCGGCGGAGAGCGAAGCGGAGCGGCA
chr2L_15742624_157432701181.59e-11 AGAACAGAGCGTGAGAAAGCGAGACGGGGCGATGAAGCCGCTGGTGGC
chr2L_2038465_20389882244.61e-11 TTAATTAATGTAGTGAAAACGCTAGCAAAAGAGAAATCGCGAACGGTA

Motif 3 block diagrams

NameLowest
p-value
   Motifs
chr3R_18193983_18194441 6e-16

3
chr3R_11234319_11234687 9.4e-13

3
chr3R_14070286_14070634 1.3e-12

3
chr2L_15742624_15743270 1.6e-11

3
chr2L_2038465_2038988 4.6e-11

3
SCALE
| | | | | | | | | | | | | | | | | | | | | | | | | |
1 25 50 75 100 125 150 175 200 225 250 275 300 325 350 375 400 425 450 475 500 525 550 575 600 625

Motif 3 in BLOCKS format


to BLOCKS multiple alignment processor.
Motif 3 position-specific scoring matrix


Motif 3 position-specific probability matrix


to known motifs in JASPAR database:
Motif 3 regular expression

[GT][AGT]G[ACT]GAAA[GA][AC]G[ACG][GAT][AC][GAC][CG][AGC][GA][AG][AC]GA[GT][ACG][AG]A[AGT][GC]




Time 46.94 secs.


P N
MOTIF 4     width = 15     sites = 16     llr = 175     E-value = 3.6e-001

SimplifiedA6a8243a55aaa315
pos.-specificC:::2:7:2::::341
probabilityG4::1:::1::::134
matrixT::256::25:::32:
bits 2.2
2.0
1.8     
1.5     
Information 1.3     
content 1.1        
(15.8 bits)0.9          
0.7           
0.4            
0.2              
0.0
Multilevel AAATTCAAAAAAACA
consensus GAATTGG
sequence C
NAME   START P-VALUE    SITES 
chr3R_11619615_116202492882.27e-07 GAGACATGTGGAATACAATAAATGAGATTGTGTAA
chr2L_2129234_21296592282.27e-07 ACTCGCAGCTGAATACAAAAAATGAAAAGAAAACA
chr2L_2196643_21969041322.67e-07 GCCCGTCACAAAATTCACAAAACCGCTACGAATAT
chr2R_4641252_46419651084.09e-07 CGCATTTAACAAATTAAATAAATCGCAATTTTGCA
chr3R_11619615_116202494217.31e-07 TGTAGTGGAAAAACTCAATAAACGGAATTACATAA
chr3L_9331880_9332156888.97e-07 AGCAAAACAAAAATTAAATAAAAGGAATAAGTGGA
chr3R_27573369_27573630641.28e-06 GCGATACAAAAAAGTCAATAAAAGGGTGAAAAGCG
chr3R_14409892_144104273835.37e-06 GTGTGGAGCAGAATACAAAAAAAAAGTAGCAGCAA
chr3L_9331880_93321562057.27e-06 TTATCAGTGCAAACAAACAAAAACAATTCTTTCCC
chr2R_2383963_23849598487.84e-06 AGAGCTGTCGGAACTAAGAAAATCGCGAAAACATA
chr2L_2038465_20389883127.84e-06 GCAAAGCGAAGAAGTCATTAAAGCATTGAGATTTC
chr3R_11619615_116202494367.84e-06 CAATAAACGGAATTACATAAAAACATGGTGGCATG
chr3R_14409892_144104274681.42e-05 TCCTTGCCGAGAAATCAATAAAGCCCTAAATGAAA
chr2L_4973579_49741893251.42e-05 AGCATTTCTAAATTTCACAAAACTAAATTGAACGA
chr3R_11234319_112346871072.35e-05 AGTACGCAGGGAAAAAATAAAATTAGCAACAAAAG
chr2L_4973579_49741895253.03e-05 AATAGTGAATAATAACAGTAAACTGCTAGTTCGTT

Motif 4 block diagrams

NameLowest
p-value
   Motifs
chr3R_11619615_11620249 7.8e-06

4
4 4
chr2L_2129234_2129659 2.3e-07

4
chr2L_2196643_2196904 2.7e-07

4
chr2R_4641252_4641965 4.1e-07

4
chr3L_9331880_9332156 7.3e-06

4
4
chr3R_27573369_27573630 1.3e-06

4
chr3R_14409892_14410427 1.4e-05

4
4
chr2R_2383963_2384959 7.8e-06

4
chr2L_2038465_2038988 7.8e-06

4
chr2L_4973579_4974189 1.4e-05

4
4
chr3R_11234319_11234687 2.3e-05

4
SCALE
| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
1 25 50 75 100 125 150 175 200 225 250 275 300 325 350 375 400 425 450 475 500 525 550 575 600 625 650 675 700 725 750 775 800 825 850 875 900 925 950 975

Motif 4 in BLOCKS format


to BLOCKS multiple alignment processor.
Motif 4 position-specific scoring matrix


Motif 4 position-specific probability matrix


to known motifs in JASPAR database:
Motif 4 regular expression

[AG]AAT[TA][CA]AA[AT]AAA[ATC][CG][AG]




Time 61.79 secs.


P N
MOTIF 5     width = 50     sites = 5     llr = 174     E-value = 1.5e+001

SimplifiedA::::::2:::2:62::::::::4:::2244::2:26:::::::::4:2::
pos.-specificC:82::a2626:8248::84:a6266:262248:a2::68864:a428442
probabilityG4:8:8:2:6:22:2264248::2222222:2:6:4:82:222a:2422:8
matrixT62:a2:44246:22:46:22:422284:24422:24222:24::4::26:
bits 2.2     
2.0     
1.8      
1.5             
Information 1.3                   
content 1.1                          
(50.3 bits)0.9                            
0.7                                    
0.4                                           
0.2                                              
0.0
Multilevel TCGTGCTCGCTCACCGTCCGCCACCTTCAACCGCGAGCCCCCGCCACCTG
consensus GTCTATCTAGCAGTGGGTTCGGGAACTTTAATTGTGGTTGGACC
sequence CTGTGTGTTCGGCGTCTTGGCG
GTTGTTT
NAME   START P-VALUE    SITES 
chr2L_2196643_2196904761.71e-18 TTCATCCCTTTCGTGCCCGCACAACGTCCGCCAGCTACCAGCGCGAGCTCCTGCTGGCCCGTCACAAAAT
chr2R_2383963_23849596036.71e-18 AGCGCAGTTCGCGTTCACGTTCACCGGGCGCTGCGTTCATCCGCGTGGCGTTGCCACCTGGGCCGAAACT
chr3R_17848559_178489221263.05e-16 CCTGCTCTGCTCGTGCTCCTGCTCCTTCGGCTACCGTAAATTTCAAGTCCCGGCGGCGTGAATTAAATAT
chr3R_14070286_140706342443.05e-16 CAGCCTTTAAGTGTGCTTTCTCAGGTGCTGCCCCCTGCGCCCACCATCCCCCGCTCCATGCTCTTTCCAT
chr3R_17848559_178489222981.66e-15 CGCACACGAGTCCTGCGTGCTGCTCGTCGTCCTTTTCGTTTCGCTTGCCCGCGCCACTCGAATTTGATCA

Motif 5 block diagrams

NameLowest
p-value
   Motifs
chr2L_2196643_2196904 1.7e-18

5
chr2R_2383963_2384959 6.7e-18

5
chr3R_17848559_17848922 3e-16

5
5
chr3R_14070286_14070634 3e-16

5
SCALE
| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
1 25 50 75 100 125 150 175 200 225 250 275 300 325 350 375 400 425 450 475 500 525 550 575 600 625 650 675 700 725 750 775 800 825 850 875 900 925 950 975

Motif 5 in BLOCKS format


to BLOCKS multiple alignment processor.
Motif 5 position-specific scoring matrix


Motif 5 position-specific probability matrix


to known motifs in JASPAR database:
Motif 5 regular expression

[TG][CT][GC]T[GT]C[TACGA][CT][GCT][CT][TAG][CG][ACT][CAGTA][CG][GT][TG][CG][CGT][GT]C[CT][ACGTC][CGT][CGT][TG][TACGA][CAG][ACGTC][ATC][CTG][CT][GAT]C[GACTA][AT][GT][CGT][CT][CG][CGT][CTG]GC[CTG][AGC][CG][CAGTA][TC][GC]




Time 75.92 secs.


P N
SUMMARY OF MOTIFS


Combined block diagrams: non-overlapping sites with p-value < 0.0001

NameCombined
p-value
   Motifs
chr3R_14070286_14070634 4.64e-18

3
5
5
chr2L_4973579_4974189 3.11e-04

4
2
4
chr3L_9331880_9332156 4.63e-03

4
4
chr2R_1749168_1749692 6.81e-06

1
3
chr3R_27573369_27573630 2.94e-05

4
1
chr2L_2129234_2129659 3.49e-03

4
chr3R_17486358_17486706 6.46e-10

1
2
2
chr3R_14409892_14410427 1.84e-10

5
1
4
4
1
chr2L_2196643_2196904 5.20e-21

5
4
2
chr2R_3428309_3428737 3.19e-01

chr2L_2884920_2885214 8.93e-02

chr3R_18193983_18194441 4.46e-16

3
2
2
chr2R_4641252_4641965 1.12e-02

4
chr3R_17848559_17848922 6.68e-17

5
2
5
chr3R_11619615_11620249 2.83e-10

4
1
4
1
1
4 4
1
chr3R_20596837_20597185 4.00e-09

5
2 2
chr2L_2038465_2038988 1.25e-13

2
3
2
4
1
chr2R_2383963_2384959 1.25e-17

2
2
5
4
chr2L_15742624_15743270 1.28e-05

3
chr3R_11234319_11234687 4.09e-08

4
3
SCALE
| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
1 25 50 75 100 125 150 175 200 225 250 275 300 325 350 375 400 425 450 475 500 525 550 575 600 625 650 675 700 725 750 775 800 825 850 875 900 925 950 975

Motif summary in machine readable format.
Stopped because nmotifs = 5 reached.


CPU: p338i-005.win.med.uni-muenchen.de


EXPLANATION OF MEME RESULTS

The MEME results consist of:

MOTIFS

For each motif that it discovers in the training set, MEME prints the following information:


Go to top